| Literature DB >> 27531992 |
Pratiksha V Bhat1, Farhath Khanum1, Anand Tamatam1.
Abstract
Ochratoxin-A (OTA), is toxic secondary metabolite and is found to be a source of vast range of toxic effects like hepatotoxicity, nephrotoxicity. However, the information available currently regarding neurotoxic effects exerted by OTA is scanty. Hence, the present study was aimed to evaluate the neurotoxic effects of OTA and the possible mechanisms of toxicity as well as the role of cytotoxic oxidative stress on neuronal (Neuro-2a) cell line was evaluated in vitro. Results of the MTT and LDH assay showed that, OTA induced dose-dependent cell death in Neuro-2a cells and EC50 value was determined as 500 nM. OTA induced high levels of reactive oxygen species (ROS) and elevated levels of malondialdehyde, also loss of mitochondrial membrane potential was observed in a dose depended manner. Effects of OTA on ROS induced chromosomal DNA damage was assessed by Comet assay and plasmid DNA damage assay in which increase in DNA damage was observed in Neuro-2a cells by increasing the OTA concentration. Further western blotting analysis of OTA treated Neuro-2a cells indicated elevated expression levels of c-Jun, JNK3 and cleaved caspase-3 leading to apoptotic cell death. Other hand realtime-Q-PCR analysis clearly indicates the suppressed expression of neuronal biomarker genes including AChE, BDNF, TH and NOS2. Further N-acetylcysteine (NAC) pretreatment to Neuro-2a cells followed by OTA treatment clearly evidenced that, the significant reversal of toxic effects exerted by OTA on Neuro-2a cells. In the present study, results illustrate that ROS a principle event in oxidative stress was elevated by OTA toxicity in Neuro-2a cells. However, further in vivo, animal studies are in need to conclude the present study reports and the use of NAC as a remedy for OTA induced neuronal stress.Entities:
Keywords: N-acetylcysteine; Neuro-2a; Ochratoxin-A; apoptosis; c-Jun N-terminal kinases; reactive oxygen species
Year: 2016 PMID: 27531992 PMCID: PMC4969303 DOI: 10.3389/fmicb.2016.01142
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Primers sequences used for quantitative PCR.
| Gene | Primers | Product Size (bp) | |
|---|---|---|---|
| 18S RNA | Forward -5′AGGCGCGCAAATTACCCACTC 3′ | 477–497 | 277 |
| Reverse-5′GCCCGCTCCCAAGATCCAAC 3′ | 681–700 | ||
| AChE | Forward-5′TCGCAGCCTTTGGGGGAGAC 3′ | 653–672 | 227 |
| Reverse-5′AGCGCCACCTGGGGGACA 3′ | 862–879 | ||
| BDNF | Forward-5′CGGCCCAACGAAGAAAACCATAA 3′ | 607–629 | 154 |
| Reverse-5′GGCGCCGAACCCTCATAGACAT 3′ | 739–760 | ||
| NOS2 | Forward -5′GCCCCACGGAGAACAGCAGAG 3′ | 143–163 | 284 |
| Reverse -5′GGGCGGGTCGATGGAGTCAC 3′ | 407–426 | ||
| TH | Forward -5′TCGGAAGCTGATTGCAGAGA 3′ | 620–639 | 96 |
| Reverse -5′TTCCGCTGTGTATTCCACATG 3′ | 695–715 | ||
Effect of NAC on antioxidant status.
| Superoxide dismutase (SOD) (U/mg of protein) | CAT (mM H2O2 degraded/min/ mg of protein) | GPx (U/mg of protein) | GR (U/mg of protein) | GSH (μM/mg of protein) | TAC (nmol/mg of protein) | |
|---|---|---|---|---|---|---|
| CON | 1.89 ± 0.09 | 0.88 ± 0.03 | 1058.77 ± 57.82 | 1017.06 ± 51.30 | 4.05 ± 0.02 | 42.23 ± 3.12 |
| 1.91 ± 0.03 | 0.91 ± 0.05 | 1050.73 ± 44.37 | 1046.16 ± 42.64 | 3.96 ± 0.02 | 54.87 ± 2.43 | |
| Ochratoxin A (OTA) | 1.20 ± 0.05∗ | 0.51 ± 0.03∗ | 580.57 ± 36.49∗ | 597.21 ± 29.69∗ | 1.69 ± 0.04∗ | 21.12 ± 3.53∗ |
| OTA+NAC | 1.68 ± 0.08# | 0.70 ± 0.05# | 900.61 ± 33.45# | 899.32 ± 52.59# | 2.94 ± 0.05# | 32.01 ± 2.13# |