Literature DB >> 27528396

Deciphering transcriptome profiles of peripheral blood mononuclear cells in response to PRRSV vaccination in pigs.

Md Aminul Islam1,2, Christine Große-Brinkhaus1, Maren Julia Pröll1, Muhammad Jasim Uddin2, Sharmin Aqter Rony1, Dawit Tesfaye1, Ernst Tholen1, Michael Hölker3, Karl Schellander1, Christiane Neuhoff4.   

Abstract

BACKGROUND: pan> class="Species">Porcine reproductive and respiratory syndrome (PRRS) is one of the most economically important viral diseases affecting swine industry worldwide. Despite routine farm vaccination, effective control strategies for PRRS remained elusive which underscores the need for in-depth studies to gain insight into the host immune response to vaccines. The current study aimed to investigate transcriptional responses to PRRS Virus (PRRSV) vaccine in the peripheral blood mononuclear cells (PBMCs) within 3 days following vaccination in German Landrace pigs.
RESULTS: Transcriptome profiling of PBMCs from PRRSV vaccinated and age-matched unvaccinated pigs at right before (0 h), and at 6, 24 and 72 h after PRRSV vaccination was performed using the Affymetrix gene chip porcine gene 1.0 st array. Comparison of PBMCs transcriptome profiles between vaccinated and unvaccinated pigs revealed a distinct host innate immune transcriptional response to PRRSV vaccine. There was a significant temporal variation in transcriptional responses of PRRSV vaccine in PBMCs accounting 542, 2,263 and 357 differentially expressed genes (DEGs) at 6, 24 and 72 h post vaccination, respectively compared to the time point before vaccination (controls). Gene ontology analysis revealed the involvement of these DEGs in various biological process including innate immune response, signal transduction, positive regulation of MAP kinase activity, TRIF-dependent toll-like receptor signaling pathway, T cell differentiation and apoptosis. Immune response specific pathways such as cytokine-cytokine receptor interaction, chemokine signaling pathway, signal transduction, JAK-STAT pathway and regulation, TRAF6 mediated induction of NF-kB and MAPK, the NLRP3 inflammasome, endocytosis and interferon signaling were under regulation during the early stage of PRRSV vaccination. Network enrichment analysis revealed APP, TRAF6, PIN1, FOS, CTNNB1, TNFAIP3, TIP1, CDKN1, SIRT1, ESR1 and HDAC5 as the highly interconnected hubs of the functional network of PRRSV vaccine induced transcriptome changes in PBMCs.
CONCLUSIONS: This study showed that a massive gene expression change occurred in PBMCs following PRRSV vaccination in German Landrace pigs. Within first 3 days of vaccine exposure, the highest transcript abundance was observed at 24 h after vaccination compared to that of control. Results of this study suggest that APP, TRAF6, PIN1, FOS, CDKN1A and TNFAIP3 could be considered as potential candidate genes for PRRSV vaccine responsiveness.

Entities:  

Keywords:  Antibody; Innate immunity; Microarray; PBMCs; PRRSV vaccine; Pig

Mesh:

Substances:

Year:  2016        PMID: 27528396      PMCID: PMC4986384          DOI: 10.1186/s12864-016-2849-1

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

Porcine reproductive anpan>d pan> class="Disease">respiratory syndrome (PRRS) is an emerging viral infectious disease; clinically characterized by reproductive failures in breeding sows and respiratory disorders in growing pigs [1]. PRRS causes huge economic loss, and is of major concern as animal welfare issue in swine industry worldwide [2, 3]. The disease is caused by an enveloped, positive-sense, single-stranded RNA virus called porcine reproductive and respiratory syndrome virus (PRRSV). The PRRSV, a member of arterivirus group under the family arteriviridae, is divided into two distinct genotypes namely European and North American types [4]. The PRRSV genome is approximately 15 kb containing ten open reading frames (ORF) encoded with seven structural and 14 nonstructural proteins [5, 6]. The virulent PRRSV primarily infects pulmonary alveolar macrophages, and destroy infected cells through cytopathic replication. The host-virus interaction results in a deficient host’s innate immune response indicated by a poor induction of type I interferon (IFN α/β), the potent antiviral immune responsive cytokines [7, 8]. Some of the non-structural proteins (Nsp1, Nsp2, Nsp11) and a structural protein (N protein) of PRRSV are known to be associated with IFN suppression in the infected cells [4]. The RIG-I/MDA5 and JAK-STAT pathways are two major signaling pathways for IFN production which are found to be impaired by PRRSV during acute infection [4]. Overall, the timing and the potency of the host cellular and immunological events that occur following infection are likely potential determinants governing the pathogenesis [9]. Vaccination with modified live virus has been widely practiced in the commercial swine herd as onpan>e of the cost-effective conpan>trol approaches for PRRS. The live attenpan>uated pan> class="Species">PRRSV vaccine provides sufficient protection against homologous virus but limited protection against reinfection of genetically variant strains [10]. Live viral vaccines can efficiently trigger the activation of the host immune system through evolutionarily conserved pathogen associated molecular patterns (PAMPs) allowing their recognition by pattern recognition receptors (PPRs) of immune cells [11]. Following administration, vaccine antigen produces a ‘danger signals’ which activate the monocytes and dendritic cells in such a way to secrete proinflammatory cytokines and chemokines [12]. These cytokines and chemokines lead the extravasation and attraction of monocytes, granulocytes and natural killer cells, and generate an inflammatory microenvironment, in which monocytes differentiate into macrophages, and immature dendritic cells become mature [13]. Through changing the surface receptors, macrophages and mature dendritic cells migrate towards the draining lymph nodes and induce the activation of T and B lymphocytes. T lymphocytes have two subsets namely CD4+ and CD8+ T cell. The generation and maintenance of both B cell and CD8+ T cell responses are supported by growth factors and signals provided by CD4+ T helper lymphocytes 1 and 2 (Th1 and Th2). Th1 and Th2 are controlled by regulatory T cells (Treg) involved in maintaining the immune tolerance [14]. The peripheral blood mononuclear cells (PBMCs) are the population of immune cells which includes lymphocytes (T cell, B cell and NK cells), monocytes and dendritic cells. Altogether, they play a central role in immune system against virus infection. Therefore, deciphering the PRRSV vaccine induced global transcriptome changes in PBMCs might lead to identify the molecules and signaling pathways associated with host immune responses. The innate immune response against viruses like PRRSV is critical as such virus is conpan>tinpan>uously chanpan>ginpan>g their anpan>tigenpan>ic epitopes [15]. Inpan>nate immunpan>e responpan>se is the first linpan>e defenpan>se mechanpan>ism of host cells againpan>st foreignpan> anpan>tigenpan> which typically occurs withinpan> hours inpan> a nonpan>-specific manpan>ner anpan>d may persists for few days [15]. The inpan>nate immunpan>e system recruits effector cells uponpan> anpan>tigenpan> exposure which secret cytokinpan>es, chemokinpan>es anpan>d proteinpan>s anpan>d subsequenpan>tly activate the adaptive immunpan>e system [16]. By that meanpan>s, the inpan>nate immunpan>e responpan>se acts as precursor to inpan>itiate the adaptive immunpan>ity againpan>st a specific pathogenpan> [17]. Inpan>nate immunpan>e traits have beenpan> conpan>sidered as potenpan>tial selectionpan> goals for disease resistanpan>ce inpan> pan> class="Species">pig breeding as innate immunity is likely to provide a common protection mechanism against multiple pathogens [18]. Genome-wide association study revealed a major quantitative trait locus (QTL) on chromosome 4 (SSC4) associated with host resistance to in-vivo PRRSV challenge [19]. The association of this region on SSC4 with PRRS resistance was further validated by the presence of single nucleotide polymorphism (SNP) marker, WUR10000125 (WUR) in the same region [20, 21]. Candidate genes in this locus on SSC4 include the interferon induced guanylate-binding protein gene family which are functionally linked to the innate immunity [22]. Therefore, genes and molecular pathways associated with improved innate immune response to PRRSV vaccine could possibly be implemented in breeding program for PRRS resistant pigs [18]. To this end, key molecules regulating the transcriptional network of PRRSV vaccine induced innate immune response in peripheral blood are highly sought. PBMCs are the primary immune cells in blood [23] and have suitably been used for the evaluation of vaccine induced global gene expression changes for several diseases in human anpan>d nonpan>-pan> class="Species">human primates (reviewed by [24]). The porcine PBMCs have also been used for microarray analysis of immune response genes following in-vitro lipopolysaccharide stimulation [25], in-vivo mycoplasma vaccination [26], and tetanus toxoid vaccination [27]. Transcriptional responses to natural as well as experimental infection of PRRSV have been studied through global gene expression profiling of pulmonary alveolar macrophages in pig [28, 29]. However, little is known about the global transcriptome alterations in peripheral blood after PRRSV vaccination in pigs. Therefore, the aim of this study was firstly to investigate the transcriptional response to PRRSV vaccine in PBMCs of vaccinated pigs compared to unvaccinated one. Secondly to characterize the temporal patterns of global gene expression changes in PBMCs over the first 3 days following PRRSV vaccination.

Methods

Study design and blood sampling

A total of 12 German Landrace female piglets were housed inpan> the pan> class="Species">pig research farm at Frankenforst, University of Bonn, Germany. Piglets were selected from two sows farrowed at the same day; all piglets were clinically healthy with no history of respiratory diseases and birth defects. After weaning, experimental piglets were divided into two groups: six in vaccinated and six in unvaccinated group. The piglets of vaccinated group were vaccinated with a modified live PRRSV vaccine of European strain (Porcilis® PRRS, MSD Animal Health, Germany) with primary dose at day 28 and booster dose at day 56 of their age according to the routine farm vaccination program. The unvaccinated group was maintained for health control without vaccine treatment. About 8 mL whole blood samples with 1.5 mL anticoagulant (0.5 M EDTA) were collected at different ages and time points before and after vaccination from pigs of both groups (Additional file 1). The blood samples collected at day 7 of age from all piglets were used for screening the PRRSV-specific maternally derived antibody response. The blood samples collected at four time points (0 (before vaccination), 6, 24 and 72 h post vaccination (hpv)) following primary vaccination from both groups (except 0 h in unvaccinated group) were used for microarray hybridization. Three individual biological replicates from both groups were selected based on their RNA quality for the microarray experiment. In addition, the blood samples from all piglets collected just before, and two weeks post primary vaccination as well as just before, and 2 weeks post booster vaccination were used for monitoring the vaccine induced antibody response by ELISA (Additional file 1).

Isolation of PBMCs and plasma

PBMCs and plasma were separated from the whole blood sample through density gradient cenn class="Gene">trifugationpan> (1500 rpm for 25 minpan>) with Histopaque®-1077 (Sigma-Aldrich, Munpan>ich, Germany) accordinpan>g to the protocol described by Uddinpan> et al. [30]. The PBMCs were washed three times (pelleted at 1000 rpm for 5 minpan>) usinpan>g n class="Chemical">phosphate-buffered saline with purity of ˃99 % determined by Wright-Giemsa staining.

Measurement of plasma antibody level

To monitor the PRRSV-specific anpan>tibody titre, the plasma samples from all study anpan>imals collected at day 7, 28, 42, 56 anpan>d 70 of their age ((Additionpan>al file 1) were screenpan>ed by ELISA (pan> class="Species">PRRSV-AK screening, Synlab Vet GmbH, Augsburg, Germany) according to manufacturer’s protocol. The optical density (OD) of each well was measured at 650 nm using the Bio-Rad 680 microplate reader. The presence or absence of PRRSV antibody was determined by calculating the sample to positive (S/P) ratio. The S/P ratio was calculated according to the following equation: S/P ratio (%) = 100 × [(OD of test sample – Mean OD of negative controls)/(Mean OD of positive controls – Mean OD of negative controls)]. The samples were considered to be positive for PRRSV antibody if the S/P ratio was more than 0.4 as described by Kittawornrat et al. [31].

Isolation and quality control of total RNA

The total RNA was extracted from PBMCs usinpan>g the miRNeasy mini kit (P/N 217004, Qiagen, Hilden, Germany) according to the manufacturer’s protocol along with DNase treatment (P/N 79254, Qiagen, Hilden, Germany). RNA concentration and purity were measured by NanoDrop® spectrophotometry (ND-8000; NanoDrop Technologies). RNA integrity was checked by micro capillary electrophoresis on an Agilent 2100 Bioanalyser with RNA 6000 Nanochip kit (Agilent Technologies, Waghäusel - Wiesental, Germany).

Microarray target preparation and hybridization

To prepare the target probes of 21 microarray, about 100 ng of total RNA samples from each of sevenpan> selected time poinpan>ts were processed with the Genpan>eChip® WT PLUS Reagenpan>t kit (P/pan> class="Chemical">N 902281; Affymetrix Inc., Santa Clara, CA, USA) according to the manufacturer’s protocol. In brief, the total RNA was subjected to synthesize the first-strand cDNA containing a T7 promoter sequence at the 5′ end followed by synthesis of the second-strand cDNA by DNA polymerase in the presence of RNase H. This double-strand cDNA was subjected to in-vitro transcription with T7 RNA polymerase for synthesis of the antisense RNA (complementary RNA, cRNA). The cRNA preparation was then purified using purification beads to improve its stability. From 15 μg of purified cRNA, the sense-strand cDNA (ss-cDNA) was synthesized by reverse transcription using random primers. The ss-cDNA contained dUTP at a fixed ratio relative to dTTP and the remaining cRNA was degraded by RNase H. After purification and quantification, 5.5 μg of ss-cDNA in a 31.2 μL volume was fragmented by uracil-DNA glycosylase (UDG) and apyrimidinic endonuclease 1 (APE 1) at the unnatural dUTP residues and breaks the DNA strand. The fragmented ss-cDNA was then labeled by terminal deoxynucleotidyl transferase (TdT) using the Affymetrix proprietary labeling reagent that is covalently linked to biotin. The hybridization of microarray probes followed by washing and staining was performed with the GeneChip® Hybridization, Wash and Stain kit (P/N 900720, Affymetrix Inc., Santa Clara, CA). For hybridization, about 130 μL hybridization cocktail containing about 3.5 μg of biotinylated ss-cDNA probes was injected into the GeneChip® Porcine Gene 1.0 ST array strip of 81/4 format (P/N 901976, Affymetrix Inc., Santa Clara, CA, USA) and incubated for 16 h in a hybridization oven (GeneChip® Hybridization oven 640; Affymetrix Inc.) at 45 °C with 60 rpm. The hybridized chips were stained and washed in a fluid station (GeneChip® Fluidics Station 450; Affymetrix Inc.) and scanned by Affymetrix GeneChip® scanner 3000 7G. The Affymetrix GeneChip® Command Console™ (AGCC) software was used to evaluate the array images and to export the reports of spot intensity data in CEL file format.

Microarray data processing

Pre-processing, normalization and statistical analyses of microarray dataset were performed using packages of Bioconductor-platform implemented in R-project software (v3.1.2) [32]. The ‘oligo’ package was implemented for the RMA (Robust Multi-array Average) based quantile normalization of microarray data at transcript level [33]. For quality control, some diagnostic plots of the raw intensity data were checked before and after the normalization. After excluding two arrays at 72 h post unvaccinated sample which did not pass the quality control, 19 arrays were used for further analysis. After normalization, the main probes (19,218) of the array were extracted. Then interquartile range (IQR) based filtering (variance cutoff value 0.25) was applied which further excluded about 4,978 low expressed probes. Finally the expression dataset comprising 14,231 transcript probes were subjected for downstream analysis. Probe to gene transcript annotation was performed with recent Affymetrix annotation file for assigned array [34]. Gene annotations were extended by their orthologous n class="Species">human genpan>e symbol as well as enpan>sembl genpan>e idenpan>tifiers. Unpan>til otherwise menpan>tionpan>ed, downpan>stream funpan>ctionpan>al anpan>alyses of this dataset were performed based onpan> pan> class="Species">human genome database.

Characterization of phenotypic groups

To characterize the differences of transcriptional responses between pigs of vaccinpan>ated anpan>d unpan>vaccinpan>ated group, the anpan>notated genpan>e expressionpan> profiles of PBMCs were subjected to anpan> exploratory funpan>ctionpan>al anpan>alysis through genpan>e set enpan>richmenpan>t anpan>alysis (pan> class="Chemical">GSEA) algorithm implemented in GSEA-P tool [35]. Two pairs of vaccination-time point group (6 hp vaccinated vs. 6 hp unvaccinated and 24 hp vaccinated vs. 24 hp unvaccinated) were considered as input phenotype for this analysis. The normalized and filtered expression dataset of 12 arrays containing human orthologous symbols of gene transcripts with their corresponding expression values were uploaded into the GSEA-P to generate the list of ranked order gene markers. The ‘immunologic signature’ catalog of gene set from Molecular Signatures Database (C7: MSigDB v5.0, Broad Institute, Cambridge, MA) was screened against the ranked gene list. The normalized enrichment score (NES) of each gene set was estimated by the number of over-representation of members of gene set towards the top or bottom of the ranked gene list through applying a weighted Kolmogrov-Smirnov statistics [36]. Then the enrichment score p-values were estimated using a phenotype based permutation test procedure. The statistical significance was defined by the cutoff value of false discovery rate (FDR) <0.15 and the NES p < 0.05.

Differential gene expression analysis

To explore the temporal variation of transcriptional response to vaccination, differential gene expression analysis was performed using the linear analysis of microarray technique from the ‘limma’ package [37] with empirical Bayes adjustmenpan>t to the varianpan>ce, followed by Benpan>jaminpan>i anpan>d Hochberg (BH) correctionpan> for multiple testinpan>g [38]. To check whether there was temporal variationpan> amonpan>g the pan> class="Species">pigs of unvaccinated control group, two contrast pairs (i.e. 0h_vac vs. 6h_unvac and 0h_vac vs. 24h_unvac) were tested. Then within the vaccinated group, three pairwise comparisons (6 hpv vs. control; 24 hpv vs. control and 72 hpv vs. control) were taken in to account for the differential expression analysis. Gene transcripts were considered as differentially expressed when passing the thresholds of false discovery rate (FDR) of <0.01 and log2 fold-change either >1.5 or < −1.5. The number of differentially expressed genes in each contrast pair and their interaction were exported in intersecting Venn diagram.

Gene ontology and pathway analysis

For biological interpretation of the transcriptome dataset, the significantly over-represented gene ontology terms and biological pathways were explored with the InnateDB pathway analysis tool [39]. First, the identifiers of DEGs from microarray data were converted to their n class="Species">human enpan>sembl orthologues usinpan>g the BioDBnpan>et tool (http://biodbnpan>et.abcc.ncifcrf.gov/). The list of enpan>sembl genpan>e idenpan>tifiers was thenpan> uploaded inpan> Inpan>nateDB web anpan>d performed the over-represenpan>tationpan> anpan>alysis with implemenpan>tationpan> of the hypergeometric algorithm anpan>d the Benpan>jaminpan>i-Hochberg (BH) multiple test correctionpan> method. The genpan>e onpan>tology (GO) anpan>d pathways were conpan>sidered signpan>ificanpan>tly over-represenpan>ted if they had a FDR < 0.05.

Sub-network enrichment analysis

To visualize the PRRSV vaccinpan>e inpan>duced tranpan>scriptionpan>al network as well as to idenpan>tify the regulatory genpan>es, the sub-network anpan>alysis was performed usinpan>g NetworkAnlayst online tool [40]. This tool uses the InnateDB (downloaded June 20, 2014) protein-protein interaction (PPI) datasets comprised of 14,755 proteins and 145,955 experimentally validated interactions for human. NetworkAnlayst implements the R package ‘igraph’ for network analysis and ‘Gephi Toolkit’ for finalizing the network layout. Human orthologous ensembl gene identifiers of the DEGs were uploaded into the NetworkAnlayst to construct the interacting network. First, a default network was assembled based on the Walktrap algorithm taking only direct interaction of seed genes (first-order interactors). The network size was then adjusted for <500 seeds and 200 ~ 2000 nodes using the ‘reduce’ panel for high-performance visualization. Two topological measures such as degree (number of connections to other nodes) and betweenness centrality (number of shortest paths going through the node) were taken in to account for detecting highly interconnected hubs of the network. Centrality measures of hub nodes were evaluated serially with degree followed by betweenness. Nodes having higher degree and betweenness values were considered as potentially important network hubs in cellular signal trafficking. Finally, weighted network based module detection was perform to cluster the genes of similar biological functions. The p value of a given network module was calculated using a Wilcoxon rank-sum test of the “internal” (edges within in a module) and “external” (edges connecting the nodes of other modules) degrees. The p values were calculated based on their connectivity assuming null hypothesis that there is no difference between the number of “internal” and “external” connections to a particular node in the module. Module having more internal than external edges was like to be significant. The functional enrichment of modules was performed with REACTOME.db pathway database incorporated in this tool for comprehensive biological illustration of the network.

Quantitative real-time PCR (qRT-PCR)

For technical validation of microarray results, five selected DEGs (Table 1) known to be involved in immune response function were quantified by qRT-PCR in the same RNA samples as used for microarray expressionpan>. Primers were designpan>ed based onpan> anpan> openpan> source primer designpan>inpan>g software Primer3 [41]. First Stranpan>d cDNA Synthesis Kit (P/N K1612, Thermo Scientific, Co.) was used for reverse transcription with oligo (dT) primer. The qRT-PCR reaction was set up taking 1.0 μl of cDNA template, 8.0 μl of deionized RNase free water, 0.5 μM of upstream and downstream primers, and 10 μl iTaq™ Universal SYBR® Green Supermix (Bio-Rad laboratories GmbH, Germany) in a total reaction volume of 20 μl and were amplified by the StepOnePlus™ Real-Time PCR System (Applied Biosystems®, Darmstadt, Germany). The thermal cycling conditions were 95 °C for 3 min, 95 °C for 15 s, 6 °C for 45 s (40 cycles); 95 °C for 15 s, 62 °C for 1 min, 95 °C for 15 s. All reactions were run in duplicate and the average value was used for calculating the expression value. Gene-specific expression was measured as relative to the geometric mean of the expression of two housekeeping genes (GAPDH and ACTB) (Table 1). The delta delta Ct (∆∆Ct) method was used for calculating the difference between target gene and reference genes [42]. The correlation between microarray and qRT-PCR results was analyzed by Spearman’s Rho test. The significance level was set as p < 0.01.
Table 1

Primer sequences for used qRT-PCR validation. List of primers and their sequences of selected candidate genes used for qRT-PCR validation of microarray data

GenBankGene namePrimer sequence (5′-3′)
Accession number
NM_213770.1IRF3: Interferon regulatory factor 3F: CCAGTGGTGCCTACACTCCT
R: AGAGGTGTCTGGCTCAGGAA
NM_001044580STAT3 : Signal transducer and activator of transcription 3 (acute-phase response factor)F: TGCTGGAGGAGAGAATCGT
R: GGGAATTTGACCAGCAATC
NM_214087CD80: Cluster of differentialtion-80F: TCAGACACCCAGGTACACCA
R: GACACATGGCTTCTGCTTGA
NM_001105286.1TRAF6: Tumor necrosis factor receptor-associated factorF: GGGAACGATACGCCTTACAA
R: CTCTGTCTTAGGGCGTCCAG
NM_213779CCL4 : Chemokine (C-C motif) ligand 4F: CTCTCCTCCAGCAAGACCAT
R: CAGAGGCTGCTGGTCTCATA
HQ013301GAPDH : Glyceraldehyde-3-phosphate dehydrogenasea F: GCTGGTGCTGAGTATGTCGT
R: AAGCAGTTGGTGGTACAGG
XM_003124280.3ACTB: Actin, Betaa F: AAGGACCTCTACGCCAACAC
R: CTGGCTGATCCACATCTGCT

a are the house keeping genes used for normalization

Primer sequences for used qRT-PCR validation. List of primers and their sequences of selected candidate genes used for qRT-PCR validation of microarray data a are the house keeping genes used for normalization

Results

PRRSV-specific antibody responses

In order to exclude the maternally derived antibody (MDA) response of PRRSV as well as to evaluate the vaccinpan>e inpan>duced anpan>tibody responpan>se, plasma samples from all pan> class="Species">pigs at day 7, 28, 42, 56 and 70 of age were screened by ELISA. The plasma antibody level confirmed that experimental pigs were negative for MDA of PRRSV considering the sample to positive (s/p) ratio of 0.4 (40 %) as threshold (Fig. 1). The optical density (OD) values indicated a relatively higher MDA titre in suckling piglets which felt down and remained stable towards the base line along with increased age of unvaccinated pigs. On the other hand, there was an increasing trend of plasma antibody titre in pigs following vaccination. The antibody titre got above the threshold after 2 weeks, and subsequently reached a plateau after 4 weeks of the primary vaccination (Fig. 1).
Fig. 1

PRRSV-specific antibody responses. The figure depicts the reactivity of maternally derived antibody and vaccine derived antibody to PRRSV in plasma detected by PRRSV-AK Enzyme Immunoassay. Values in the Y-axis represent the sample to positive (s/p) ratio, and the s/p values of 0.4 was considered as threshold to classify the individuals either positive or negative. Values in X-axis represents the piglet ages at which blood samples were evaluated. Primary and booster vaccination were performed at day 28 and 56 of age, respectively in pigs of vaccinated group. In vaccinated group, the optical density (OD) values of samples at day 7 and 28 of age represent for maternally derived antibody (MDA), and samples at day 42, 56 and 70 for vaccine induced antibody response. While samples from the control group were used for only monitoring the way of declining the MDA over the age of animals in absence of further PRRSV exposure

PRRSV-specific anpan>tibody responpan>ses. The figure depicts the reactivity of maternpan>ally derived anpan>tibody anpan>d vaccinpan>e derived anpan>tibody to pan> class="Species">PRRSV in plasma detected by PRRSV-AK Enzyme Immunoassay. Values in the Y-axis represent the sample to positive (s/p) ratio, and the s/p values of 0.4 was considered as threshold to classify the individuals either positive or negative. Values in X-axis represents the piglet ages at which blood samples were evaluated. Primary and booster vaccination were performed at day 28 and 56 of age, respectively in pigs of vaccinated group. In vaccinated group, the optical density (OD) values of samples at day 7 and 28 of age represent for maternally derived antibody (MDA), and samples at day 42, 56 and 70 for vaccine induced antibody response. While samples from the control group were used for only monitoring the way of declining the MDA over the age of animals in absence of further PRRSV exposure

Transcriptome profiles of PBMCs following PRRSV vaccination

To uncover the transcriptional modification underlying the innate immune response to a live attenuated PRRSV vaccinpan>e, we performed the global tranpan>scriptome profilinpan>g of PBMCs from pan> class="Species">pigs of vaccinated group at before (control) and 6, 24 and 72 h after vaccination; and from unvaccinated group at 6, 24 and 72 h post vaccination time points using the Affymetrix GeneChip Porcine Gene 1.0 ST Array. This array was encoded with 394,580 probe (20–22 probes per gene) representing a total of 19,212 known genes. After normalization the current study identified a total of 27,558 probes having higher signal intensity than the background. After filtering, 14,231 transcripts were found to be expressed in PBMCs, 10,217 of which could be annotated and were implemented in the downstream analyses.

Variation of PBMCs transcriptome profiles between vaccinated and unvaccinated pigs

The gene set enrichment analysis (GSEA)-based comparisonpan> of genpan>ome-wide expressionpan> profiles has distinpan>guished the vaccinpan>e inpan>duced tranpan>scriptome chanpan>ges betweenpan> the vaccinpan>ated pan> class="Species">pigs and the age-matched unvaccinated control pigs. The GSEA algorithm revealed that a total of 42 and 36 gene sets (pathways) were significantly upregulated at 6 and 24 hpv in vaccinated group, respectively, compared to their unvaccinated counterparts. Of these, the chemokine signaling, JAK-STAT signaling and cytoskeleton activation are the most significantly enriched gene sets which indicated the potential of vaccine to switch on the transcriptional machinery in PBMCs (Additional file 2). The enrichment score of most of the up regulated gene sets in the vaccinated group was increased at 24 hpv from that of 6 hpv indicating the number of core genes of particular gene set increased over the time of immunization (Table 2).
Table 2

Significantly enriched gene sets (pathway) obtained from gene set enrichment analysis. Top most gene sets enriched in PBMCs of PRRSV vaccinated pigs compared to unvaccinated control pigs exported from GSEA desktop application

Gene sets6hpv_vacc vs. 6hpv_unvacc24hpv_vacc vs. 24hpv_unvacc
NESFDRNESFDR
Regulation of actin cytoskeleton2.510.0012.750.001
Chemokine signaling pathway2.480.0012.560.001
JAK-STAT signaling pathway2.390.0012.550.001
Integrin cell surface interactions2.460.0012.50.001
Cell adhesion molecules2.310.0012.380.001
Integrin signaling pathway2.280.0012.370.001
Cell surface interactions at the vascular wall2.270.0012.330.001
Signal transduction by L12.240.0072.270.007
Cytokine cytokine receptor interaction2.200.0082.250.007
Apoptosis by serum deprivation up2.170.0082.230.007
Immortalized by HPV31 DN2.160.0082.230.008
Signaling by FGFR1 mutants2.140.0112.210.010
TNF signaling up2.120.0142.190.013
ECM receptor interaction2.100.0252.130.021
TRAF trafficking pathway2.080.0132.120.011
Leukocyte transendothelial migration2.040.0082.140.007

NES normalized enrichment score, FDR false discovery rate

Significantly enriched gene sets (pathway) obtained from gene set enrichment analysis. Top most gene sets enriched in PBMCs of PRRSV vaccinpan>ated pan> class="Species">pigs compared to unvaccinated control pigs exported from GSEA desktop application n class="Chemical">NES normalized enpan>richmenpan>t score, FDR false discovery rate

Differential gene expression in PBMCs after PRRSV vaccination

To get a comprehensive overview of transcriptional modifications associated with innate immune response, we performed the differential gene expression analysis over three time points (6, 24 and 72 hpv) after vaccination compared to the control (before vaccination). The normalized expression values for only main probes of the chip were included for differential expression analysis and filtered by the thresholds of FDR <0.01 and log2 fold-change >1.5 or < −1.5. Using this criterion, 2,453 transcripts were found to be differentially expressed in PBMCs after PRRSV vaccinpan>ationpan>. Amonpan>g them, 1087 (44.31 %) genpan>e tranpan>scripts could be anpan>notated. A complete list of the differenpan>tially expressed genpan>es (DEGs) inpan> PBMCs at three time poinpan>ts followinpan>g pan> class="Species">PRRSV vaccination is provided in Additional files 3, 4 and 5. The number DEGs and their direction of expression in three pairwise comparisons are plotted in Fig. 2. A total of 542 DEGs including 423 up regulated and 119 down regulated genes were detected at 6 hpv. The highest number (2, 263) of DEGs was identified at 24 h post vaccination. The number of upregulated genes (2,060) was also much higher than the down regulated ones (203) at 24 hpv. A total of 357 genes showed differential expression at 72 hpv in which 188 and 169 were up and down regulated, respectively. The fold change (FC) of differential expression ranged from −3.76 to 3.94; from −3.7 to 4.45 and from −4.15 to 3.11 at 6 hpv, 24 hpv and 72 hpv, respectively. A higher proportion of up regulated genes at each comparison indicated that vaccination induces active gene expression processes which may be associated with development of innate immune response.
Fig. 2

Number of differentially expressed genes after PRRSV vaccination. The figure depicts the number and direction of DEGs identified at three time points (6, 24 and 72 hpv) of PRRSV vaccination compared to the control (before vaccination)

Number of differentially expressed genes after PRRSV vaccination. The figure depicts the number and direction of DEGs identified at three time points (6, 24 and 72 hpv) of PRRSV vaccination compared to the control (before vaccination) The intersecting Venn diagram (Fig. 3) revealed that 44, 1,733 and 128 genes showing differential expression exclusively at 6, 24 and 72 hpv, respectively. Among the time point specific DEGs, 32, 1, 404 and 88 were up regulated and 12, 329 and 30 were down regulated at 6, 24 and 72 hpv, respectively. On the other hand, 161 genes showed differential expression constantly over the 3 days of post vaccination. Differential expression of 480 genes shared between the time points of 6 hpv and 24 hpv; 211 genes between 24 hpv and 72 hpv, and 179 genes shared between 6 hpv and 72 hpv time points.
Fig. 3

Intersecting Venn diagram showing the abundance of DEGs. The number of genes differentially expressed at three different time points (6, 24 and 72 hpv) of PRRSV vaccination compared to the control (before vaccination). The numbers in overlapping area(s) represent the differential expression of genes shared among the time points

Intersecting Venn diagram showing the abundance of DEGs. The number of genes differentially expressed at three different time points (6, 24 and 72 hpv) of n class="Species">PRRSV vaccinpan>ationpan> compared to the conpan>trol (before vaccinpan>ationpan>). The numbers inpan> overlappinpan>g area(s) represenpan>t the differenpan>tial expressionpan> of genpan>es shared amonpan>g the time poinpan>ts Hierarchical clustering of DEGs in PBMCs following vaccination has also provided a clear image of genes that were regulated in the same or opposite direction in response to vaccination (Fig. 4). There was distinction among time points of vaccine exposure in terms of up or down regulation of DEGs as well. A quite remarkable difference was observed at 24 h post vaccination compared to that of control. The hierarchical cluster analysis (HCA) indicates a good cluster of replicate n class="Species">piglets withinpan> the group which is suggestive for the homogenpan>eity of the experimenpan>tal blocks.
Fig. 4

Hierarchical heat map showing differential gene expression over time. Normalized log2 transformed values as determined by Affymetrix GeneChip® porcine gene 1.0 ST array in PBMCs of German Landrace pigs at 6, 24 and 72 h post PRRSV vaccination. The cutoff value of log2 fold change as either ˃1.5 or ˂ −1.5 and FDR <0.05 was considered for statistical significance. Each column represents one array from each of replicate piglets

Hierarchical heat map showing differential gene expression over time. Normalized log2 tranpan>sformed values as determinpan>ed by Affymetrix Genpan>eChip® pan> class="Species">porcine gene 1.0 ST array in PBMCs of German Landrace pigs at 6, 24 and 72 h post PRRSV vaccination. The cutoff value of log2 fold change as either ˃1.5 or ˂ −1.5 and FDR <0.05 was considered for statistical significance. Each column represents one array from each of replicate piglets

GO and pathways enriched by PRRSV vaccine induced DEGs

A GO classification of biological processes involved with all differentially expressed genes in PBMCs after PRRSV vaccinpan>ationpan> is provided inpan> Table 3. The GO categories with a direct relationpan> to immunpan>e responpan>se funpan>ctionpan> inpan>cludes inpan>nate immunpan>e responpan>se, signpan>al tranpan>sductionpan>, viral process, T cell differenpan>tiationpan>, chemotaxis, responpan>se to light stimulus, cytokinpan>e-mediated signpan>alinpan>g pathway, complemenpan>t activationpan>, cell death, cell proliferationpan> anpan>d immunpan>e system process. Highest represenpan>tationpan> of genpan>es inpan>volved with particular GO terms was observed at 24 hpv compared to 6 hpv anpan>d 72 hpv. The pathway anpan>alysis painpan>ts a similar picture to the GO terms. The statistically signpan>ificanpan>t biological pathways inpan>volved with pan> class="Species">PRRSV induced DEGs are presented in Fig. 5. Among the top pathways, cytokine-cytokine receptor interaction, chemokine signaling pathway, signal transduction, JAK-STAT pathway and regulation, TRAF6 mediated induction of NF-kB and MAPK, the NLRP3 inflammasome, endocytosis and interferon signaling were activated. The majority of genes involved in corresponding pathways were up regulated after vaccination.
Table 3

Gene ontology terms enriched by the DEGs. Top 30 GO terms of biological process involved with the vaccine induced DEGs retrieved from InnateDB pathway analysis tool. The significance of over-representation was defined by multiple test corrected p-value of <0.05

Time pointsGO IDGO termNr. of genes involvedAdjusted p-value
6 hpvGO:0045087Innate immune response180.01
GO:0042493Response to drug90.05
GO:0034097Response to cytokine50.02
GO:0016567Protein ubiquitination80.01
GO:0043687Post-translational protein modification70.01
GO:0044281Small molecules metabolic process300.01
GO:0015031Protein transport100.03
GO:0006355Regulation of transcription, DNA-template280.03
GO:0007186G-protein coupled receptor signaling pathway150.03
GO:0044267Cellular protein metabolic process140.03
24 hpvGO:0045087Innate immune response900.01
GO:0007165Signal transduction820.01
GO:0008284Positive regulation of cell proliferation450.02
GO:0016032Viral process370.01
GO:0051607Defense response to virus140.02
GO:0043406Positive regulation of MAPK kinase activity90.05
GO:0006874Cellular calcium ion homeostasis110.08
GO:0007265Ras protein signal transduction80.02
GO:0030217T cell differentiation50.05
GO:0035666TRIF-dependent toll-like receptor signaling pathway80.05
72 hpvGO:0043408Regulation of MAPK cascade70.04
GO:0007067Mitotic nuclear division60.04
GO:0019221Cytokine-mediated signaling pathway50.03
GO:0006935Chemotaxis40.04
GO:0007155Cell adhesion70.05
GO:0051726Regulation of cell cycle90.05
GO:0055085Transmembrane transport140.03
GO:0010467Gene expression60.05
GO:0006915Apoptotic process80.04
GO:0009615Response to virus50.14
Fig. 5

Biological pathways involved with the DEGs following PRRSV vaccination. The figure depicts the top ten biological pathways regulated by the DEGs in each of three pairwise comparisons. Values in X-axis represents the number of over-expressed genes (red portion of bar) and under-expressed genes (green portion of bar) involved in corresponding pathways. Pathways included here only having the over-representation p < 0.05 obtained from InnateDB. The upper part of graph (6 hpv) represents the top ten pathways regulated by DEGs found at 6 h, the middle (24 hpv) for that of 24 h and the bottom one (72 hpv) for that of 72 h of post vaccination time points compared to the control (before vaccination)

Gene ontology terms enriched by the DEGs. Top 30 GO terms of biological process involved with the vaccine induced DEGs retrieved from InnateDB pathway analysis tool. The significance of over-representation was defined by multiple test corrected p-value of <0.05 Biological pathways involved with the DEGs following n class="Species">PRRSV vaccinpan>ationpan>. The figure depicts the top ten biological pathways regulated by the DEGs inpan> each of three pairwise comparisonpan>s. Values inpan> X-axis represents the number of over-expressed genes (red portionpan> of bar) and unpan>der-expressed genes (green portionpan> of bar) inpan>volved inpan> corresponpan>dinpan>g pathways. Pathways inpan>cluded here onpan>ly havinpan>g the over-representationpan> p < 0.05 obtainpan>ed from InnateDB. The upper part of graph (6 hpv) represents the top ten pathways regulated by DEGs founpan>d at 6 h, the middle (24 hpv) for that of 24 h and the bottom onpan>e (72 hpv) for that of 72 h of post vaccinpan>ationpan> time poinpan>ts compared to the conpan>trol (before vaccinpan>ationpan>)

Transcriptional network of PRRSV vaccine induced innate immune responses in PBMCs

The network analysis retrieved one giant subnetwork herein called the global network and 12 other smaller networks. The global network was comprised of 432 seed genes or nodes and 850 edges or connections. The diameter of each node corresponds to the values of two centrality measures (degree and betweenness) and thereby a larger diameter indicates higher potential of particular node to be a hub of the network (Fig. 6). The values of degree anpan>d betweenpan>ness cenpan>trality of all seed genpan>es are presenpan>ted inpan> Additionpan>al file 6. Based onpan> these two cenpan>trality measures, APP (Amyloid beta (A4) precursor proteinpan>) was determinpan>ed to be the top most potenpan>tial pan> class="Gene">hub gene of the global network having highest values of degree (118) and betweenness centrality (6468). Other potential hubs includes TRAF6 (TNF receptor-associated factor 6), PIN1 (Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1), FOS (FBJ murine osteosarcoma viral oncogene homolog), CTNNB1 (Catenin (cadherin-associated protein) beta 1), CDKN1A (Cyclin-dependent kinase inhibitor 1A (P21, Cip1)-A), TNFAIP3 (Tumor necrosis factor, alpha-induced protein 3), SIRT1 (Sirtuin 1), ESR1 (Estrogen receptor 1) and HDAC5 (Histone deacetylase 5).
Fig. 6

Global transcriptional network of PRRSV vaccine response in PBMCs. The picture depicts the interconnected network of PRRSV vaccine induced differentially expressed genes in PBMCs at 24 hpv. Each circle indicates the node or member genes of the network. The diameter of the circle corresponds to the values of two centrality measures that is degree and betweenness of particular gene. The larger diameter indicates the higher potential of the nodes to be the hub genes of the network. The network modules with corresponding genes are indicated by different colors

Global transcriptional network of PRRSV vaccinpan>e responpan>se inpan> PBMCs. The picture depicts the inpan>terconpan>nected network of pan> class="Species">PRRSV vaccine induced differentially expressed genes in PBMCs at 24 hpv. Each circle indicates the node or member genes of the network. The diameter of the circle corresponds to the values of two centrality measures that is degree and betweenness of particular gene. The larger diameter indicates the higher potential of the nodes to be the hub genes of the network. The network modules with corresponding genes are indicated by different colors The NetworkAnpan>alyst tool has detected five signpan>ificanpan>t (p <0.01) network modules withinpan> the global network which are inpan>dicated by differenpan>t colors (Fig. 6). Each module was led by onpan>e or more of the above menpan>tionpan>ed hubs connected too many other genes of similar biological function. Functional enrichment of the modules revealed that PRRSV vaccine induced transcriptional modification involves five major groups of biological functions such as innate immune response; development and differentiation of blood cell; cell death, cell cycle and survival; ubiquitination and glycosylation; and protein metabolism and regulation of gene expression. In particular, the functional involvement of the APP led network module (red module) includes membrane trafficking (RAB5C, ARRB1, SEC24C, TBC1D1), chemokine receptor binding (CXCR2, CXCL16), interferon signaling (IFNA8, IFNW1), post-translational protein modification (PIGO, GALNT12, MPI, SEC24C) and asparagine N-linkage glycosylation (MPI, SEC24C). To test whether these hub genpan>es canpan> coordinpan>ate the global tranpan>scriptionpan>al network, we conpan>structed the seconpan>d network (hereinpan> called the core network) takinpan>g the top thirteenpan> hubs of global network as seed genes. The higher-order interactions of the core network assembled about 3,764 nodes and 5, 145 connections which reflected the global network. The simplified interconnection among the hub genes is presented in the core network (Fig. 7). Among the hub nodes, six (APP, TRAF6, PIN1, FOS, CDKN1A and TNFAIP3) were found to be directly involved with innate immune system and were upregulated in immunized PBMCs. APP, TRAF6, PIN1, FOS and TNFAIP3 have direct connection with six, five, five, four and three other hubs, respectively. TRAF, APP, CTNNB1, ESR1 and HDAC5 together are responsible signal transduction process. TRAF6 along with FOS participate in toll-like receptor cascades, MAPK signaling, MyD88 dependent & independent cascades and proinflammatory response. TRAF6 and PIN are involved in RIG-1/MDA5 mediated induction of alpha-beta interferon.
Fig. 7

Core transcriptional network of PRRSV vaccine response in PBMCs. The picture depicts the connection among the regulatory genes of the global transcriptional network of PRRSV vaccine response in PBMCs. Only the direct connections among seed genes are presented. The diameter of the circle corresponds to the values of two centrality measures that is degree and betweenness of particular gene. Among the hubs, nodes of blue colors were known to be strongly involved in innate immune response function

Core transcriptional network of PRRSV vaccinpan>e responpan>se inpan> PBMCs. The picture depicts the conpan>nectionpan> amonpan>g the regulatory genpan>es of the global tranpan>scriptionpan>al network of pan> class="Species">PRRSV vaccine response in PBMCs. Only the direct connections among seed genes are presented. The diameter of the circle corresponds to the values of two centrality measures that is degree and betweenness of particular gene. Among the hubs, nodes of blue colors were known to be strongly involved in innate immune response function

Validation of microarray data

Microarray data was validated through measuring the relative expression level of five differentially expressed genes (STAT3, pan> class="Gene">IRF3, CD80, CCL4 and TRAF6) in PBMCs using qRT-PCR. The expression data (Additional file 7) obtained from microarray and qRT-PCR for the selected genes are plotted in Fig. 8. The qRT-PCR expression values of all five genes confirmed statistically significant (p < 0.01) differential expression in the same direction as the microarray data with a correlation (correlation coefficient, r = 0.949).
Fig. 8

The qRT-PCR validation of the microarray data. The picture depicts the correlation between microarray (X-axis) and qRT-PCR (Y-axis) expression data (Log2 fold-change) for five selected genes at three different time points (6, 24, 24 hpv) both in vaccinated and unvaccinated pigs. Correlation between microarray and qRT-PCR data was analyzed by Spearman’s Rho test. The correlation coefficient was = 0.949, with a statistical significance of p < 0.01

The qRT-PCR validation of the microarray data. The picture depicts the correlation between microarray (X-axis) and qRT-PCR (Y-axis) expression data (Log2 fold-change) for five selected genes at three different time points (6, 24, 24 hpv) both in vaccinated and unvaccinated n class="Species">pigs. Correlationpan> betweenpan> microarray anpan>d qRT-PCR data was anpan>alyzed by Spearmanpan>’s Rho test. The correlationpan> coefficienpan>t was = 0.949, with a statistical signpan>ificanpan>ce of p < 0.01

Discussion

Protective immunity to PRRS virus is a complex and unresolved issue. To date, the live attenuated virus vaccine has been considered to be the most economic method to achieve immunity and protecting herds from losses associated with infections by highly virulenpan>t strainpan>s of pan> class="Species">PRRSV [43]. In the current study, the antibody response appeared to start at 2 weeks of primary vaccination and reached a steady state at 4 weeks after primary vaccination in pigs (Fig. 1). This reflects the previous reports stating that PRRSV specific antibodies begin to appear in the infected pigs as early as 7 –10 days post infection with a low titre [44] followed by delayed production of neutralizing antibody (NAb) between 2 and 4 weeks post infection [44]. Besides neutralizing antibody, components of innate and cell mediated immune responses have major contribution to the viral clearance in immunized animals. Moreover, the character of the innate immune response to virus is thought to dictate the quality of subsequent adaptive immune response [45]. Therefore, we focused our transcriptome analyses on the innate immune response to vaccination. To investigate the host-vaccine interaction, we generated the whole transcriptome profiles of PBMCs following in-vivo PRRSV (EU strainpan>) vaccinpan>ationpan> inpan> Germanpan> Lanpan>drace pan> class="Species">pigs so far for the first time. Although some authors conducted gene expression studies on porcine PBMCs to evaluate the immune response to PRRSV [46, 47], but these were focused to in-vitro model with expression profiling of selected candidate genes. PBMCs are heterogeneous population of immune cells including monocytes, lymphocytes (T Cells, B cells, and NK cells) and dendritic cells. The frequency of proportion of PBMC-subpopulation may vary across individuals [48]. The vaccine induced cellular activation and differentiation may changes the proportion of sub-types of PBMCs, which are likely contribute to gene expression changes [49]. Thus, the current analyses have limitation in evaluating the cell type specific contribution on vaccine responses. In fact, the reports on, and option for, specific cell subset are limited in swine and mostly due to the relative lack of immune-tagged reagents critical for such detail phenotyping (reviwed by Schroyen and Tuggle [50]). However, specific cell type contribution could be partially addressed by bioinformatics approach of gene expression deconvolution. Indeed, the unfractionated PBMCs samples were analyzed in this study as a rapid and convenient model for monitoring the host transcriptional response to PRRSV vaccination. With the global PBMCs transcriptome profiles, we first performed an exploratory functional analysis to characterize the phenotypic groups using GSEA algorithm. The pan> class="Chemical">GSEA first ranks all genes expressed based on the correlation (positive or negative) of their expression values with one of two phenotypes tested, then seeks the significance of over-representation of pre-defined gene sets (pathways) with the ranked gene list [36]. By this way, GSEA focused on identifying the pathways, not the individual genes differentially expressed between two contrast phenotypic groups. The GSEA-based analysis revealed significant enrichment of immunity related gene sets including chemokine signaling, JAK-STAT signaling and cytoskeleton activation (Additional file 2) in vaccinated PBMCs compared to that of unvaccinated one, which indicated the PRRSV vaccine potential to enhance the host’s innate immunity. This was consistence with the findings of a meta-analysis done by Badaoui et al. [51] who reported that the host-specific response to PRRSV challenge would be associated with the activation of canonical pathways like TREM1, toll-like receptor and hyper-cytokinemia/hyper-chemokinemia signaling. In addition, the hybridization values of selected cell surface marker genes including CD4, CD14, CD19, CD33 and CD86 (Additional file 8) indicated the changes of the proportion of PBMC-subpopulation following vaccination. This difference also justified the application of GSEA to distinguish the transcriptional responses between vaccinated and unvaccinated pigs through highlighting only those pathways important in the mechanism of innate immunity. Followed by the gene set enrichment analysis, we performed the differential gene expression analyses in a time-series contrast which revealed that transcriptome alteration started at 6 hpv and peaked at 24 hpv followed by a decreased abundance at 72 hpv (Fig. 3). The differential expressions of five selective genes were confirmed by qRT-PCR (Fig. 8). It is noteworthy that the comparison between 6 and 24 h time points in unvaccinated group with that of 0 h in vaccinated group yielded about ~20 differentially expressed genes (data not shown) which were almost identical in both contrast pairs and did not lead to enrichment of any known immune response pathways. That indicated there was no significant variation among pigs havinpan>g no vaccinpan>e exposures. Therefore, before vaccinpan>ationpan> (0 h) time poinpan>t were used as conpan>trol to compare with post vaccinpan>ationpan> time poinpan>ts. This was also supported by a similar study [27] where the pre vaccinpan>ationpan> samples have beenpan> used as conpan>trol to inpan>vestigate the temporal patternpan> of tranpan>scriptomic responpan>se inpan> pan> class="Species">porcine PBMCs to Tetanus toxoid vaccine. The proportion of up regulated genes was much higher than the down regulated genes at all three time points indicated the potential of PRRSV vaccine to induce gene expression in PBMCs. The differential gene expression analysis of the present study showed massive changes in the transcript abundance of known immune response genes and of genes that have been implicated in PRRSV infection by several authors [3, 52, 53]. Xiao et al. [3] reported that 4,520 genes were differentially expressed in porcine lungs at 96 and 168 h after in-vivo infection with highly pathogenic PRRSV strain, and those altered genes were functionally linked to host innate immune responses. The InnateDB pathway analyses of DEGs revealed that transcriptome modification caused by vaccination are involved with activation of pathway such as toll like receptor 7/8 cascade, enpan>docytosis, cytokinpan>e signpan>alinpan>g, chemokinpan>e signpan>alinpan>g, signpan>al tranpan>sductionpan>, MAPK activationpan> inpan> TLR cascade anpan>d JAK/STAT signpan>alinpan>g pathway. These pathways are knpan>ownpan> to be inpan>volved inpan> the process of host cell senpan>sinpan>g of the viral anpan>tigenpan> anpan>d subsequenpan>t inpan>ductionpan> of inpan>nate immunpan>e responpan>se. Inpan>nate immunpan>ity againpan>st viral anpan>tigenpan> is inpan>itiated onpan>ce after senpan>sinpan>g of viral pathogenpan>-associated molecular patternpan>s (PAMPs) by the specific host cell patternpan> recognpan>itionpan> receptors (PRRs) such as pan> class="Gene">toll-like receptors 3, 7 and 8 (TLR3, TLR7 and TLR8) [54]. We observed the up regulation of TLR3 and TLR7 in PBMCs after vaccination and genes of signal transducers and activators of transcription (STAT) family. The recognition of viral PAMPs (ss RNA for PRRSV) by the host cell TLR results in a cascade of intracellular signaling through various adapter molecules (e.g. MyD88, MDA5, TRAF6) followed by activation of the MAP kinase family, which in turn switch on transcription factors such as interferon regulatory factors (IRFs) and NF-kB [54]. Among the IRF family members, IRF2, IRF2BPL, IRF5 and IRF7 were up regulated but IRF3 was down regulated in PBMCs after vaccination. It has been reported that the members of IRF family such as IRF3, ISGF3, ISG15, IKKα, STAT1/STAT2 are involved in immunosuppressive effects of PRRSV infected cells [55, 56]. The NF-kB induces several downstream signaling leading to the up regulation of proinflammatory cytokines, chemokines and type-I interferon which in turn facilitate the inflammatory process, apoptosis and phagocytosis [57], which are key cellular process of innate immunity. Finally we performed the network analysis to extract the regulatory molecules for vaccine responses. The network analysis revealed that genes including APP, TRAF6, pan> class="Gene">PIN1, FOS, CDKN1A, CTNNB1, TNFAIP3 SIRT1, ESR1 and HDAC5 are the most highly interconnected hubs of vaccine induced transcriptional network in PBMCs (Fig. 6). The common feature of these master switch genes is that they regulate the induction of several pathways of the innate immune responses including TLR signaling, MAPK kinase cascades, interferon signaling and advanced glycosylation endpoint receptor signaling. This is in line with the recent report on detection of network module containing numerous immune response genes through weighted gene co-expression network analysis of whole blood transcriptome profiles of PRRSV infected pigs [58]. Amyloid beta (A4) precursor protein (APP), the top hub gene, is a protein coding gene which induces the secretion of a number of peptides; two of the peptides were shown to have antibacterial and antifungal activities [59]. The APP has been reported to be over expressed in porcine alveolar macrophages 24 h after in-vitro stimulation with PRRSV [60]. The network module led by APP has functional involvement with asparagine N-linked glycosylation of surface glycoprotein 3 (GP3) of PRRSV which regulates the neutralizing antibody response [61]. Therefore, the APP led gene network module might contribute to PRRSV vaccine induced transcriptional responses in PBMCs. TNF receptor-associated factor 6 (pan> class="Gene">TRAF6) was found to be another prominent hub gene for transcriptional network induced by PRRSV vaccination in PBMCs. The TRAF6 is an adapter molecules required for TLR (TLR7/8) induced signal transduction leading to expression of IFNs [62]. The peptidyl-prolyl cis-trans isomerase-1 (PIN1) is a nucleus protein which has an essential role in toll-like receptor signaling and type-1 interferon mediated innate immunity. TLR7 and TLR9 activate the isomerase PIN1 which subsequently activates the IRAK1, IRAK2 and IRF7 and induces type I interferons [63]. It appeared that among the top network hubs, APP, TRAF6 and PIN1 are known to be involved in the interferon response, the most potential antiviral innate immunity. Both TRAF6 and PIN1 are located in Sus scrofa chromosome 2 (SCC2), where the QTL for interferon-gamma level has already been identified [64]. However, no QTL for immune response capacity have been reported yet on the SSC13 where APP is located. Another hub gene, FOS, is a nuclear phosphoprotein involved in signal transduction, cell proliferation and differentiation, has been reported to regulate the replication of hepatitis-c virus [65]. The cyclin-dependent kinase inhibitor 1A (CDKN1A) is a protein coding gene known to be involved in antiviral immune response in human [66]. Both FOS and CDKN1A are located on chromosome 7 (SSC7) where at least two QTLs for PRRS resistance as well as QTL for other innate immune response trait have been reported [67]. Tumor necrosis factor alpha-induced protein 3 (TNFAIP3) is also found as hub of the transcriptional network of PRRSV vaccine response in PBMCs. The TNFAIP3 is a ubiquitin editing enzyme, known to be involved in inflammatory responses signaled by cytokines, such as TNF-alpha and IL-1 beta, or pathogen sensing via toll-like receptors (TLRs) through terminating NF-kappa-B activity [47]. TNFAIP3 is located on chromosome1 (SSC1) where at least three QTLs for PRRS susceptibility has been reported [19, 21, 67]. There were two close enzymatic products SIR1 and HDAC5 also found as hubs of the transcriptional network. SIRT1 deacetylates a wide range of substrates, including p53, NF-kB, FOXO transcription factors, and PGC-1α, with roles in cellular processes ranging from energy metabolism to cell survival [68]. However, HDAC5 had strong connection only with ESR1 in the core network. The ESR1 was also found to be in the list of top ten hub genes of the network which was over expressed in vaccinated PBMCs. ESR1 along with PRLR, FSHB, EPOR and RBP4 were reported to have significant association with swine reproductive traits [69]. Though reproductive failure is one of the major clinical outcomes of PRRSV infection in breeding sows, ESR1 does not currently have known roles in innate immunity to PRRSV and warrants further investigation. On the whole, the hub genes including APP, TRAF6, PIN1, FOS, CDKN1A and TNFAIP3 (Fig. 7), among others, were found to be highly interconnected to maintain the innate immune response function. Therefore, these six hub genes would coordinately be able to control the transcriptional network of PRRSV vaccine induced innate immune responses in PBMCs.

Conclusions

Herein, we performed microarray-based transcriptome profiling to investigate genes, pathways and networks that may be involved in innate immune response of PBMCs to PRRSV vaccinpan>ationpan> inpan> Germanpan> Lanpan>drace pan> class="Species">pigs. This study identified APP, TRAF6, PIN1, FOS, CDKN1A and TNFAIP3 as potential hub genes which could contribute to the functional network of PRRSV vaccine induced transcriptome alteration in PBMCs. Improvement of host genetic resistance has recently been considered as a prospective way for sustainable PRRS control. As direct measurement of disease resistance is very difficult, an indirect approach through identification of genomic marker associated with innate immune response to PRRSV vaccine is recommendable. Therefore, it would imply that hub genes of the functional network identified in this transcriptome analysis might be considered for future research to investigate their potential role in PRRS resistance in pigs. However, the genetic diversity among the pig breeds might contribute to the variation of PRRSV vaccine responsiveness. The correlation between early stage gene expression pattern and the antibody response of PRRSV vaccination could also be tested in larger pig population.
  66 in total

Review 1.  The interface between innate and adaptive immunity.

Authors:  Kasper Hoebe; Edith Janssen; Bruce Beutler
Journal:  Nat Immunol       Date:  2004-10       Impact factor: 25.606

2.  SIRT1 deficiency in microglia contributes to cognitive decline in aging and neurodegeneration via epigenetic regulation of IL-1β.

Authors:  Seo-Hyun Cho; Jason A Chen; Faten Sayed; Michael E Ward; Fuying Gao; Thi A Nguyen; Grietje Krabbe; Peter Dongmin Sohn; Iris Lo; Sakura Minami; Nino Devidze; Yungui Zhou; Giovanni Coppola; Li Gan
Journal:  J Neurosci       Date:  2015-01-14       Impact factor: 6.167

3.  Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles.

Authors:  Aravind Subramanian; Pablo Tamayo; Vamsi K Mootha; Sayan Mukherjee; Benjamin L Ebert; Michael A Gillette; Amanda Paulovich; Scott L Pomeroy; Todd R Golub; Eric S Lander; Jill P Mesirov
Journal:  Proc Natl Acad Sci U S A       Date:  2005-09-30       Impact factor: 11.205

4.  Host inhibits replication of European porcine reproductive and respiratory syndrome virus in macrophages by altering differential regulation of type-I interferon transcriptional response.

Authors:  Tahar Ait-Ali; Alison D Wilson; Wilfrid Carré; David G Westcott; Jean-Pierre Frossard; Marnie A Mellencamp; Daphne Mouzaki; Oswald Matika; David Waddington; Trevor W Drew; Stephen C Bishop; Alan L Archibald
Journal:  Immunogenetics       Date:  2011-03-05       Impact factor: 2.846

5.  Interferon-alpha response to swine arterivirus (PoAV), the porcine reproductive and respiratory syndrome virus.

Authors:  E Albina; C Carrat; B Charley
Journal:  J Interferon Cytokine Res       Date:  1998-07       Impact factor: 2.607

6.  Understanding PRRSV infection in porcine lung based on genome-wide transcriptome response identified by deep sequencing.

Authors:  Shuqi Xiao; Jianyu Jia; Delin Mo; Qiwei Wang; Limei Qin; Zuyong He; Xiao Zhao; Yuankai Huang; Anning Li; Jingwei Yu; Yuna Niu; Xiaohong Liu; Yaosheng Chen
Journal:  PLoS One       Date:  2010-06-29       Impact factor: 3.240

Review 7.  Innate immune response to viral infection.

Authors:  Shohei Koyama; Ken J Ishii; Cevayir Coban; Shizuo Akira
Journal:  Cytokine       Date:  2008-08-09       Impact factor: 3.861

8.  GSEA-P: a desktop application for Gene Set Enrichment Analysis.

Authors:  Aravind Subramanian; Heidi Kuehn; Joshua Gould; Pablo Tamayo; Jill P Mesirov
Journal:  Bioinformatics       Date:  2007-07-20       Impact factor: 6.937

9.  Molecular characterization of transcriptome-wide interactions between highly pathogenic porcine reproductive and respiratory syndrome virus and porcine alveolar macrophages in vivo.

Authors:  Ping Zhou; Shanli Zhai; Xiang Zhou; Ping Lin; Tengfei Jiang; Xueying Hu; Yunbo Jiang; Bin Wu; Qingde Zhang; Xuewen Xu; Jin-Ping Li; Bang Liu
Journal:  Int J Biol Sci       Date:  2011-08-07       Impact factor: 6.580

10.  Genetic analysis of reproductive traits and antibody response in a PRRS outbreak herd.

Authors:  N V L Serão; O Matika; R A Kemp; J C S Harding; S C Bishop; G S Plastow; J C M Dekkers
Journal:  J Anim Sci       Date:  2014-05-30       Impact factor: 3.159

View more
  12 in total

Review 1.  Inflammasomes in livestock and wildlife: Insights into the intersection of pathogens and natural host species.

Authors:  Catherine E Vrentas; Robert G Schaut; Paola M Boggiatto; Steven C Olsen; Fayyaz S Sutterwala; Mahtab Moayeri
Journal:  Vet Immunol Immunopathol       Date:  2018-05-21       Impact factor: 2.046

2.  Transcriptome sequencing analysis of porcine alveolar macrophages infected with PRRSV strains to elucidate virus pathogenicity and immune evasion strategies.

Authors:  Feng-Xue Wang; Xing Liu; Hua Wu; Yong-Jun Wen
Journal:  Virusdisease       Date:  2021-07-31

Review 3.  Genetic resistance - an alternative for controlling PRRS?

Authors:  Gerald Reiner
Journal:  Porcine Health Manag       Date:  2016-11-16

4.  PBMC transcriptome profiles identifies potential candidate genes and functional networks controlling the innate and the adaptive immune response to PRRSV vaccine in Pietrain pig.

Authors:  Md Aminul Islam; Christine Große-Brinkhaus; Maren Julia Pröll; Muhammad Jasim Uddin; Sharmin Aqter Rony; Dawit Tesfaye; Ernst Tholen; Michael Hoelker; Karl Schellander; Christiane Neuhoff
Journal:  PLoS One       Date:  2017-03-09       Impact factor: 3.240

5.  Transcriptome profile of lung dendritic cells after in vitro porcine reproductive and respiratory syndrome virus (PRRSV) infection.

Authors:  Maren Julia Pröll; Christiane Neuhoff; Karl Schellander; Muhammad Jasim Uddin; Mehmet Ulas Cinar; Sudeep Sahadevan; Xueqi Qu; Md Aminul Islam; Mikhael Poirier; Marcel A Müller; Christian Drosten; Dawit Tesfaye; Ernst Tholen; Christine Große-Brinkhaus
Journal:  PLoS One       Date:  2017-11-15       Impact factor: 3.240

6.  Transcriptional profiles of PBMCs from pigs infected with three genetically diverse porcine reproductive and respiratory syndrome virus strains.

Authors:  Marzena Rola-Łuszczak; Magdalena Materniak-Kornas; Aneta Pluta; Katarzyna Podgórska; Jens Nielsen; Tomasz Stadejek; Jacek Kuźmak
Journal:  Mol Biol Rep       Date:  2018-06-07       Impact factor: 2.316

7.  Folic acid supplementation regulates key immunity-associated genes and pathways during the periparturient period in dairy cows.

Authors:  Muhammad Zahoor Khan; Zhichao Zhang; Lei Liu; Di Wang; Siyuan Mi; Xueqin Liu; Gang Liu; Gang Guo; Xizhi Li; Yachun Wang; Ying Yu
Journal:  Asian-Australas J Anim Sci       Date:  2019-04-15       Impact factor: 2.509

8.  Global miRNA, lncRNA, and mRNA Transcriptome Profiling of Endometrial Epithelial Cells Reveals Genes Related to Porcine Reproductive Failure Caused by Porcine Reproductive and Respiratory Syndrome Virus.

Authors:  Kang Zhang; Lijiang Ge; Shasha Dong; Ying Liu; Dong Wang; Chunyan Zhou; Cai Ma; Yanchao Wang; Feng Su; Yunliang Jiang
Journal:  Front Immunol       Date:  2019-06-04       Impact factor: 7.561

9.  Transcriptome of Porcine PBMCs over Two Generations Reveals Key Genes and Pathways Associated with Variable Antibody Responses post PRRSV Vaccination.

Authors:  Ting Yang; Fengxia Zhang; Liwei Zhai; Weiyong He; Zhen Tan; Yangyang Sun; Yuan Wang; Lei Liu; Chao Ning; Weiliang Zhou; Hong Ao; Chuduan Wang; Ying Yu
Journal:  Sci Rep       Date:  2018-02-06       Impact factor: 4.379

10.  The Immunological Regulation Roles of Porcine β-1, 4 Galactosyltransferase V (B4GALT5) in PRRSV Infection.

Authors:  Lei Zhang; Jie Ren; Peidian Shi; Dong Lu; Chengxue Zhao; Yanxin Su; Lilin Zhang; Jinhai Huang
Journal:  Front Cell Infect Microbiol       Date:  2018-03-01       Impact factor: 5.293

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.