Literature DB >> 27531140

Iron-regulated gene ireA in avian pathogenic Escherichia coli participates in adhesion and stress-resistance.

Yaxin Li1, Jianjun Dai1, Xiangkai Zhuge1, Haojin Wang1, Lin Hu1, Jianluan Ren1, Ling Chen1, Dezhi Li1, Fang Tang2.   

Abstract

BACKGROUND: Avian pathogenic Escherichia coli (APEC) causes avian colibacillosis, which results in economic and welfare costs in the poultry industry worldwide. The pathogenesis of avian pathogenic E. coli strains is not well defined. Here, the function of an outer membrane protein encoded by the ireA gene of avian pathogenic E. coli strain DE205B was investigated.
RESULTS: The ireA gene was distributed in 32.9 % (46/140) of tested E. coli strains, with high percentages in the phylogenetic ECOR groups B2 (58.8 %, 10/17) and D (55.9 %, 19/34). The gene expression level of ireA of APEC strain DE205B in high Fe M9 media was 1.8 times higher (P < 0.05) than that in low Fe M9 media. An ireA deletion mutant and complementary strain were constructed. Compared with the wild-type strain DE205B, the expression of most ferric uptake genes in the ireA deletion mutant were significantly upregulated (P < 0.05). The adhesion ability of the ireA deletion mutant to DF-1 cells was significantly decreased. The survival rate of ireA deletion mutant was reduced 21.17 % (P < 0.01), 25.42 (P < 0.05) and 70.0 % (P < 0.01) under alkali, high osmolarity, and low temperature (4 °C) conditions, respectively, compared with the wild-type strain.
CONCLUSIONS: The results suggested that the protein encoded by the iron-regulated gene ireA has roles in adhesion and stress resistance in avian pathogenic E. coli.

Entities:  

Keywords:  APEC; Adhesion; IreA; Stress resistance; Virulence

Mesh:

Substances:

Year:  2016        PMID: 27531140      PMCID: PMC4988017          DOI: 10.1186/s12917-016-0800-y

Source DB:  PubMed          Journal:  BMC Vet Res        ISSN: 1746-6148            Impact factor:   2.741


Background

Avian pathogenic Escherichia coli (APEC), a subgroup of extra-intestinal pathogenic E. coli (ExPEC) causes avian colibacillosis and imposes economic losses on the poultry industry worldwide [1]. However, the pathogenesis of APEC is poorly understood. Many virulence genes have been studied to identify virulence factors in APEC, including those involved in adhesion, iron-regulation, toxin/cytotoxin production and serum resistance [2]. Iron is an essential element involved in important biological processes [3]. Biological activities in cells, such as peroxide reduction, nucleotide biosynthesis and electron transport, are facilitated by iron ions [4]. Extra-intestinal sites have low iron contents; therefore, ExPEC strains struggle to take up iron from the host during infection [5]. During natural infection, the initiation, progression and transmission of most bacterial infections depend on the ability of the invading pathogen to acquire iron from the complicated environment [6]. During iron acquisition, the cell must produce transmembrane receptors for siderophores that chelate iron ions [7]. There are various receptors that chelate iron ions encoded by bacterial genes, such as chuA, the SitABCD system, iron, iha, iutA, and ireA. Outer membrane protein ChuA participates in heme acquisition in enterohemorrhagic E. coli and uropathogenic E. coli (UPEC) strains, and is important for the pathogenicity of APEC [8, 9]. The SitABCD system, identified in the APEC strain MT512 by comparative genomic analysis, was reported to be associated with the pathogenicity of APEC [9, 10]. IreA was suggested to be involved in Fe acquisition and to act as an iron-regulated virulence gene in the blood- or urine-derived ExPEC E. coli isolated from humans [11]; however, its exact role in APEC strains remains unknown. Herein, an ireA deletion mutant was constructed to study the ireA gene function in the APEC strain DE205B.

Results

Prevalence of the ireA gene among E. coli Strains

As shown in Table 1, ireA was present in 32.9 % (46/140) of E. coli strains, with 19.0 % (12/63) in phylogenetic ECOR group A, 19.2 % (5/26) in B1, 58.8 % (10/17) in B2 and 55.9 % (19/34) in group D (Additional file 1: Table S1). Thus, the ireA gene was significantly more frequently distributed in the B2 and D groups than in the A and B1 groups.
Table 1

Distribution of the ireA gene in Escherichia coli strains

ECOR groupStrain countsStrain counts positive for ireA Percentage
A631219.0 %
B126519.2 %
B2171058.8 %
D341955.9 %
Total1404632.9 %
Distribution of the ireA gene in Escherichia coli strains

Expression of the ireA gene

The ireA gene expression was tested by Immunoblotting. Western blotting was performed with anti-His serum, showing expected fusion protein bands for ireA (39 kDa) from strains DE205B. However, only fusion his protein (18 kDa) was detected from the blank plasmid control (Fig. 1). These results indicated that ireA was expressed under laboratory conditions.
Fig. 1

Expression of ireA by western blotting. Expression of fusion ireA protein was detected by immunoblotting. Fusion ireA was detected in pET32a(+), while there is only his protein was detected in the blank plasmid. Lane M, protein marker; lane 1, fusion ireA; lane 2, fusion his

Expression of ireA by western blotting. Expression of fusion ireA protein was detected by immunoblotting. Fusion ireA was detected in pET32a(+), while there is only his protein was detected in the blank plasmid. Lane M, protein marker; lane 1, fusion ireA; lane 2, fusion his

Gene expression of ireA in M9 media with different iron content

The relative gene expression of ireA in low Fe M9 media was 1.8 times higher than that in high Fe M9 media (P < 0.01) (Fig. 2).
Fig. 2

Expression of ireA in M9 media. The first and second columns represent the relative gene expressions of ireA in M9 media with low and high Fe content, respectively. The gene expression levels showed significant differences in the two kinds of media (P < 0.01)

Expression of ireA in M9 media. The first and second columns represent the relative gene expressions of ireA in M9 media with low and high Fe content, respectively. The gene expression levels showed significant differences in the two kinds of media (P < 0.01)

Growth curve

The CFU of the wild-type strain DE205B, mutant strain DE205BΔireA and the complementary strain DE205BCΔireA was monitored for 12 h. There was no significant difference between the growth curves of the wild-type and mutant strains (Fig. 3), which indicated that deletion of ireA had no effects on the growth of DE205B.
Fig. 3

Growth curve of different strains. Growth curves of the wild-type strain DE205B, mutant strain DE205BΔireA and complementary strain DE205BCΔireA. Bacterial growth was estimated by plate counting as Colony Forming Units (CFU)

Growth curve of different strains. Growth curves of the wild-type strain DE205B, mutant strain DE205BΔireA and complementary strain DE205BCΔireA. Bacterial growth was estimated by plate counting as Colony Forming Units (CFU)

Expression variations of Ferric uptake system and adherence genes

The expressions of fepC, feoB, chuT, fyuA, irp1, irp2, chuA and fepA were detected in the mutant and compared with their expressions in the wild-type strain DE205B. Most of the ferric uptake genes in the mutant strain DE205BΔireA, except irp1, irp2 and chuA, were significantly upregulated (P < 0.05) (Fig. 4). Irp1, irp2 and chuA were non-significantly upregulated. Furthermore, the expressions of the eight ferric uptake genes in the complementary strain DE205BCΔireA were restored to wild-type levels.
Fig. 4

Expressions of Fe acquisition genes. Expressions of Fe acquisition genes of the wild-type strain DE205B, mutant strain DE205BΔireA and complementary strain DE205BCΔireA were tested by qPCR. The relative expression levels in the different mutant strains were calculated using the 2-△△Ct method

Expressions of Fe acquisition genes. Expressions of Fe acquisition genes of the wild-type strain DE205B, mutant strain DE205BΔireA and complementary strain DE205BCΔireA were tested by qPCR. The relative expression levels in the different mutant strains were calculated using the 2-△△Ct method The expression of adherence genes yfcO, yfcQ, aufG, fmlD, fmlE, yadN and fimH showed no significant difference between the wild-type strain DE205B and the ireA mutant strain (Fig. 5).
Fig. 5

Expressions of adhesion genes. Expressions of adhesion genes, including yfcO, yfcQ, aufG, fmlD, fmlE, yadN and fimH, of the wild-type strain DE205B, mutant strain DE205BΔireA and complementary strain DE205BCΔireA were tested by qPCR. The relative expression levels in the different mutant strains were calculated using the 2-△△Ct method

Expressions of adhesion genes. Expressions of adhesion genes, including yfcO, yfcQ, aufG, fmlD, fmlE, yadN and fimH, of the wild-type strain DE205B, mutant strain DE205BΔireA and complementary strain DE205BCΔireA were tested by qPCR. The relative expression levels in the different mutant strains were calculated using the 2-△△Ct method

Adherence assays

The number of mutant DE205BΔireA bacteria adhering to DF-1 cells was significantly decreased compared with the number of DE205B wild-type adherent cells (P < 0.05) (Fig. 6). The adhesion to DF-1 cells of complementary strain DE205BCΔireA was partly restored to wild-type levels.
Fig. 6

Adherence assays. The adhesion abilities of the wild-type strain DE205B, mutant strain DE205BΔireA and complementary strain DE205BCΔireA to DF-1 cells were tested. The numbers of adherent cells were calculated by plate counting. The number of DE205BΔireA mutant bacteria adhering to DF-1 cells was significant decreased compared with the number of DE205B wild-type bacteria (P < 0.05)

Adherence assays. The adhesion abilities of the wild-type strain DE205B, mutant strain DE205BΔireA and complementary strain DE205BCΔireA to DF-1 cells were tested. The numbers of adherent cells were calculated by plate counting. The number of DE205BΔireA mutant bacteria adhering to DF-1 cells was significant decreased compared with the number of DE205B wild-type bacteria (P < 0.05)

Animal infection

The LD50 of the wild-type, deletion mutant and complementary strains were 1.74 × 105, 2.45 × 105, and 3.16 × 105, respectively (Table 2). The results showed that there was no significant difference between the LD50 of the wild-type and deletion mutant strains, indicating that the deletion of ireA gene has no obvious effect on the virulence of DE205B toward ducks.
Table 2

LD50 of wild-type and mutant strains

Challenge dose (CFU/ml)Duck mortality
DE205BDE205BΔireA DE205BCΔireA
108 7/77/77/7
107 7/77/77/7
106 6/76/76/7
105 3/72/71/7
LD50 1.74 × 105 2.45 × 105 3.16 × 105
LD50 of wild-type and mutant strains

Determination of resistance to environmental stress

Compared with the wild-type strain, the survival rate of the ireA deletion mutant was reduced by 21.17 % (P < 0.01) and 25.42 % (P < 0.05) under alkali and high osmolarity conditions, respectively (Fig. 7). The resistance to alkali and high osmolarity conditions of the complementary strain DE205BCΔireA was almost restored to wild-type levels. For the temperature challenge, compared to the wild type strain, the ireA deletion mutant was reduced 70.0 % (P < 0.01) under the low (4 °C) temperature (Fig. 8). The resistance to low temperature of the complementary strain DE205BCΔireAwas partly restored. The results showed that presence of the ireA gene increased the stress-resistance of APEC strain DE205B.
Fig. 7

Resistance to alkaline and high osmolarity. The resistance to alkali (a) and high osmolarity (b) of wild-type strain DE205B, mutant strain DE205BΔireA and complementary strain DE205BCΔireA was tested by exposing the strains to alkaline and high osmolarity conditions and calculating their survival rates. Compared with the wild-type strain, the survival rate of the ireA deletion mutant was reduced 21.17 % (P < 0.01) and 25.42 (P < 0.05) under alkaline and high osmolarity conditions, respectively

Fig. 8

Challenge under the low temperature of different strains. Each bacterial suspension with concentration of 107 CFU/ml (DE205B, DE205BΔireA or DE205BCΔireA) were incubated at 4 °C for 7days. The survival rates of wild-type and mutant strains were calculated by plate counting and compared using GraphPad Prism 5. The ireA deletion mutant was reduced 70.0 % (P < 0.01) under the low (4 °C) temperature compared to that of the wild type strain

Resistance to alkaline and high osmolarity. The resistance to alkali (a) and high osmolarity (b) of wild-type strain DE205B, mutant strain DE205BΔireA and complementary strain DE205BCΔireA was tested by exposing the strains to alkaline and high osmolarity conditions and calculating their survival rates. Compared with the wild-type strain, the survival rate of the ireA deletion mutant was reduced 21.17 % (P < 0.01) and 25.42 (P < 0.05) under alkaline and high osmolarity conditions, respectively Challenge under the low temperature of different strains. Each bacterial suspension with concentration of 107 CFU/ml (DE205B, DE205BΔireA or DE205BCΔireA) were incubated at 4 °C for 7days. The survival rates of wild-type and mutant strains were calculated by plate counting and compared using GraphPad Prism 5. The ireA deletion mutant was reduced 70.0 % (P < 0.01) under the low (4 °C) temperature compared to that of the wild type strain

Discussion

The ireA gene is an iron-regulated gene and is involved in iron acquisition in human pathogenic E. coli isolates and our study proved this protein functions in APEC. Additionally, we identified two new functions of ireA using the deletion mutant. In the present study, ireA was demonstrated to contribute to the adhesion to DF-1 cells. Moreover, the expressions of several adhesion genes were tested and the results showed no significant differences between wild-type and mutant strain, indicating that the ireA gene indeed plays a role in adhesion. Tarr et al., identified adhesin Iha from an O157:H7 strain of E. coli [12]. This adhesin shared high similarities with several identified or putative siderophore receptors. Siderophore receptor IrgA was reported to contribute to growth in the rabbit ileal loop model in vivo and to enhance virulence in an infant mouse model, suggesting a possible role in colonization [13, 14]. Here, we proved that iron-regulated gene ireA plays a role in the adhesion of APEC strains. The ireA gene also increased stress-resistance under alkali and high osmolarity conditions, as well as underlow temperature. Thus, the redundancy of siderophore receptors might reflect their multifunctional roles. E. coli strains were reported to be classified into four main phylogenetic groups (A, B1, B2, and D) [15]. Virulent ExPEC strains mainly belong to phylogroup B2 and D, whereas most commensal strains belong to phylogroup A [16]. The ireA gene was distributed more frequently in the B2 (58.8 %) and D (55.9 %) groups than in the A (19 %) and B1 (19.2 %) groups, indicating that ireA might be associated with the virulence of the APEC strain DE205B. Thus, the result correlated with that Russo’s report: ireA was detected in 13 (26 %) of 50 random clinical isolates from patients and in none (0 %) of 14 fecal isolates, which presumably represented commensal strains [11]. Taken together, these results indicated that ireA might be a virulence gene in both human and avian ExPEC E. coli strains. The expression level of ireA in DE205B was decreased in high Fe M9 media compared with that in low Fe media, indicating that ireA is involved in iron-regulation in this APEC strain. This result agreed with the report of Russo et al., who found that ireA was a iron-regulated virulence gene in the blood- or urine-derived isolates of ExPEC E. coli [11]. Most ferric uptake genes, such as fepC, feoB, chuT, fyuA and fepA were upregulated in the ireA deletion mutant strain. This might represent a compensatory function for ireA gene deletion. Fe acquisition is important for many microorganisms, especially for pathogens that grow in the host, which attempts to limit Fe availability. It is thought that pathogens harbor multiple Fe acquisition systems to ensure that Fe is gained from the host cells to provide a selective advantage. Alternatively, certain siderophores, and their cognate receptors, might be more active in certain environments, such as inside or outside the gastrointestinal tract [17, 18]. Moreover, multiple systems might represent ‘alternatives’ that protect against the disruption of one system caused by genomic rearrangements or mutations. In the duck infection experiments, the LD50 showed no significant difference between the wild-type DE205B and the ireA deletion mutant strain. Thus, it seemed that ireA deletion had no obvious effect on the virulence of DE205B. However, DE205B has several Fe acquisition systems. We showed that most of the other Fe acquisition genes were upregulated in the ireA gene deletion mutant. Thus, the ireA gene might indeed contribute to the virulence of the APEC strain DE205B, while other Fe acquisition genes displayed compensatory functions when the ireA gene was deleted.

Conclusions

In summary, the ireA gene was mainly distributed in the more virulent phylogenetic ECOR group B and D. Compared with the wild-type strain, the adhesion and resistance to environmental stress of the ireA deletion mutant were significant decreased. This indicated that ireA is a Fe iron-regulated gene that aids adhesion and stress-resistance in the APEC strain DE205B.

Methods

Bacterial strains, plasmids and growth conditions

The APEC strain DE205B, which was characterized previously, was isolated from the brain of a duck with neurological symptoms in our previous work [19-22]. Its serotype is O2:K1, which is one of the predominant serotypes of APEC [9, 23]. All E. coli strains were grown in Luria-Bertani (LB) medium at 37 °C with shaking or on LB plates with 2 % agar. When necessary, the LB medium was supplemented with appropriate antibiotics: ampicillin (Amp; 100 μg/mL) and kanamycin (Kan; 50 μg/mL), unless otherwise specified. Information on the main strains and plasmids used in this study are listed in Table 3. M9 minimal medium was used to assess the expression of ireA, which was prepared as follows: an aliquot was mixed with200 ml of 5 × M9 salt solution (containingNa2PO4 · 7 H2O, 12.8 g; KH2PO4, 3.0 g; NaCl, 0.5 g; NH4Cl, 1.0 g;),2 ml of 1 M MgSO4, 20 ml of 20 % glucose solution, 0.1 ml of1 M CaCl2, and then dissolved in1000 ml double distilled water andfiltrated through a 0.22-μm membrane.
Table 3

Bacterial strains and plasmids used in the present study

Strain or plasmidCharacteristicsReference
Strain
 DE205BO2:K1, NalR[16, 19]
 DE205BΔireA ireA deletion mutant strainThis study
 DE205BCΔireA ireA complementary strainThis study
Plasmid
 pKD46Amp, express λ red recombinase[29]
 pKD4kan, template plasmid[29]
 pSTV28Cm, expression using lac promotorTAKARA
 pCP20Cm, Amp, yeast Flp recombinase gene, FLP[29]
Bacterial strains and plasmids used in the present study

Prevalence of ireA among E. coli Strains

The distribution of ireA among 140 E. coli strains (Additional file 1: Table S1) maintained in our laboratory was tested using PCR. The PCR primers were designed using Primer Premier 5. The specific primers ireA-F and ireA-R are listed in Table 4. The PCR conditions were: 5 min at 95 °C for initial denaturing; 30 cycles of 1 min at 95 °C, 30 s at 50 °C and 1 min at 72 °C; followed by 10 min at 72 °C for extension. The DNA of DE205B and ddH2O were used as positive and negative templates, respectively. The PCR products were electrophoresed through 1 % agarose gels. Phylogenetic E. coli reference (ECOR) groups of single isolates of the 140 E. coli strains were determined using triplex PCR, as described previously [16, 24].
Table 4

Primers used in the present study

PrimersPrimer sequence (5′–3′)GeneReference
ireA-FAGATACGCTTGTTGTTAC ireA This study
ireA-RCATTCCATGCTGCTAC
ireAMu-FGTAAATTCCCTCTTTGCTAACGCAAATCATTATCATTACGCCTTTGGCAAAGGGAAATTTGTGTAGGCTGGAGCTGCTTCGAUpstream region of ireA This study
ireAMu-RCATTACTGATTACTACACTGGTACCTGAGGCTCACGGCCTCAGGTTGTCTTTATATACTCCATATGAATATCCTCCTTAGDownstream region of ireA
ireA-1TACTCCCCATCCCCGGGCAA ireA This study
ireA-2GGGGGCAGCAATATCCGGTG
k1CAGTCATAGCCGAATAGCCT kanR [27]
k2CGGTGCCCTGAATGAACTGC
ireACo-FTACGGATCCCTGAACAATAGCGAT ireA This study
ireACo-RGCTAAGCTTTTACAACCTGGAAAC
QireA-FAAACATGGGATGGCGTACTT ireA This study
QireA-RAATCAATGGGCCTGACAGATAG
QFeoB-FGCACTCTTTGTGCATGGTATTC FeoB This study
QFeoB-RTGGCAGCACGGTGTTAAT
QfepA-FCAATGCGCCAGAACATAAAGAG fepA This study
QfepA-RTGTCGAGGTTGCCATACAAG
QfepC-FTCGTTACGCCAGCCATTT fepC This study
QfepC-RTGCAGCGCAGACCATAAA
QfyuA-FATGCCTATGTGGGATGGAATG fyuA This study
QfyuA-RCCAGTCATCGGTGGTGTATTT
Qirp1-FGGCGAACCCTGCTATGTATT irp1 This study
Qirp1-RGTCCATGCAGTACCAGCTAAA
Qirp2-FGCGGCTGATTACCAACAATTAC irp2 This study
Qirp2-RCTGGATCAGGTTGCTCTCTTC
QChuA-FTAGGCCACATCAAGGCTAAAC ChuA This study
QChuA-RCGGCGACAACTATGTCGTATAA
QdnaE-FATGTCGGAGGCGTAAGGCT dnaE This study
QdnaE-RTCCAGGGCGTCAGTAAACAA
P1TTGCCGGAATTCTCAGGGGGCCAGTCTACTGAATGAGfusion ireA This study
P2ACCGTCGTCGACTTAGTGATGATGATGATGATGAGAACCATACAGGGAAGACATAGGG
QyfcO-FTGCATAACTCGTCATGTCCTGTCTCCGTTG yfcO This study
QyfcO-RAGCGTTTTCTCAATCGTTCCGCCCGTC
QyfcQ-FCCTGCATTTCTACGGCAATTTAC yfcQ This study
QyfcQ-RCGGTCACCATCAGGTCTTTAC
QaufG-FTGCTCTGGCAACATCAGTAG aufG This study
QaufG-RACTAACAGGTAAAGTCAGGAAAGT
QfmlD-FCAGGCTCCCTACAGTCATATAAAG fmlD This study
QfmlD-RTCGGTGTCTTATCACCAATATCC
QfmlE-FCAGTGCCAGACAATTTCCAAC fmlE This study
QfmlE-RCCGTTAAATGCAACCTGAACTC
QyadN-FCCACTGTTAATGGCGGTGTA yadN This study
QyadN-RTTTAGCCAGGCGAGAAGAAC
QfimH-FCTTATGGCGGCGTGTTATCT fimH This study
QfimH-RCGGCTTATCCGTTCTCGAATTA
Primers used in the present study The expression of the ireA gene was tested by fusion expression and western blotting as previously reported [25, 26]. The fusion fragment of ireA (including the ireA promoter and 579bp of ireA sequence) and His tag were inserted into plasmid pET32a(+). The fusion PCR primers P1 and P2 were listed in Table 4. Plasmid pET32a(+) without the fusion fragment was used as a blank control. For immunoblotting, protein samples were subjected to sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride membranes (Amersham Pharmacia Biotech, Piscataway, NJ, USA), as described previously [27]. Anti-His serum was the primary antibody, horseradish peroxidase-conjugated goat anti-mouse IgG was the secondary antibody and 3,3′-diaminobenzidine was used as the substrate.

Regulation of ireA expression in M9 media

M9 minimal medium was used to assess the expression of ireA.M9 medium or M9 medium with Fe (0.1 mM Fe(NO3)3) were used as low and high Fe content media, respectively. DE205B was cultured in both M9 media to the mid-log phase and the expression of ireA was detected by quantitative real-time reverse transcription PCR(qRT-PCR). The real –time PCR primers were designed by PrimerQuest Tool IDT (http://sg.idtdna.com/primerquest/Home/Index). Briefly, total RNA was extracted from 1 ml of bacteria culture using the Trizol RNA isolation protocol (Invitrogen, Shanghai, China) and cDNA was amplified by reverse transcription according to the instructions of the primeScript RT reagent Kit (Takara). Quantitative real-time PCR (qPCR) was carried out using the ABI Prism 7300 and Sequence Detection System software version 1.4 (Applied Biosystems, Foster City, CA, USA), according to the instructions of the SYBR Premix Ex Taq (Takara, Dalian, China). QPCR primers for ireA (QireA-F and QireA-R) are listed in Table 4. DnaE was used as a reference gene. Assays were performed three times. The relative expressions of ireA in different media were calculated using the 2-△△Ct method [28]. Statistical analysis was performed using an unpaired t test in Graphpad Prism 5.0.

Construction of the ireA deletion mutant and complementary strain

An ireA knockout strain of DE205B was constructed using the lambda red recombinase system described by Datsenko and Wanner [29]. The specific primers ireAMu-F and ireAMu-R were designed to amplify the target gene ireA. The kanamycin resistance gene, which contained sequences homologous to the 5′ and 3′ ends of the target sequence, was amplified using plasmid pKD4 as a template. The PCR products were then transformed by electroporation into DE205B containing the lambda red recombinase expression plasmid pKD46. The transformed bacterial cells were first incubated at 30 °C for 2 h in super optimal broth with catabolite repression (SOC) broth, and then grown on LB agar containing kanamycin at 37 °C. Mutants were confirmed by PCR and sequenced using primers k1 and k2 (Table 4) in combination with primers ireA-1 and ireA-2 (Table 4) flanking the ireA region. To remove the kanamycin resistance gene, plasmid pCP20 was transformed into the mutant and a kanamycin sensitive mutant strain was selected. Finally, the ireA deletion mutant strain without kanamycin resistance was named as DE205BδireA (Additional file 2: Figure S1). To construct the complementary strain, the ireA gene, including its putative promoters, was amplified using primers ireACo-F and ireACo-R (Table 4). The following amplification program were used: 5 min at 95 °C for initial denaturing; 35 cycles of 30 s at 95 °C, 30 s at 55 °C and 2.5 min at 72 °C; 10 min at 72 °C for extension. The PCR product of ireA gene was purified and subcloned into plasmid pSTV-28. The complementary strain DE205BCΔireA was generated by transforming vector pSTV-28-ireA into the deletion mutant (Additional file 3: Figure S2). The growths of the DE205B wild-type and mutant strains were compared in LB medium at 37 °C over a course of 12 h, starting at 107 CFU/ml. Bacterial growth was estimated by plate counting as Colony Forming Units (CFU). Assays were performed three times.

The expression of the Ferric uptake system and adherence genes

The effect of ireA deletion on the regulation of the ferric uptake system, including fepC, feoB, chuT, fyuA, irp1, irp2, chuA and fepA was detected using qRT- PCR. Seveal adherence genes, including yfcO, yfcQ, aufG, fmlD, fmlE, yadN and fimH were also selected to test their expression levels. The wild-type DE205B and the ireA deletion mutant were cultured in LB to mid-log phase and total RNA was extracted from 1 ml of bacterial culture using the Trizol RNA isolation protocol (Gibco BRL, USA, cat. no.15596-026). cDNA was reverse transcribed and real-time PCR was carried out as described above. The qRT-PCR primers for the ferric uptake system and adherence genes are listed in Table 4. The real-time PCR primers were designed unsing PrimerQuest Tool IDT (http://sg.idtdna.com/primerquest/Home/Index). The relative expression levels of the genes were calculated using the 2-△△Ct method [28]. Assays were performed three times, and the statistical analysis was performed using an unpaired t test in Graphpad Prism 5.0. On the figures, error bars indicate the standard deviation. The adherence assay was performed as described previously [24]. Briefly, chicken embryo fibroblast (CEF) DF-1 cells were seeded at approximately 1 × 105 cells per well in 24-well tissue culture trays (TPP, Shanghai, China) and grown in Dulbecco’s modified Eagle medium (DMEM) with 10 % fetal bovine serum at 37 °C in a 5 % CO2 humidified atmosphere without antibiotics. DF-1 cells were washed once with DMEM and then inoculated with 500 ul of 2 × 107 CFU/ml bacteria per well for 2 h at 37 °C in the presence of 5 % CO2. The cells were washed, lysed with ddH2O, and the number of bacterial cells was calculated by plate counting. In all assays, wells only containing DF-1 cells were used as negative controls. The adherence assays were conducted three times. The statistical analysis was performed using an unpaired t test in Graphpad Prism 5.0.

Animal infections

Animal infections were performed as described previously [19, 20]. We purchased 7-day-old ducklings and young duck feeds from Anhui Poultry Farm (Anhui, China). Bacterial strains were cultured to the exponential phase, harvested, washed three times in PBS and then adjusted to the appropriate doses. Twenty-five 7-day-old ducks were inoculated intramuscularly 0.2 ml of each bacterial suspension (DE205B, DE205BΔireA or DE205BCΔireA) at four concentrations (5 × 108 CFU/ml, 5 × 107 CFU/ml, 5 × 106 CFU/ml, and 5 × 105 CFU/ml). Assays were performed three times. Seven ducks were used for each dose. Seven ducks were injected with PBS as a negative control. Death of the ducks was monitored for 7 days post infection. We calculated the LD50 of each strain using the method described by Spearman-Karber [30]. Resistance to environmental stress was tested for the wild-type and the mutant strain, as described by La Ragione et al. [31]. Bacteria were cultured in LB broth overnight and harvested by centrifugation. The cells were resuspended in PBS and adjusted to 107 CFU/ml in PBS. For alkali challenge, 100 μl of adjusted cells were mixed with 100 μl Tris buffer (1 M, pH10.0) and 800 μl ddH2O (final concentration, 100 mM, pH10.0) and incubated at 37 °C for 30 min. For high osmolarity endurance, cells were mixed with an equal volume of 4.8 M NaCl (final concentration, 2.4 M) and incubated at 37 °C for 1 h. Bacteria were exposed to PBS (pH 7.0) as a control. Temperature challenge was performed as previously described with modifications [32], each bacterial suspension, at a concentration of 107 CFU/ml (DE205B, DE205BΔireA or DE205BCΔireA) was incubated at 4 °C for 7days. Assays were performed three times. The survival rates of wild-type and mutant strains were calculated by plate counting and compared using GraphPad Prism 5.
  32 in total

1.  The role of fimbriae and flagella in the colonization, invasion and persistence of Escherichia coli O78:K80 in the day-old-chick model.

Authors:  R M La Ragione; A R Sayers; M J Woodward
Journal:  Epidemiol Infect       Date:  2000-06       Impact factor: 2.451

2.  Identification of genes required for avian Escherichia coli septicemia by signature-tagged mutagenesis.

Authors:  Ganwu Li; Claudia Laturnus; Christa Ewers; Lothar H Wieler
Journal:  Infect Immun       Date:  2005-05       Impact factor: 3.441

3.  Effects of ibeA deletion on virulence and biofilm formation of avian pathogenic Escherichia coli.

Authors:  Shaohui Wang; Chunling Niu; Zhenyu Shi; Yongjie Xia; Muhammad Yaqoob; Jianjun Dai; Chengping Lu
Journal:  Infect Immun       Date:  2010-10-25       Impact factor: 3.441

4.  Sequencing and functional annotation of avian pathogenic Escherichia coli serogroup O78 strains reveal the evolution of E. coli lineages pathogenic for poultry via distinct mechanisms.

Authors:  Francis Dziva; Heidi Hauser; Thomas R Connor; Pauline M van Diemen; Graham Prescott; Gemma C Langridge; Sabine Eckert; Roy R Chaudhuri; Christa Ewers; Melha Mellata; Suman Mukhopadhyay; Roy Curtiss; Gordon Dougan; Lothar H Wieler; Nicholas R Thomson; Derek J Pickard; Mark P Stevens
Journal:  Infect Immun       Date:  2012-12-28       Impact factor: 3.441

5.  Identification of an iron-regulated virulence determinant in Vibrio cholerae, using TnphoA mutagenesis.

Authors:  M B Goldberg; V J DiRita; S B Calderwood
Journal:  Infect Immun       Date:  1990-01       Impact factor: 3.441

6.  Comparative expression of five Lea Genes during wheat seed development and in response to abiotic stresses by real-time quantitative RT-PCR.

Authors:  Mohamed A Ali-Benali; Rémi Alary; Philippe Joudrier; Marie-Françoise Gautier
Journal:  Biochim Biophys Acta       Date:  2005-07-25

7.  Novel roles for autotransporter adhesin AatA of avian pathogenic Escherichia coli: colonization during infection and cell aggregation.

Authors:  Shaohui Wang; Yongjie Xia; Jianjun Dai; Zhenyu Shi; Yahui Kou; Huiqin Li; Yinli Bao; Chengping Lu
Journal:  FEMS Immunol Med Microbiol       Date:  2011-09-26

8.  Avian lipocalin expression in chickens following Escherichia coli infection and inhibition of avian pathogenic Escherichia coli growth by Ex-FABP.

Authors:  Amélie Garénaux; Sébastien Houle; Benjamin Folch; Geneviève Dallaire; Mélanie Truesdell; François Lépine; Nicolas Doucet; Charles M Dozois
Journal:  Vet Immunol Immunopathol       Date:  2012-09-26       Impact factor: 2.046

9.  Relative importance of three iron-regulated outer membrane proteins for in vivo growth of Vibrio cholerae.

Authors:  K T Tashima; P A Carroll; M B Rogers; S B Calderwood
Journal:  Infect Immun       Date:  1996-05       Impact factor: 3.441

10.  Translational control and target recognition by Escherichia coli small RNAs in vivo.

Authors:  Johannes H Urban; Jörg Vogel
Journal:  Nucleic Acids Res       Date:  2007-01-30       Impact factor: 16.971

View more
  6 in total

1.  Deletion of the c2515 and c2516 Genes Affects Iron Uptake and Virulence of APEC O1 Strain E516.

Authors:  Qingqing Gao; Xi Li; Senyan Su; Lei Yang; Song Gao
Journal:  Front Vet Sci       Date:  2021-04-12

2.  Genomic Investigation into the Virulome, Pathogenicity, Stress Response Factors, Clonal Lineages, and Phylogenetic Relationship of Escherichia coli Strains Isolated from Meat Sources in Ghana.

Authors:  Frederick Adzitey; Jonathan Asante; Hezekiel M Kumalo; Rene B Khan; Anou M Somboro; Daniel G Amoako
Journal:  Genes (Basel)       Date:  2020-12-14       Impact factor: 4.096

3.  Comparative Pathogenomics of Escherichia coli: Polyvalent Vaccine Target Identification through Virulome Analysis.

Authors:  J R Clark; A M Maresso
Journal:  Infect Immun       Date:  2021-07-15       Impact factor: 3.441

4.  Adaptive strategies of uropathogenic Escherichia coli CFT073: from growth in lab media to virulence during host cell adhesion.

Authors:  Meysam Sarshar; Daniela Scribano; Anna Teresa Palamara; Cecilia Ambrosi; Dolores Limongi; Carlo Zagaglia
Journal:  Int Microbiol       Date:  2022-02-02       Impact factor: 3.097

5.  Role of LsrR in the regulation of antibiotic sensitivity in avian pathogenic Escherichia coli.

Authors:  Lumin Yu; Wenchang Li; Qian Li; Xiaolin Chen; Jingtian Ni; Fei Shang; Ting Xue
Journal:  Poult Sci       Date:  2020-04-24       Impact factor: 3.352

Review 6.  Avian Pathogenic Escherichia coli (APEC): An Overview of Virulence and Pathogenesis Factors, Zoonotic Potential, and Control Strategies.

Authors:  Dipak Kathayat; Dhanashree Lokesh; Sochina Ranjit; Gireesh Rajashekara
Journal:  Pathogens       Date:  2021-04-12
  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.