Literature DB >> 27502441

MicroRNA-21 Mediates Angiotensin II-Induced Liver Fibrosis by Activating NLRP3 Inflammasome/IL-1β Axis via Targeting Smad7 and Spry1.

Zuo-Wei Ning1, Xiao-Ying Luo1, Guo-Zhen Wang1, Yang Li1, Miao-Xia Pan2, Ren-Qiang Yang3, Xu-Guang Ling3, Shan Huang1, Xiao-Xin Ma1, Si-Yi Jin1, Dan Wang1, Xu Li1,4.   

Abstract

AIMS: Angiotensin II (AngII), a vasoconstrictive peptide of the renin-angiotensin system (RAS), promotes hepatic fibrogenesis and induces microRNA-21(mir-21) expression. Angiotensin-(1-7) [Ang-(1-7)] is a peptide of the RAS, which attenuates liver fibrosis. Recently, it was reported that the NOD-like receptor family, pyrin domain containing 3 (NLRP3) inflammasome participated in liver fibrosis. However, it remains unclear how mir-21 mediates AngII-induced NLRP3 inflammasome activation. We investigate the role of AngII-induced mir-21 in the regulation of NLRP3 inflammasome/IL-1β axis in liver fibrosis.
RESULTS: In vivo, circulating mir-21 was upregulated in patients with liver fibrosis and was positively correlated with liver fibrosis and oxidation. Treatment with Ang-(1-7) inhibited mir-21, NLRP3 inflammasome, and liver fibrosis after bile duct ligation (BDL) or AngII infusion. Inhibition of mir-21 suppressed the Smad7/Smad2/3/NOX4, Spry1/ERK/NF-κB pathway, NLRP3 inflammasome, and liver fibrosis induced by AngII infusion. In vitro, AngII upregulated mir-21 expression via targeting Smad7 and Spry1 in primary hepatic stellate cells (HSCs). In contrast, Ang-(1-7) suppressed mir-21 expression and oxidation induced by AngII. Overexpression of mir-21 promoted oxidation, and collagen production enhanced the effect of AngII on NLRP3 inflammasome activation via the Spry1/ERK/NF-κB, Smad7/Smad2/3/NOX4 pathways. However, downregulation of mir-21 exerted the opposite effects. Innovation and Conclusions: Mir-21 mediates AngII-activated NLRP3 inflammasome and resultant HSC activation via targeting Spry1 and Smad7. Ang-(1-7) protected against BDL or AngII infusion-induced hepatic fibrosis and inhibited mir-21 expression. Antioxid. Redox Signal. 27, 1-20.

Entities:  

Keywords:  NLRP3 inflammasome; angiotensin II; angiotensin-(1-7); liver fibrosis; microRNA 21; reactive oxygen species

Mesh:

Substances:

Year:  2016        PMID: 27502441      PMCID: PMC5488354          DOI: 10.1089/ars.2016.6669

Source DB:  PubMed          Journal:  Antioxid Redox Signal        ISSN: 1523-0864            Impact factor:   8.401


Introduction

Liver fibrosis, with excessive extracellular matrix deposition, is a common stage of chronic liver diseases. Hepatic stellate cells (HSCs) play a key role in liver fibrogenesis in response to profibrogenic mediators (10). MicroRNA-21 (mir-21) has been shown to promote fibrogenesis in cardiac muscle (38), kidneys (46), and lungs (20). Moreover, recent studies indicated that mir-21 induces liver fibrosis by activating HSCs (12, 48). Smad7, an inhibitory Smad that downregulates the TGF-β/Smad pathway, is a target of mir-21 (20). In addition, the ERK-negative regulator Spry1, also a target of mir-21, mediates the effects of mir-21 through augmenting ERK kinase activity in cardiac fibroblasts (38) and HSCs (49). Hence, mir-21 stimulates the Smad, ERK pathway by promoting Smad7 and Spry1 degradation. However, the potential link between these two target genes during mir-21-induced HSC activation remains unclear and needs further investigation. AngII-induced mir-21 activates NLRP3 inflammasome in hepatic stellate cells (HSCs) via targeting Spry1 and Smad7, resulting in HSC activation. Ang-(1–7) protected against bile duct ligation or AngII-induced liver fibrosis and inhibited the expression of mir-21. Recently, the NOD-like receptor family, pyrin domain containing 3 (NLRP3) inflammasome complex (including NOD-like receptor NLRP3, the adaptor molecule apoptosis-associated speck-like protein containing a caspase-recruitment domain (ASC), and the effector molecule procaspase-1) has been revealed as the novel mediator of liver fibrosis (36). It is believed that NLRP3 activation causes assembly of the NLRP3 inflammasome, leading to activation of caspase-1, which cleaves pro-IL-1β and pro-IL-18 to their maturational forms (34). The NLRP3 inflammasome has been reported to amplify chronic liver inflammation and activate HSCs (39, 41). The NLRP3 inflammasome is a promising target for treatment of hepatic fibrosis. NLRP3 inflammasome activation includes a two-step process: the first signaling step termed as the signal 1: NF-κB activation, mostly activated by toll-like receptor 4 (TLR4)-ligand lipopolysaccharide (LPS), promotes NLRP3 and pro-IL-1β gene transcription; while the signal 2 triggers functional NLRP3 inflammasome activation by inflammasome ligands, including both pathogen-associated molecular patterns and endogenous damage associated molecular patterns (DAMPs). Among DAMP molecules, the NADPH oxidase (NOX)-derived reactive oxygen species (ROS) is a key factor that initiates the second signaling step (36). Several studies indicated a close link between mir-21 and NLRP3 inflammasome. Ling et al. reported that mir-21 induces the ERK/NF-κB pathway via degrading the target gene Spry1 (19). In addition, mir-21 increased ROS generation by decreasing the activity of superoxide dismutase (47). Furthermore, Smad2/3 mediated NOX4-derived ROS production (35). Hence, mir-21 has the potential to increase NOX4-derived ROS production by targeting Smad7 for degradation. As a result, we infer that mir-21 activates the ERK/NF-κB, Smad/NOX4/ROS pathway via reducing Spry1 and Smad7, leading to activation of NLRP3 inflammasome/IL-1β axis. Angiotensin II (AngII), a component of the renin–angiotensin system (RAS), has been implicated in the pathogenesis of fibrosis in the kidneys (42), lungs (43), and liver (28). As a vasoconstrictive peptide, AngII triggers hypertension by activation and infiltration of certain subsets of immune cells (11, 16, 40). In addition, being a pro-oxidative peptide, AngII triggers formation of NOX4-derived ROS (4, 25) and mitochondrial reactive oxygen species (mito-ROS) (6, 8, 15), the mito-ROS lead to white blood cell activation and inflammation (17). Interestingly, there exists interaction and cross-activation between AngII-induced mito-ROS and NADPH oxidase-dependent ROS (6, 8, 15). It is well known that the mito-ROS contribute to the activation of the NLRP3 inflammasome (50) providing the link between AngII-induced mito-ROS formation and inflammation. Our previous study (4) further confirmed that Ang II enhanced NOX4-derived ROS production in HSCs, leading to NLRP3 inflammasome activation and resultant collagen synthesis. Recent study reported that AngII promotes mir-21 expression (21), suggesting that mir-21 is likely to mediate AngII-induced liver fibrosis. Nevertheless, the mechanism by which mir-21 mediates AngII-induced NLRP3 inflammasome activation and collagen synthesis in HSCs remains unclear. Angiotensin-(1–7) [Ang-(1–7)], another peptide in RAS, regulates Ang II negatively (9). Ang-(1–7) is believed to protect against fibrosis in the liver (22) and lungs (25) by inhibiting the profibrotic effect of AngII. Reports regarding the relationship between Ang-(1–7) and mir-21 are rare and only one study has reported that Ang-(1–7) reduced mir-21 expression in the muscle (1). How mir-21 mediates the antifibrotic effects of Ang-(1–7) against hepatic fibrosis deserves further investigation. Therefore, we hypothesized that AngII-induced mir-21 activates the ERK/NF-κB, Smad/NOX4/ROS pathway in HSCs via targeting Spry1 and Smad7, leading to NLRP3 inflammasome/IL-1β axis activation and thus contributing to liver fibrosis. Furthermore, we inferred that Ang-(1–7) inhibits AngII-induced mir-21 expression in liver fibrosis. The present study aimed to investigate the role of AngII-induced mir-21 in the regulation of NLRP3 inflammasome/IL-1β axis in vitro and in vivo. We demonstrate that AngII-induced mir-21 activated NLRP3 inflammasome/IL-1β axis in HSCs via targeting Spry1 and Smad7, resulting in HSC activation. Ang-(1–7) protected against bile duct ligation (BDL)- or AngII-induced liver fibrosis and inhibited mir-21 expression.

Results

Circulating mir-21 level positively correlates with human liver fibrosis and oxidation

We analyzed the correlation between mir-21 levels and human liver fibrosis. In situ hybridization (ISH) and quantitative reverse-transcription polymerase chain reaction (q-RT-PCR) results showed that the ISHAK score/METAVIR score, mir-21 levels in blood and liver, liver FibroScan value, area density of Masson's trichrome staining, ALT/AST content, and H2O2 content from patients with liver fibrosis were significantly higher than those from the control group. The mir-21 ISH, α-smooth actin (α-SMA), and von Willebrand factor (VWF) immunohistochemical (IHC) staining of serial section illustrated that the mir-21 was generated by HSCs. Association study showed a positive correlation of circulating mir-21 levels with liver mir-21 levels (r = 0.477, p = 0.018), liver FibroScan value (r = 0.816, p = 0.000), area density of Masson's trichrome staining (r = 0.785, p = 0.000), ALT (r = 0.606, p = 0.002), AST (r = 0.575, p = 0.003), and liver H2O2 content (r = 0.816, p = 0.00) (Fig. 1).

Representative pictures of H&E and Masson's trichrome staining and mir-21 ISH and α-SMA and VWF IHC staining of serial section. Original magnification: × 200. (B) Morphological changes in fibrotic liver quantified using the ISHAK score and METAVIR score. (C–E) The levels of mir-21 in human liver tissues and blood were determined by q-RT-PCR. Correlation between blood mir-21 expression (2−ΔΔct) and liver tissue mir-21 expression (2−ΔΔct). (F, G) Instantaneous elasticity of normal and cirrhotic livers detected by FibroScan. Correlation between blood mir-21 expression (2−ΔΔct) and liver FibroScan value (Kpa). (H, I) Quantitative measurement of area density of Masson's trichrome staining. Correlation between blood mir-21 expression (2−ΔΔct) and area density of collagen. (J–L) The contents of ALT and AST in serum of cirrhotic patients and normal persons. Correlation between blood mir-21 expression (2−ΔΔct) and ALT/AST content (U/L). (M, N) The hydrogen peroxide content of liver tissue. Correlation between blood mir-21 expression (2−ΔΔct) and hydrogen peroxide content. n = 12 per group. The data are presented as mean ± SEM. *p < 0.05 versus the control or the normal. IHC, immunohistochemical; ISH, in situ hybridization; q-RT-PCR, quantitative reverse-transcription polymerase chain reaction; α-SMA, α-smooth actin; VWF, von Willebrand factor. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

Representative pictures of H&E and Masson's trichrome staining and mir-21 ISH and α-SMA and VWF IHC staining of serial section. Original magnification: × 200. (B) Morphological changes in fibrotic liver quantified using the ISHAK score and METAVIR score. (C–E) The levels of mir-21 in human liver tissues and blood were determined by q-RT-PCR. Correlation between blood mir-21 expression (2−ΔΔct) and liver tissue mir-21 expression (2−ΔΔct). (F, G) Instantaneous elasticity of normal and cirrhotic livers detected by FibroScan. Correlation between blood mir-21 expression (2−ΔΔct) and liver FibroScan value (Kpa). (H, I) Quantitative measurement of area density of Masson's trichrome staining. Correlation between blood mir-21 expression (2−ΔΔct) and area density of collagen. (J–L) The contents of ALT and AST in serum of cirrhotic patients and normal persons. Correlation between blood mir-21 expression (2−ΔΔct) and ALT/AST content (U/L). (M, N) The hydrogen peroxide content of liver tissue. Correlation between blood mir-21 expression (2−ΔΔct) and hydrogen peroxide content. n = 12 per group. The data are presented as mean ± SEM. *p < 0.05 versus the control or the normal. IHC, immunohistochemical; ISH, in situ hybridization; q-RT-PCR, quantitative reverse-transcription polymerase chain reaction; α-SMA, α-smooth actin; VWF, von Willebrand factor. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

Upregulation of Smad2/3, NOX4, ERK, NF-κB, and NLRP3 inflammasome protein levels in human fibrotic liver tissue

Smad7 and Spry1 protein levels in fibrotic liver tissue were lower than those in the control group. However, Smad2/3, NOX4, ERK, NF-κB, and NLRP3 inflammasome protein levels were higher in fibrotic liver tissue than in the control group (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/ars).

Ang-(1–7) infusion suppressed mir-21, Smad7/Smad2/3/NOX4, Spry1/ERK/NF-κB pathway, NLRP3 inflammasome, and liver fibrosis induced by BDL or AngII infusion in rat liver

Ang-(1–7) treatment attenuated BDL or AngII infusion-induced liver fibrosis (Figs. 2A, C, D and 3A, C, D). The BDL- or AngII-treated rats were characterized by increased mir-21 expression. However, Ang-(1–7) reduced the expression of mir-21 (Figs. 2A, B and 3A, B). Moreover, BDL treatment and AngII infusion resulted in decreased Smad7 and Spry1 protein levels but increased Smad2/3/NOX4, ERK-NF-κB, NLRP3 inflammasome, α-SMA, and α-collagen I (COL1A) protein levels and H2O2 content in the liver, which was reversed by Ang-(1–7) infusion (Figs. 2A, E–H and 3A, E–G).

Ang(1–7) infusion suppressed B pathway, NLRP3 inflammasome, and liver fibrosis after BDL in the rat liver. (A) Representative pictures of liver sections stained with H&E and Masson's trichrome. IHC staining was performed to determine the localization and expression of α-SMA, NOX4, Smad7, and Spry1 proteins. ISH staining was performed to determine the localization and expression of mir-21. Original magnification: × 200. (B) Expression of mir-21 in the liver was determined by q-RT-PCR. (C) Morphological changes in fibrotic liver quantified using the ISHAK and METAVIR scores. (D, E) The hydroxyproline and hydrogen peroxide content in the liver in different groups. (F–H) Smad7, p-Smad2/3, Smad4, Smad2/3, NOX4, Spry1, p-ERK, NF-κB, NLRP3, caspase1, ASC, IL-1β, α-SMA, and COL1A protein levels in liver tissues were analyzed by Western blotting. n = 9 per group. The data are presented as mean ± SEM. *p < 0.05 versus the Sham group; &p < 0.05 versus the BDL group. ASC, apoptosis-associated speck-like protein containing a caspase-recruitment domain; BDL, bile duct ligation; NLRP3, NOD-like receptor family, pyrin domain containing 3; NOX, NADPH oxidase. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

Ang(1–7) infusion suppressed B pathway, NLRP3 inflammasome, and liver fibrosis induced by AngII infusion in rat liver. (A) Representative pictures and quantitative measurement of liver sections stained with H&E and Masson's trichrome. IHC staining was performed to determine the localization and expression of α-SMA, NOX4, Smad7, and Spry1 proteins. ISH staining was performed to determine the localization and expression of mir-21. Original magnification: × 200. (B) The expression of mir-21 in livers was determined by RT-qPCR. (C) Morphological changes in fibrotic liver quantified using the ISHAK and METAVIR scores. (D, E) The hydroxyproline and hydrogen peroxide content of livers in different groups. (F, G) The protein levels of Smad7, p-Smad2/3, Smad4, Smad2/3, NOX4, Spry1, p-ERK, NF-κB, NLRP3 inflammasome, α-SMA, and COL1A in liver tissues were analyzed by Western blot. n = 9 per group. The data are presented as the mean ± SEM. *p < 0.05 versus the Sham group; &p < 0.05 versus the AngII treatment group. AngII, angiotensin II. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

Ang(1–7) infusion suppressed B pathway, NLRP3 inflammasome, and liver fibrosis after BDL in the rat liver. (A) Representative pictures of liver sections stained with H&E and Masson's trichrome. IHC staining was performed to determine the localization and expression of α-SMA, NOX4, Smad7, and Spry1 proteins. ISH staining was performed to determine the localization and expression of mir-21. Original magnification: × 200. (B) Expression of mir-21 in the liver was determined by q-RT-PCR. (C) Morphological changes in fibrotic liver quantified using the ISHAK and METAVIR scores. (D, E) The hydroxyproline and hydrogen peroxide content in the liver in different groups. (F–H) Smad7, p-Smad2/3, Smad4, Smad2/3, NOX4, Spry1, p-ERK, NF-κB, NLRP3, caspase1, ASC, IL-1β, α-SMA, and COL1A protein levels in liver tissues were analyzed by Western blotting. n = 9 per group. The data are presented as mean ± SEM. *p < 0.05 versus the Sham group; &p < 0.05 versus the BDL group. ASC, apoptosis-associated speck-like protein containing a caspase-recruitment domain; BDL, bile duct ligation; NLRP3, NOD-like receptor family, pyrin domain containing 3; NOX, NADPH oxidase. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars Ang(1–7) infusion suppressed B pathway, NLRP3 inflammasome, and liver fibrosis induced by AngII infusion in rat liver. (A) Representative pictures and quantitative measurement of liver sections stained with H&E and Masson's trichrome. IHC staining was performed to determine the localization and expression of α-SMA, NOX4, Smad7, and Spry1 proteins. ISH staining was performed to determine the localization and expression of mir-21. Original magnification: × 200. (B) The expression of mir-21 in livers was determined by RT-qPCR. (C) Morphological changes in fibrotic liver quantified using the ISHAK and METAVIR scores. (D, E) The hydroxyproline and hydrogen peroxide content of livers in different groups. (F, G) The protein levels of Smad7, p-Smad2/3, Smad4, Smad2/3, NOX4, Spry1, p-ERK, NF-κB, NLRP3 inflammasome, α-SMA, and COL1A in liver tissues were analyzed by Western blot. n = 9 per group. The data are presented as the mean ± SEM. *p < 0.05 versus the Sham group; &p < 0.05 versus the AngII treatment group. AngII, angiotensin II. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

Inhibition of mir-21 suppressed activation of Smad7/Smad2/3/NOX4, Spry1/ERK/NF-κB pathway, NLRP3 inflammasome, and liver fibrosis induced by AngII infusion

Lenti-mir-21-down reduced liver fibrosis and the mir-21 expression induced by AngII (Fig. 4A–D). In addition, AngII infusion resulted in decreased Smad7 and Spry1 protein levels but increased Smad2/3/NOX4, ERK-NF-κB, NLRP3 inflammasome, α-SMA, and COL1A protein levels and H2O2 content in the liver, which could be reversed by lenti-mir-21-down treatment (Fig. 4A, E–G).

Inhibition of B pathway, NLRP3 inflammasome, and liver fibrosis induced by AngII infusion. (A) Representative pictures and quantitative measurement of liver sections stained with H&E and Masson's trichrome. IHC staining was performed to determine the localization and expression of α-SMA, NOX4, Smad7, and Spry1 proteins. ISH staining was performed to determine the localization and expression of mir-21. Original magnification: × 200. (B) Mir-21 expression in the liver was determined by RT-qPCR. (C) Morphological changes in the fibrotic liver quantified using the ISHAK and METAVIR scores. (D, E) The hydroxyproline and hydrogen peroxide content in the different groups. (F, G) Smad7, p-Smad2/3, Smad4, Smad2/3, NOX4, Spry1, p-ERK, NF-κB, NLRP3, caspase1, ASC, IL-1β, α-SMA, and COL1A protein levels in liver tissues were analyzed by Western blotting. The data are presented as mean ± SEM. *p < 0.05 versus the Sham group; &p < 0.05 versus the AngII treatment group. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

Inhibition of B pathway, NLRP3 inflammasome, and liver fibrosis induced by AngII infusion. (A) Representative pictures and quantitative measurement of liver sections stained with H&E and Masson's trichrome. IHC staining was performed to determine the localization and expression of α-SMA, NOX4, Smad7, and Spry1 proteins. ISH staining was performed to determine the localization and expression of mir-21. Original magnification: × 200. (B) Mir-21 expression in the liver was determined by RT-qPCR. (C) Morphological changes in the fibrotic liver quantified using the ISHAK and METAVIR scores. (D, E) The hydroxyproline and hydrogen peroxide content in the different groups. (F, G) Smad7, p-Smad2/3, Smad4, Smad2/3, NOX4, Spry1, p-ERK, NF-κB, NLRP3, caspase1, ASC, IL-1β, α-SMA, and COL1A protein levels in liver tissues were analyzed by Western blotting. The data are presented as mean ± SEM. *p < 0.05 versus the Sham group; &p < 0.05 versus the AngII treatment group. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

AngII upregulated mir-21 level targeting Smad7 and Spry1 in HSCs

AngII treatment increased mir-21 level (Fig. 5A, B). AngII-induced mir-21 expression was reduced by Smad3 siRNA but not by Smad2 siRNA (Fig. 5C, D), suggesting that Smad3 but not Smad2 mediates AngII-induced expression of mir-21 in HSCs. In addition, VAS2870, NAC, catalase, and mito-TEMPO inhibited the expression of mir-21 induced by AngII (Fig. 5E). Meanwhile, U0126 and BAY suppressed the expression of mir-21 induced by AngII (Fig. 5F). Computational predictions revealed two conserved targets of mir-21 in the 3′UTR of Smad7 mRNA and one in the 3′UTR of Spry1 mRNA (Fig. 5G, I). We constructed luciferase reporters containing these wild or mutated 3′UTR of Smad7 and Spry1 binding sites for mir-21. Our results showed that overexpression of mir-21 significantly inhibited luciferase activity of the wild-type Smad7 and Spry1 3′UTR reporters but not the mutant-type Smad7 and Spry1 3′UTR reporters (Fig. 5H, J). The data indicated that Smad7 and Spry1 are targets of mir-21.

AngII upregulated the expression of HSCs were treated with AngII at different concentrations for 24 h or treated with AngII at different times at a concentration of 10−7 M. Mir-21 levels were detected by q-RT-PCR. Small nucleolar RNA U6 was used as an internal reference. Mean ± SEM. *p < 0.05 versus control; #p < 0.05 versus the AngII 12 h; &p < 0.05 versus AngII 10−5 M or AngII 10−9 M. (C, D) HSCs were transfected with Smad2 or Smad3 siRNA before stimulation with AngII (10−7 M) as indicated for 24 h. The mir-21 levels were detected by RT-qPCR. Mean ± SEM. *p < 0.05 versus control; #p < 0.05 versus NC; &p < 0.05 versus si-Smad2 or NC+AngII. (E, F) Cells were pretreated with VAS2870 (50 μM), NAC (10−3 M), mito-TEMPO (100 U/ml), catalase (10 mM), BAY (10−5 M), and U0126 (10−5 M) for 1 h before stimulation with AngII (10−7 M), as indicated, for 24 h. Mir-21 levels were detected by RT-qPCR. Mean ± SEM. *p < 0.05 versus control; #p < 0.05 versus AngII. (G, I) Conserved miR-21-binding sites in the 3′UTRs of Smad7 and Spry1 mRNA. Predicted consequential pairing of the target regions and miR-21 (framed) were based on TargetScan (www.targetscan.org/) (H, J) Luciferase reporters containing wild-type or mutant 3′UTRs of mouse Smad7 or Spry1 gene were cotransfected with lenti-miR21-NC or lenti-miR21-up into HEK-293 cells. Two days after transfection, dual luciferase activity was measured. Mean ± SEM. *p < 0.05 versus lenti-NC. All of the assays were performed in triplicate. HSCs, hepatic stellate cells.

AngII upregulated the expression of HSCs were treated with AngII at different concentrations for 24 h or treated with AngII at different times at a concentration of 10−7 M. Mir-21 levels were detected by q-RT-PCR. Small nucleolar RNA U6 was used as an internal reference. Mean ± SEM. *p < 0.05 versus control; #p < 0.05 versus the AngII 12 h; &p < 0.05 versus AngII 10−5 M or AngII 10−9 M. (C, D) HSCs were transfected with Smad2 or Smad3 siRNA before stimulation with AngII (10−7 M) as indicated for 24 h. The mir-21 levels were detected by RT-qPCR. Mean ± SEM. *p < 0.05 versus control; #p < 0.05 versus NC; &p < 0.05 versus si-Smad2 or NC+AngII. (E, F) Cells were pretreated with VAS2870 (50 μM), NAC (10−3 M), mito-TEMPO (100 U/ml), catalase (10 mM), BAY (10−5 M), and U0126 (10−5 M) for 1 h before stimulation with AngII (10−7 M), as indicated, for 24 h. Mir-21 levels were detected by RT-qPCR. Mean ± SEM. *p < 0.05 versus control; #p < 0.05 versus AngII. (G, I) Conserved miR-21-binding sites in the 3′UTRs of Smad7 and Spry1 mRNA. Predicted consequential pairing of the target regions and miR-21 (framed) were based on TargetScan (www.targetscan.org/) (H, J) Luciferase reporters containing wild-type or mutant 3′UTRs of mouse Smad7 or Spry1 gene were cotransfected with lenti-miR21-NC or lenti-miR21-up into HEK-293 cells. Two days after transfection, dual luciferase activity was measured. Mean ± SEM. *p < 0.05 versus lenti-NC. All of the assays were performed in triplicate. HSCs, hepatic stellate cells.

Overexpression of mir-21 promoted oxidation, mitochondrial dysfunction, and resultant HSC activation

Overexpression of mir-21 increased H2O2 content, whereas downregulation of mir-21 decreased H2O2 content (Fig. 6A, B). SB431542, Smad3 inhibitor, inhibited the increase in H2O2 content induced by overexpression of mir-21, suggesting that Smad3 is required for ROS generation induced by mir-21 overexpression (Fig. 6C). Meanwhile, overexpression of mir-21 increased intracellular superoxide content, whereas downregulation of mir-21 decreased intracellular superoxide content (Fig. 6D, E). We further assessed the effect of mir-21 on mitochondrial function. The mito-ROS was mildly increased by overexpression of mir-21 but decreased by inhibition of mir-21 expression. However, ATP levels changed in the opposite direction (Fig. 6F–I). α-SMA and COL1A protein levels were increased by lenti-mir-21-up (Fig. 6J–N). VAS2870, NAC, and mito-TEMPO inhibited the increase in COL1A and α-SMA protein levels induced by lenti-mir-21-up (Fig. 6L–N). Hence, overexpression of mir-21 promotes oxidation, mitochondrial dysfunction, and resultant HSC activation.

Overexpression of HSCs were transfected with lenti-mir-21-up or lenti-mir-21-down. (A, B) The H2O2 concentration in HSCs was measured. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-mir-21-NC. (C) HSCs were treated with SB431542 (50 μM) and transfected with lenti-mir-21-NC or lenti-mir-21-up and H2O2 concentration in HSCs was measured. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-mir-21-NC; #p < 0.05 versus lenti-mir-21-up or SB431542+lenti-mir-21-NC. (D, E) The intracellular superoxide in HSCs was measured. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-mir-21-NC. (F, G) ATP levels were measured in HSCs. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-mir-21-NC. (H, I) HSCs transfected with lenti-NC were treated with PEG-SOD, mitochondria-derived reactive oxygen species were measured by flow cytometry. (J, K) Representative confocal immunofluorescence images of COL1A or α-SMA. (L–N) HSCs were treated with VAS2870 (50 μM), NAC (10−3 M), mito-TEMPO (100 U/ml), and transfected with lenti-mir-21-NC or lenti-mir-21-up. Western blotting was used to detect COL1A and α-SMA protein levels. The data are presented as mean ± SEM. *p < 0.05 versus lenti-mir-21-NC; †p < 0.05 versus control; #p < 0.05 versus lenti-mir-21-up. All of the assays were performed in triplicate. PEG-SOD, polyethylene glycol-adsorbed–superoxide dismutase. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars.

Overexpression of HSCs were transfected with lenti-mir-21-up or lenti-mir-21-down. (A, B) The H2O2 concentration in HSCs was measured. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-mir-21-NC. (C) HSCs were treated with SB431542 (50 μM) and transfected with lenti-mir-21-NC or lenti-mir-21-up and H2O2 concentration in HSCs was measured. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-mir-21-NC; #p < 0.05 versus lenti-mir-21-up or SB431542+lenti-mir-21-NC. (D, E) The intracellular superoxide in HSCs was measured. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-mir-21-NC. (F, G) ATP levels were measured in HSCs. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-mir-21-NC. (H, I) HSCs transfected with lenti-NC were treated with PEG-SOD, mitochondria-derived reactive oxygen species were measured by flow cytometry. (J, K) Representative confocal immunofluorescence images of COL1A or α-SMA. (L–N) HSCs were treated with VAS2870 (50 μM), NAC (10−3 M), mito-TEMPO (100 U/ml), and transfected with lenti-mir-21-NC or lenti-mir-21-up. Western blotting was used to detect COL1A and α-SMA protein levels. The data are presented as mean ± SEM. *p < 0.05 versus lenti-mir-21-NC; †p < 0.05 versus control; #p < 0.05 versus lenti-mir-21-up. All of the assays were performed in triplicate. PEG-SOD, polyethylene glycol-adsorbed–superoxide dismutase. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars.

Ang-(1–7) suppressed mir-21 expression and oxidation induced by AngII

Ang-(1–7) markedly decreased the expression of mir-21 and reduced mir-21 overexpression induced by AngII (Supplementary Fig. S2A–C). However, A779 reversed the effect of Ang-(1–7) (Supplementary Fig. S2C). Interestingly, AngII alone increased H2O2 content (Supplementary Fig. S2D). However, Ang-(1–7) and VAS2870 attenuated the increase in H2O2 content induced by AngII (Supplementary Fig. S2D). Meanwhile, A779 reversed the effect of Ang-(1–7) (Supplementary Fig. S2D).

Overexpression of mir-21 activated NLRP3 inflammasome via the Spry1-ERK-NF-κB pathway in HSCs

The protein levels of p-ERK, NLRP3 inflammasome complex (NLRP3, procaspase 1, and ASC), Pro-IL-1β, and IL-1β (P17) were increased by lenti-mir-21-up (Fig. 7A, B). However, overexpression of the Spry1 plasmid reversed the effect of lenti-mir-21-up (Fig. 7A, B). Both U0126 and BAY inhibited NF-κB translocation and the protein levels of Pro-IL-1β, P17, NLRP3 inflammasome complex, and caspase 1(P10) induced by lenti-mir-21-up (Fig. 7C–F). These data demonstrate that mir-21 activated the NLRP3 inflammasome/IL-1β axis via the Spry1-ERK-NF-κB pathway.

Overexpression of the Spry1-ERK-NF-B pathway in HSCs. HSCs were transfected with Spry1 overexpression plasmid and lenti-mir-21-NC or lenti-mir-21-up. (A, B) p-ERK, Pro-IL-1β, P17, NLRP3, ASC, procaspase1, and P10 protein levels were analyzed by Western blotting. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-NC+NC-Spry1; †p < 0.05 versus lenti-mir-21-up+NC-Spry1. (C, D) HSCs were treated with U0126 (10−5M) and transfected with lenti-mir-21-NC or lenti-mir-21-up. p-ERK, NF-κB, Pro-IL-1β, P17, NLRP3, ASC, procaspase1, and P10 protein levels were analyzed by Western blot. (E, F) HSCs were treated with BAY (10−5 M) and transfected with lenti-mir-21-NC or lenti-mir-21-up. NF-κB, Pro-IL-1β, P17, NLRP3, ASC, procaspase1, and P10 protein levels were analyzed by Western blot. The data are presented as mean ± SEM. *p < 0.05 versus lenti-mir-21-NC; †p < 0.05 versus control; ‡p < 0.05 versus lenti-mir-21-up. All of the assays were performed in triplicate.

Overexpression of the Spry1-ERK-NF-B pathway in HSCs. HSCs were transfected with Spry1 overexpression plasmid and lenti-mir-21-NC or lenti-mir-21-up. (A, B) p-ERK, Pro-IL-1β, P17, NLRP3, ASC, procaspase1, and P10 protein levels were analyzed by Western blotting. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-NC+NC-Spry1; †p < 0.05 versus lenti-mir-21-up+NC-Spry1. (C, D) HSCs were treated with U0126 (10−5M) and transfected with lenti-mir-21-NC or lenti-mir-21-up. p-ERK, NF-κB, Pro-IL-1β, P17, NLRP3, ASC, procaspase1, and P10 protein levels were analyzed by Western blot. (E, F) HSCs were treated with BAY (10−5 M) and transfected with lenti-mir-21-NC or lenti-mir-21-up. NF-κB, Pro-IL-1β, P17, NLRP3, ASC, procaspase1, and P10 protein levels were analyzed by Western blot. The data are presented as mean ± SEM. *p < 0.05 versus lenti-mir-21-NC; †p < 0.05 versus control; ‡p < 0.05 versus lenti-mir-21-up. All of the assays were performed in triplicate.

Overexpression of mir-21 promoted NLRP3 inflammasome complex assembly in the mitochondria

Immunofluorescence colocalization analysis was used to examine the localization of ASC, NLRP3, or caspase-1 in the mitochondria. The data demonstrated that mir-21 overexpression promoted NLRP3 inflammasome to assemble in mitochondria. Furthermore, mir-21 overexpression promoted NOX4 to colocalize with NLRP3, indicating that NOX4 reacted with NLRP3 in the mitochondria (Fig. 8A–D).

Overexpression of Cells were transfected with lenti-mir-21-NC or lenti-mir-21-up and then were used to perform immunofluorescence staining. Nuclei were stained with DAPI; mitochondria were stained with mito-tracker (blue). (A) Representative confocal immunofluorescence images of NLRP3 (red) colocalized with ASC (green) and mitochondria (blue). (B) Representative confocal immunofluorescence images of caspase-1 (green) colocalized with ASC (red) and mitochondria (blue). (C) Representative confocal immunofluorescence images of NLRP3 (red) colocalized with caspase-1 (green) and mitochondria (blue). (D) Representative confocal immunofluorescence images of NLRP3 (red) colocalized with NOX4 (green) and mitochondria (blue). Original magnification: × 1200. All of the staining was performed in triplicate. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

Overexpression of Cells were transfected with lenti-mir-21-NC or lenti-mir-21-up and then were used to perform immunofluorescence staining. Nuclei were stained with DAPI; mitochondria were stained with mito-tracker (blue). (A) Representative confocal immunofluorescence images of NLRP3 (red) colocalized with ASC (green) and mitochondria (blue). (B) Representative confocal immunofluorescence images of caspase-1 (green) colocalized with ASC (red) and mitochondria (blue). (C) Representative confocal immunofluorescence images of NLRP3 (red) colocalized with caspase-1 (green) and mitochondria (blue). (D) Representative confocal immunofluorescence images of NLRP3 (red) colocalized with NOX4 (green) and mitochondria (blue). Original magnification: × 1200. All of the staining was performed in triplicate. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

Overexpression of mir-21 promoted NLRP3 inflammasome activation and resultant collagen production via the Smad7/Smad2/3/NOX4 pathway in HSCs

P-smad2/3, NOX4, NLRP3 inflammasome complex, P17, COL1A, and α-SMA protein levels were increased by lenti-mir-21-up (Fig. 9A). However, overexpression of Smad7 plasmid reversed the effect of lenti-mir-21-up (Fig. 9A). Moreover, SB431542 reduced the increase in NOX4, NLRP3 inflammasome complex, P17, COL1A, and α-SMA protein levels induced by lenti-mir-21-up (Fig. 9B). On the contrary, lenti-mir-21-up resulted in increased protein level of NOX4, other than NOX2. VAS2870, NAC, and mito-TEMPO attenuated the increase in NLRP3 inflammasome complex and P17 protein levels induced by lenti-mir-21-up (Fig. 9C–E). Collectively, these data suggest that mir-21 activated the NLRP3 inflammasome/IL-1β axis by the Smad7/Smad2/3/NOX4 pathway in HSCs. Furthermore, NLRP3 siRNA significantly reduced the mir-21 overexpression-induced COL1A and α-SMA production, suggesting that NLRP3 mediates HSC activation and collagen synthesis (Fig. 9F).

Overexpression of the Smad7/Smad2/3/NOX4 pathway in HSCs. (A) HSCs were transfected with Smad7 overexpression plasmid and lenti-mir-21-NC or lenti-mir-21-up. p-Smad2/3, NOX4, NLRP3, ASC, procaspase1, P10, P17, α-SMA, and COL1A protein levels were analyzed by Western blot. The data are presented as mean ± SEM. *p < 0.05 versus lenti-NC+NC-Smad7; †p < 0.05 versus lenti-mir-21-up+NC-Smad7. (B) HSCs were treated with SB431542 (50 μM) and transfected with lenti-mir-21-NC and lenti-mir-21-up. p-Smad3, NOX4, NLRP3, ASC, procaspase1, P10, P17, α-SMA, and COL1A protein levels were analyzed by Western blot. (C–E) HSCs were treated with VAS2870 (50 μM), NAC (10−3 M), and mito-TEMPO (100 U/ml) and transfected with lenti-mir-21-NC or lenti-mir-21-up. NOX4, NOX2, NLRP3, ASC, procaspase1, P10, and P17 protein levels were analyzed by Western blot. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-mir-21-NC; †p < 0.05 versus control; ‡p < 0.05 versus lenti-mir-21-up. (F) HSCs were cotransfected with NLRP3 siRNA, lenti-mir-21-NC, or lenti-mir-21-up. NLRP3, α-SMA, and COL1A protein levels were analyzed by Western blot. The data are presented as mean ± SEM. *p < 0.05 versus si Scr; †p < 0.05 versus control; ‡p < 0.05 versus si Scr+lenti-mir-21-up. All of the assays were performed in triplicate.

Overexpression of the Smad7/Smad2/3/NOX4 pathway in HSCs. (A) HSCs were transfected with Smad7 overexpression plasmid and lenti-mir-21-NC or lenti-mir-21-up. p-Smad2/3, NOX4, NLRP3, ASC, procaspase1, P10, P17, α-SMA, and COL1A protein levels were analyzed by Western blot. The data are presented as mean ± SEM. *p < 0.05 versus lenti-NC+NC-Smad7; †p < 0.05 versus lenti-mir-21-up+NC-Smad7. (B) HSCs were treated with SB431542 (50 μM) and transfected with lenti-mir-21-NC and lenti-mir-21-up. p-Smad3, NOX4, NLRP3, ASC, procaspase1, P10, P17, α-SMA, and COL1A protein levels were analyzed by Western blot. (C–E) HSCs were treated with VAS2870 (50 μM), NAC (10−3 M), and mito-TEMPO (100 U/ml) and transfected with lenti-mir-21-NC or lenti-mir-21-up. NOX4, NOX2, NLRP3, ASC, procaspase1, P10, and P17 protein levels were analyzed by Western blot. The data are presented as the mean ± SEM. *p < 0.05 versus lenti-mir-21-NC; †p < 0.05 versus control; ‡p < 0.05 versus lenti-mir-21-up. (F) HSCs were cotransfected with NLRP3 siRNA, lenti-mir-21-NC, or lenti-mir-21-up. NLRP3, α-SMA, and COL1A protein levels were analyzed by Western blot. The data are presented as mean ± SEM. *p < 0.05 versus si Scr; †p < 0.05 versus control; ‡p < 0.05 versus si Scr+lenti-mir-21-up. All of the assays were performed in triplicate.

Mir-21 mediated the effect of AngII on NLRP3 inflammasome activation via the Spry1/ERK/NF-κB and Smad7/Smad2/3/NOX4 pathways in HSCs

First, we investigated the effects of mir-21 on the AngII-induced Spry1/ERK/NF-κB pathway. AngII treatment enhanced p-ERK protein expression and NF-κB nucleoprotein levels but decreased Spry1 protein levels. Overexpression of mir-21 showed synergistic effects on AngII treatment. In contrast, inhibition of mir-21 expression reversed the effects of AngII (Fig. 10A, B).

the Spry1/ERK/NF-B and Smad7/Smad2/3/NOX4 pathways in HSCs. HSCs were transfected with lenti-mir-21-up or lenti-mir-21-down and treated with Ang II for 1 h (p-Smad2, p-Smad3, nucleoprotein NF-κB, Smad2/3, and Smad4) or for 24 h. (A, B) Spry1, p-ERK, and NF-κB protein levels were analyzed by Western blot. (C, D) TLR4 and MyD88 protein levels were analyzed by Western blot. (E, F) Smad7, p-Smad2, p-Smad3, nucleoprotein Smad2/3, Smad4, NOX4, and NOX2 protein levels were analyzed by Western blot. (G, H) NLRP3 inflammasome, α-SMA, and COL1A protein levels were analyzed by Western blot. The data are presented as mean ± SEM. *p < 0.05 versus lenti-NC; †p < 0.05 versus lenti-mir-21-up or lenti-mir-21-down. (I) HSCs were treated with rh-IL-1β (10 ng/ml) and AngII (10−7 M). NLRP3 inflammasome, α-SMA, and COL1A protein levels were analyzed by Western blot. The data are presented as the mean ± SEM. *p < 0.05 versus control; ‡p < 0.05 versus AngII. All of the assays were performed in triplicate. TLR4, toll-like receptor 4.

the Spry1/ERK/NF-B and Smad7/Smad2/3/NOX4 pathways in HSCs. HSCs were transfected with lenti-mir-21-up or lenti-mir-21-down and treated with Ang II for 1 h (p-Smad2, p-Smad3, nucleoprotein NF-κB, Smad2/3, and Smad4) or for 24 h. (A, B) Spry1, p-ERK, and NF-κB protein levels were analyzed by Western blot. (C, D) TLR4 and MyD88 protein levels were analyzed by Western blot. (E, F) Smad7, p-Smad2, p-Smad3, nucleoprotein Smad2/3, Smad4, NOX4, and NOX2 protein levels were analyzed by Western blot. (G, H) NLRP3 inflammasome, α-SMA, and COL1A protein levels were analyzed by Western blot. The data are presented as mean ± SEM. *p < 0.05 versus lenti-NC; †p < 0.05 versus lenti-mir-21-up or lenti-mir-21-down. (I) HSCs were treated with rh-IL-1β (10 ng/ml) and AngII (10−7 M). NLRP3 inflammasome, α-SMA, and COL1A protein levels were analyzed by Western blot. The data are presented as the mean ± SEM. *p < 0.05 versus control; ‡p < 0.05 versus AngII. All of the assays were performed in triplicate. TLR4, toll-like receptor 4. As mentioned before, LPS primes signal 1 of the NLRP3 inflammasome; we investigated the effects of mir-21 on AngII-induced TLR4/MyD88/NF-κB pathway. The results showed that AngII increased TLR4 and MyD88 protein levels and promoted NF-κB nuclear translocation. Overexpression or downregulation of mir-21 had no effect on AngII-induced increase in TLR4 and MyD88 protein levels but promoted or suppressed NF-κB translocation (Fig. 10C, D and Supplementary Fig. S3A). These data indicate that mir-21 mediates AngII-induced activation of Spry1/ERK/NF-κB pathway rather than TLR4/MyD88/NF-κB pathway. Next, we also found that AngII increased p-Smad2/3, NOX4, and NOX2 protein levels and promoted the Smad4 and Smad2/3 nuclear translocation but decreased Smad7 protein levels. Overexpression of mir-21 showed synergistic effects with the action of AngII on the molecules above, other than NOX2. In contrast, except NOX2, inhibition of mir-21 expression reversed the effects of AngII on the molecules mentioned above (Fig. 10E, F and Supplementary Fig. S3B). These data indicate that mir-21 mediates the AngII-induced activation of Smad7/Smad2/3/NOX4 pathway. Furthermore, we found that AngII treatment increased NLRP3 inflammasome, COL1A, and α-SMA protein levels. Overexpression of mir-21 showed synergistic effects with AngII treatment. In contrast, inhibition of mir-21 expression reversed the effects of AngII (Fig. 10G, H and Supplementary Fig. S4). These data indicate that mir-21 mediates AngII-induced NLRP3 inflammasome. Recombinant human IL-1β treatment showed synergistic effects with the AngII-induced increase in NLRP3 inflammasome, COL1A, and α-SMA protein levels, suggesting that IL-1β increased collagen synthesis via NLRP3 inflammasome activation (Fig. 10I). Taken together, these data demonstrate that mir-21 mediates the effect of AngII on NLRP3 inflammasome activation via the Spry1/ERK/NF-κB and Smad7/Smad2/3/NOX4 pathways in HSCs (Fig. 11).

A schematic view of major signal transduction pathways involved in the effects of axis activating the Spry1/ERK/NF-B and Smad7/Smad2/3/Smad4/NOX4 pathways. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

A schematic view of major signal transduction pathways involved in the effects of axis activating the Spry1/ERK/NF-B and Smad7/Smad2/3/Smad4/NOX4 pathways. To see this illustration in color, the reader is referred to the web version of this article at www.liebertpub.com/ars

Discussion

In this article, we demonstrated for the first time that mir-21 mediates AngII-induced activation of NLRP3 inflammasome and thereby collagen synthesis in HSCs via targeting Spry1 and Smad7. Ang-(1–7) protected against BDL- and AngII-induced liver fibrosis and inhibited expression of mir-21. The principal findings obtained include the following: (1) mir-21 is positively correlated with liver fibrosis and oxidation; (2) both ERK/NF-κB and Smad3/NOX/ROS pathways mediate AngII-induced overexpression of mir-21; (3) mir-21 activates the ERK/NF-κB and Smad2/3/NOX4/ROS pathways in HSCs via targeting Spry1, Smad7 for degradation, respectively; (4) AngII activated NLRP3 inflammasome/IL-1β axis and thus promoted HSC activation via the mir-21/Spry1/ERK/NF-κB and mir-21/Smad7/Smad2/3/NOX4 pathway, respectively; and (5) Ang-(1–7) protected against BDL- or AngII-induced liver fibrosis and inhibited mir-21 expression. A recent study has shown that the mir-21 level is upregulated in fibrotic liver biopsies of HCV patients (24) and mir-21 overexpression mediates the activation of HSCs (12, 48). Consistent with these reports, our in vitro data showed that overexpression of mir-21 promoted oxidation, mitochondrial dysfunction, and HSC activation. However, downregulation of mir-21 exerted the opposite effects. In vivo data showed a markedly increased mir-21 level in blood and liver tissues of patients with liver cirrhosis or rats with BDL- or AngII-induced hepatic fibrosis. Meanwhile, lenti-mir-21-down attenuated liver fibrosis and the oxidation induced by AngII. It is noteworthy that there is a positive correlation of human circulating mir-21 levels with liver FibroScan value, suggesting that circulating mir-21 could potentially serve as a biomarker in patients with liver fibrosis. Hence, mir-21 is a promising biomarker and a therapeutic target for liver fibrosis. Some studies have reported that AngII regulated cardiac fibrosis via mir-21 induction. The work by Siddesha et al. (32) found that AngII promotes cardiac fibroblast migration and thereby cardiac fibrosis by suppressing RECK expression, a critical molecular for cardiac fibroblast migration, via ERK-dependent AP-1- and STAT3-mediated mir-21 induction. Moreover, AngII suppressed the proapoptotic PTEN and Spry1, but induced the MMP2. Also, the work by Adam et al. (2), Maegdefessel et al. (23), and Lorenzen et al. (21) provided similar insights. However, a recent report showed that AngII upregulated the expression of mir-224 but not mir-21 in adult rat cardiac fibroblasts (27). Considering these findings in cardiac fibrosis, we investigated whether AngII could promote liver fibrosis by regulating mir-21 and the detail mechanism. We found that AngII treatment induced an increase in mir-21 in HSCs and liver tissue. Meanwhile, AngII treatment elevated mir-21 expression in HSCs in a time dependency but not dose dependency. AngII 10−7 M had the best effect to promote mir-21 expression. The increase in mir-21 induced by AngII in HSCs could be reduced by si-Smad3 (not by si-Smad2) and antioxidants VAS2870, NAC, catalase, and mito-TEMPO. Moreover, blockade of ERK and NF-κB prevented AngII-induced mir-21 expression. This result is consistent with Ling's report that activation of ERK/NF-κB promoted mir-21 expression (19). Hence, Smad3/NOX/ROS and ERK/NF-κB pathways mediate AngII-induced mir-21 expression in HSCs. Furthermore, it remains to be determined how mir-21 simultaneously regulates multiple signaling pathways in hepatic fibrogenesis. In the present study, we focused on two target genes of mir-21, namely Spry1 and Smad7. Previous studies have shown that mir-21 contributes to fibrosis along with degradation of Spry1 to stimulate ERK signaling in cardiac fibroblasts (38) and HSCs (49). In the present study, mir-21 overexpression promoted Spry1 degradation, enhanced p-ERK levels, and induced NF-κB nuclear translocation in HSCs. In addition, in vivo data also demonstrated a markedly increased p-ERK and nucleoprotein NF-κB but decreased Spry1 protein expression in hepatic tissues of patients with liver cirrhosis and rats with hepatic fibrosis induced by BDL or AngII. Hence, by targeting Spry1 for degradation, AngII-induced mir-21 mediated the ERK/NF-κB pathway in HSCs. We then focused on the Smad2/3/NOX4/ROS pathway. Being a “constitutively active” enzyme, NOX4 contributes to generation of H2O2. NOX4-derived ROS are a critical factor in HSC activation and hepatic fibrogenesis (30). TGF-β induces the Smad2/3 complex with Smad4 and translocates to the nucleus, leading to NOX4 gene transcription and NOX4-derived ROS generation (35). Our recent report (4) further showed that Smad3 gene depletion inhibits NOX4 protein levels and that NOX4 gene depletion reduces Smad3 protein levels, suggesting the feedback loop between NOX4 and Smad3. Hence, we deduced the mechanism of mir-21 inducing HSC activation: via targeting Smad7 for degradation, mir-21 promotes the Smad2/3/NOX4/ROS pathway. Our findings confirm the suggestion. We found that AngII-induced mir-21 overexpression degraded Smad7 and subsequently promoted Smad2/3 phosphorylation and the recruitment of Smad2/3 with Smad4 in the nucleus, thus leading to increase of NOX4 protein level and H2O2 generation, which could be blocked by Smad3 inhibitor SB43152. Noteworthy, NOX2 is also an important isoform of NOX family. NOX2 was implicated in the pathology of AngII (5, 13, 18, 26) and liver fibrogenesis (14, 29). In consistence with these, here we found that AngII increased both NOX2 and NOX4 protein levels in HSCs, and NOX inhibitor VAS2870, which shows the highest affinity for NOX2 (3), inhibited AngII-induced mir-21 overexpression and resultant inhibition of H2O2 generation. Hence, NOX2 actually involves in the process above. However, mir-21 overexpression resulted in increased protein expression level of NOX4, other than NOX2. Overexpression of mir-21 enhanced NOX4 protein expression induced by AngII. Inhibition of mir-21 expression reduced NOX4 protein expression level induced by AngII. In contrast, mir-21 could not regulate NOX2 protein level induced by AngII, indicating that not NOX2 but NOX4 mediates oxidative stress initiated by mir-21 overexpression. The reason may be associated with the feedback loop between NOX4 and Smad3 (4). Whether NOX2 can be regulated by Smad2/3 remains unclear, which deserves further investigation. Moreover, mir-21 overexpression induced mitochondrial dysfunction and promoted mito-ROS generation in HSCs. In contrast, downregulation of mir-21 exerted the opposite effects. Interestingly, mir-21 promoted NOX4 translocation into the mitochondria, indicating cross talk between the mitochondria and NOX4 in HSCs. In agreement with the results in vitro, in vivo data indicated a markedly high level of mir-21, along with increased Smad2/3, NOX4 protein levels, and H2O2 production in the fibrotic liver tissues of humans or rats treated with BDL or AngII infusion. Meanwhile, lenti-mir-21-down attenuated the effects induced by AngII infusion. Therefore, by targeting Smad7 for degradation, AngII-induced mir-21 promoted generation of ROS (including NOX-derived ROS and mito-ROS) in the HSCs via the Smad2/3-NOX pathway. Interestingly, ERK promoted mir-21 expression, and mir-21 caused feedback activation of ERK by targeting Spry1, whereas the Smad3/NOX/ROS pathway mediated AngII-induced mir-21 expression and mir-21 caused feedback activation of Smad3/NOX/ROS by targeting Smad7. We demonstrated that mir-21 maintains itself at constant high levels and drives forces for hepatic fibrosis using two feedback loops: mir-21/Spry1/ERK loop and mir-21/Smad7/Smad3/NOX/ROS loop. Targeting these aberrantly activated feedback loops may provide new therapeutic strategies against hepatic fibrosis. The NLRP3 inflammasome is a novel mediator for liver fibrosis (36). We found that injection of lenti-mir-21-down attenuated AngII-induced activation of the NLRP3 inflammasome/IL-1β axis in the rat liver. Nevertheless, how mir-21 regulates NLRP3 inflammasome activation has not been reported until now. This study is the first that connects two target genes of mir-21 with two signals of the NLRP3 inflammasome. Cell priming with an NF-κB activator, such as TLR4-ligand LPS, is the signal 1 of NLRP3 inflammasome activation. The TLR/MyD88/NF-κB pathway mediates NLRP3 and pro-IL-1β gene transcription, whereas signal 2, triggered by a broad variety of DAMP molecules such as ROS, induces the assembly of NLRP3 inflammasome complex, resulting in activation of caspase-1 and subsequent pro-IL-1β maturation (36). In this study, AngII-induced mir-21 promoted ERK phosphorylation and nuclear translocation of NF-κB via inhibition of the target gene Spry1 but did not affect TLR4 and Myd88. U0126 or BAY, inhibitor of ERK or NF-κB, inhibited activation of NLRP3 inflammasome complex induced by mir-21 overexpression. Hence, our study is the first to demonstrate that the signal 1 of NLRP3 inflammasome was activated by AngII via the mir-21/Spry1/ERK/NF-κB pathway. The mir-21/Spry1/ERK/NF-κB pathway is a new manner of regulation of NLRP3 inflammasome. As for signal 2, we demonstrate, for the first time, that ROS generation regulated by the mir-21/Smad7/Smad3/NOX4 pathway mediates AngII-induced activation of NLRP3 inflammasome. We found that overexpression of mir-21 increased protein levels and the assembly of the NLRP3 inflammasome complex, as well as a marked increase in Smad2/3 phosphorylation, H2O2 content, and colocalization of NLRP3 and NOX4 in the mitochondria. Smad3 inhibitor SB43152, VAS2870, and NAC reduced the increase in NLRP3 inflammasome complex protein levels induced by mir-21 overexpression. Overexpression of mir-21 had synergistic effects with AngII-induced increase in NLRP3 inflammasome. In contrast, inhibition of mir-21 expression reversed the effects of AngII. These data indicate that the mir-21/Smad7/Smad2/3/NOX4 pathway mediates AngII-induced NLRP3 inflammasome activation. Moreover, mito-TEMPO also inhibited NLRP3 inflammasome complex protein levels induced by mir-21 overexpression. Hence, besides NOX4-derived ROS, mito-ROS mediated mir-21-induced NLRP3 inflammasome activation. Then, we come to the final result of NLRP3 inflammasome activation. In our study, overexpression of mir-21 induced a marked increase in P17 (an active part of IL-1β), COL1A, and α-SMA. NLRP3 depletion inhibited expression of P17, COL1A, and α-SMA induced by mir-21. Moreover, recombinant rat IL-1β exerted a synergistic effect with mir-21 on COL1A and α-SMA production. Injection with lenti-mir-21-down attenuated liver fibrosis and AngII-induced activation of NLRP3 inflammasome/IL-1β axis in the rat liver. Because mir-21 triggers two signals of NLRP3 inflammasome/IL-1β axis, downregulating mir-21 is an effective strategy for inhibition of hepatic fibrosis. Taken together, we demonstrate that AngII activates NLRP3 inflammasome/IL-1β axis and thus promotes HSC activation via the mir-21/Spry1/ERK/NF-κB, mir-21/Smad7/Smad2/3/NOX4 pathway. Finally, we come to the effects of Ang-(1–7) on mir-21. Ang(1–7) has been shown to attenuate liver fibrosis in BDL rats (31). Recently, we reported that Ang-(1–7) inhibits HSC activation by inhibiting NLRP3 inflammasome activation in HSCs (4). Acuna et al. showed that Ang-(1–7) reduced expression of mir-21 in skeletal muscle fibroblasts (1). However, the precise mechanisms underlying Ang(1–7) attenuating liver fibrosis by inhibiting mir-21 remain unclear. In the present study, Ang-(1–7) inhibited either mir-21 expression or AngII-induced mir-21 expression in vitro. In vivo, exogenous Ang-(1–7) infusion significantly decreased mir-21 expression, NLRP3 inflammasome activation, and attenuated liver fibrosis induced by BDL or AngII infusion. Hence, we first reported that Ang-(1–7) decreases mir-21 expression in vitro and in vivo, suggesting the potential mechanism of Ang-(1–7) treatment against liver fibrosis. A more detailed mechanism deserves further investigation. So far, there are some clinical data to support the use of the RAS inhibitor, such as angiotensin II type 1 receptor blocker or angiotensin converting enzyme inhibitor in human liver fibrosis (7, 33, 37, 44, 45). These studies have administered the drug alone, or in combination with others. These clinical studies potently support the clinical impact of the here reported mechanism for the clinical situation. In conclusion, we identified AngII-induced mir-21 as a crucial factor that initiates HSC activation by upregulating NLRP3 inflammasome/IL-1β axis via the Spry1/ERK/NF-κB and Smad7/Smad2/3/NOX4 pathways. Ang-(1–7) protected against BDL- and AngII-induced liver fibrosis and inhibited expression of mir-21. Consequently, the present study revealed a specific mechanism underlying AngII-induced mir-21 activating HSCs, suggesting that downregulation of mir-21 is a promising strategy for treatment of hepatic fibrosis.

Materials and Methods

Reagents

Ang-(1–7), AngII, A779(Mas blocker), SB431542 (Smad3 blocker), VAS2870 (NADPH-oxidase blocker), N-acetyl-l-cysteine (NAC, a superoxide inhibitor), mito-TEMPO, polyethylene glycol-adsorbed–superoxide dismutase (PEG-SOD), and catalase were provided by Sigma-Aldrich (Sigma-Aldrich, St. Louis, MO). rh-IL-1β was obtained through ProSpec Protein Specialists (Rehovot, Israel). ALZET osmotic pumps (models 2004 and 2ML4) were provided by the DURECT Corporation (Cupertino, CA). All of the siRNA was synthesized by GenePharma (Shanghai, China). All of the primers were provided by Invitrogen (Shanghai, China). Lenti NC, mir-21 virus, Smad7, and Spry1 plasmids were obtained through GeneChem (Shanghai, China).

Human blood and liver specimens

Control liver tissues were obtained from 12 patients undergoing partial liver resection for hepatic hemangioma. Normal blood samples were obtained from 12 normal persons. Fibrotic liver biopsy specimens and abnormal blood samples were obtained from 12 patients with liver fibrosis (8 patients suffered from HBV infection, 4 patients suffered from bile duct stones) who underwent a liver hardness scan (FibroScan value >7.3 kPa) by FibroScan (ECHOSENS Company, France). Each person had signed the informed written consent, and the Ethics Committee at the Nanfang hospital had approved the use of the samples.

Animal model

Male Wistar rats (200–300 g) were obtained from the Laboratory Animal Center (Southern Medical University, China). The Committee on the Ethics of Animal Experiments of Southern Medical University had approved all experimental procedures on rats (Permission No. SCXK 2009-015). The rats were housed under an environment (12-h light/12-h dark; 22–24°C) and received water ad libitum. In the first animal model, the model of hepatic fibrosis was established by BDL. Mini-Osmotic pumps containing saline or Ang-(1–7) (25 μg·kg−1·h−1) were implanted into the abdominal cavity of rats. There were three groups (9 rats/group): the sham group, the BDL+saline group, and the BDL+Ang-(1–7) group. In the second animal model, liver fibrosis was induced by continuous infusion of AngII (25 μg·kg−1·h−1) with mini-Osmotic pumps, and control rats received an infusion of saline. Mir-21 downexpression lentivirus was injected into the tail vein. Animals were divided into the sham group, the AngII group, the AngII+lenti-mir-21-NC group, and the AngII+lenti-mir-21-down group, each group containing nine rats. In the third model of liver fibrosis group, there were four groups, each containing nine rats: the control group, the AngII group, the Ang-(1–7) group, and the AngII+Ang-(1–7) group. All rats were sacrificed 4 weeks later.

Cell culture

Rat HSCs were isolated and cultured in Dulbecco's modified Eagle's medium (GIBCO BRL, Life Technologies, Inc.). HEK-293 cells were obtained from the cell bank of the Chinese Academy of Sciences in Shanghai. Experiments were performed on cells at passages 3–5.

Histological analysis

For IHC analysis, the sections were incubated with antibody against α1-type 1 collagen (COL1A), α-SMA, VWF, NOX4, NLRP3, caspase-1, IL-1β (1:100; Abcam, Cambridge, MA), Smad7, Spry1 (1:50; Santa Cruz Biotechnology).

In situ hybridization

In brief, the livers sections were treated with acetylation solution and proteinase K. Then, the sections were blocked with hybridization solution and incubated with digoxigenin-conjugated mir-21 probes (Exiqon, Denmark). Then, the sections were incubated with the HRP-conjugated anti-digoxigenin antibody (Roche, Shanghai, China). Finally, the sections were treated with NBT/BCIP (Roche, Shanghai, China). Light blue cytoplasmic staining means positive.

RNA isolation and q-RT-PCR

Total RNA was extracted by using TRIzol. Blood total RNA was isolated from 200 μl of blood using the miRNeasy Mini Kit (TransGene Biotech, Beijing, China). One thousand nanograms of tissue or cell RNA was reverse transcribed and performed q-PCR using the All-in-One mir-21 q-RT-PCR kit (GeneCopoeia, Guangzhou, China). Blood RNA (2.5 μl) was reverse transcribed and performed q-PCR using the miRNeasy Mini Kit. Real-time PCR was performed using the ABI 7500 Real-Time PCR System (Applied Biosystems). Mir-21 primer: UAGCUUAUCAGACUGAUGUUGA, the universal primer was provided by All-in-One miR-21 q-RT-PCR kit or miRNeasy Mini Kit. Mir-21 expression was normalized using the 2−ΔΔCt method from the Ct values of the respective miRNAs relative to the housekeeping gene U6 snRNA.

Western blotting

The proteins level was detected by Western blotting. The primary antibodies were α-SMA, NOX4, NOX2, NLRP3, caspase1, ASC, IL-1β (1:1000; Abcam, Cambridge, MA), p-Smad2, p-Smad3, Smad2/3 (1:1000; Cell Signaling Technology, MA), COL1A, Smad7, Spry1 (1:100; Santa Cruz Biotechnology). β-Actin acted as an internal control.

Transfection studies

Mir-21 NC and overexpression or downexpression of lentivirus were transfected according to the manufacturer's instructions. The siRNA sequences: Smad3 (sense: 5′-CCGCAUGAGCUUCGUCAAATT-3′, antisense: 5′-UUUGACGAAGCUCAUGCGGTT-3′); Smad2 (sense: 5′-AATAATATAAGCGCACTCCTCCCTGTCTC-3′, antisense: 5′-AAGAGGAGTGCGCTTATATTACCTGTCTC-3′); and NLRP3 (sense: 5′-GCUUCAGCCACAUGACUUU-3′, antisense: 5′-AAAGUCAUGUGGCUGAAGC-3′).

Luciferase reporter assay

Cells were cotransfected with 0.5 μg wild-type or mutant-type 3′-UTR luciferase reporters containing the firefly luciferase gene and Renilla luciferase gene and lenti-mir-21-NC or lenti-mir-21-up into HEK-293T cells. Renilla luciferase reporters were also included as an internal control.

Hepatic hydroxyproline determination

The hydroxyproline detection kit (Jiancheng Institute of Biotechnology, Nanjing, China) was used to measure the hepatic hydroxyproline content.

Hydrogen peroxide assay

The H2O2 product was detected using the Hydrogen Peroxide Assay Kit (Beyotime, Shanghai, China). The technical principle of the used Hydrogen Peroxide Assay Kit is that a ferrous iron can be oxidized to ferric iron by H2O2 and then react with xylenol orange in a specific solution to synthesizing purse products. So, the concentration of the H2O2 can be detected by microplate reader. The cells were cracked in lysis buffer, and then, hydrogen peroxide detection of liquid was added, followed by supernatant and standard substance. Finally, the OD value was detected at 562 nm wavelength absorption spectroscopy.

Intracellular superoxide and mitochondrial ROS measurement

The fluorescent probe dihydroethidium (Beyotime, Shanghai, China) was used. Mito-ROS was detected by measuring mitochondrial superoxide with the fluorogenic probe MitoSOX red reagent (M36008; Invitrogen Life Technologies). PEG-SOD was used to determine the specificity of MitoSOX red oxidation for measurements of superoxide.

Intracellular ATP level assay

The intracellular ATP levels were measured according to instructions (Beyotime, Shanghai, China).

Statistical analysis

All experiments were repeated at least three times. Data are expressed as the mean ± SD. Data were analyzed by ANOVA with LSD for multiple comparisons. For association studies, Pearson analysis was used for parametric and Spearman was used for nonparametric data. r > 0 was considered a positive correlation. Differences were considered significant at a p < 0.05. The data were analyzed using SPSS 13.0.
  50 in total

1.  Therapeutic targeting of mitochondrial superoxide in hypertension.

Authors:  Anna E Dikalova; Alfiya T Bikineyeva; Klaudia Budzyn; Rafal R Nazarewicz; Louise McCann; William Lewis; David G Harrison; Sergey I Dikalov
Journal:  Circ Res       Date:  2010-05-06       Impact factor: 17.367

2.  CXCR6 plays a critical role in angiotensin II-induced renal injury and fibrosis.

Authors:  Yunfeng Xia; Xiaogao Jin; Jingyin Yan; Mark L Entman; Yanlin Wang
Journal:  Arterioscler Thromb Vasc Biol       Date:  2014-05-22       Impact factor: 8.311

3.  Correlation between microRNA expression levels and clinical parameters associated with chronic hepatitis C viral infection in humans.

Authors:  Rebecca T Marquez; Sarmistha Bandyopadhyay; Erik B Wendlandt; Kathy Keck; Brandon A Hoffer; Michael S Icardi; Randolph N Christensen; Warren N Schmidt; Anton P McCaffrey
Journal:  Lab Invest       Date:  2010-07-12       Impact factor: 5.662

4.  Angiotensin II plays a critical role in diabetic pulmonary fibrosis most likely via activation of NADPH oxidase-mediated nitrosative damage.

Authors:  Junling Yang; Yi Tan; Fenglian Zhao; Zhongsen Ma; Yuehui Wang; Shirong Zheng; Paul N Epstein; Jerry Yu; Xia Yin; Yang Zheng; Xiaokun Li; Lining Miao; Lu Cai
Journal:  Am J Physiol Endocrinol Metab       Date:  2011-04-12       Impact factor: 4.310

5.  A role for mitochondria in NLRP3 inflammasome activation.

Authors:  Rongbin Zhou; Amir S Yazdi; Philippe Menu; Jürg Tschopp
Journal:  Nature       Date:  2010-12-01       Impact factor: 49.962

Review 6.  Inflammasomes in liver diseases.

Authors:  Gyongyi Szabo; Timea Csak
Journal:  J Hepatol       Date:  2012-05-23       Impact factor: 25.083

7.  Role of miR-21 in the pathogenesis of atrial fibrosis.

Authors:  Oliver Adam; Björn Löhfelm; Thomas Thum; Shashi K Gupta; Sarah-Lena Puhl; Hans-Joachim Schäfers; Michael Böhm; Ulrich Laufs
Journal:  Basic Res Cardiol       Date:  2012-07-04       Impact factor: 17.165

8.  MicroRNA-21 blocks abdominal aortic aneurysm development and nicotine-augmented expansion.

Authors:  Lars Maegdefessel; Junya Azuma; Ryuji Toh; Alicia Deng; Denis R Merk; Azad Raiesdana; Nicholas J Leeper; Uwe Raaz; Anke M Schoelmerich; Michael V McConnell; Ronald L Dalman; Joshua M Spin; Philip S Tsao
Journal:  Sci Transl Med       Date:  2012-02-22       Impact factor: 17.956

9.  The autoregulatory feedback loop of microRNA-21/programmed cell death protein 4/activation protein-1 (MiR-21/PDCD4/AP-1) as a driving force for hepatic fibrosis development.

Authors:  Zhengping Zhang; Yinhe Zha; Wei Hu; Zhen Huang; Zhongfei Gao; Yuhui Zang; Jiangning Chen; Lei Dong; Junfeng Zhang
Journal:  J Biol Chem       Date:  2013-11-06       Impact factor: 5.157

10.  Osteopontin is indispensible for AP1-mediated angiotensin II-related miR-21 transcription during cardiac fibrosis.

Authors:  Johan M Lorenzen; Celina Schauerte; Anika Hübner; Malte Kölling; Filippo Martino; Kristian Scherf; Sandor Batkai; Karina Zimmer; Ariana Foinquinos; Tamas Kaucsar; Jan Fiedler; Regalla Kumarswamy; Claudia Bang; Dorothee Hartmann; Shashi K Gupta; Jan Kielstein; Andreas Jungmann; Hugo A Katus; Frank Weidemann; Oliver J Müller; Hermann Haller; Thomas Thum
Journal:  Eur Heart J       Date:  2015-04-21       Impact factor: 29.983

View more
  31 in total

1.  Targeting the renin-angiotensin-aldosterone system in fibrosis.

Authors:  Mohammad AlQudah; Taben M Hale; Michael P Czubryt
Journal:  Matrix Biol       Date:  2020-05-16       Impact factor: 11.583

Review 2.  siRNA- and miRNA-based therapeutics for liver fibrosis.

Authors:  Zhen Zhao; Chien-Yu Lin; Kun Cheng
Journal:  Transl Res       Date:  2019-08-13       Impact factor: 7.012

3.  The NLRP3 Activation in Infiltrating Macrophages Contributes to Corneal Fibrosis by Inducing TGF-β1 Expression in the Corneal Epithelium.

Authors:  Jing Xu; Peng Chen; Xiaoyu Luan; Xinying Yuan; Susu Wei; Yaxin Li; Chuanlong Guo; Xianggen Wu; Guohu Di
Journal:  Invest Ophthalmol Vis Sci       Date:  2022-07-08       Impact factor: 4.925

4.  Balancing Effect of Biejiajian Oral Liquid () on ACE-Ang II-AT1R Axis and ACE2-Ang-(1-7)-Mas Axis in Rats with CCl4-Induced Hepatic Fibrosis.

Authors:  Xiao-Ya Li; Yan Peng; Xia-Wei Bu; Jia Yao; Li Yao
Journal:  Chin J Integr Med       Date:  2018-01-15       Impact factor: 1.978

5.  LncRNA Neat1 expedites the progression of liver fibrosis in mice through targeting miR-148a-3p and miR-22-3p to upregulate Cyth3.

Authors:  Wei Huang; Feizhou Huang; Rui Zhang; Hongwu Luo
Journal:  Cell Cycle       Date:  2021-02-08       Impact factor: 4.534

6.  Mir-21 Mediates the Inhibitory Effect of Ang (1-7) on AngII-induced NLRP3 Inflammasome Activation by Targeting Spry1 in lung fibroblasts.

Authors:  Na-Na Sun; Chang-Hui Yu; Miao-Xia Pan; Yue Zhang; Bo-Jun Zheng; Qian-Jie Yang; Ze-Mao Zheng; Ying Meng
Journal:  Sci Rep       Date:  2017-10-30       Impact factor: 4.379

7.  Activation of the STAT3/microRNA-21 pathway participates in angiotensin II-induced angiogenesis.

Authors:  Li-Yuan Chen; Xue Wang; Xiao-Long Qu; Li-Na Pan; Ze-Yang Wang; Yong-Hui Lu; Hou-Yuan Hu
Journal:  J Cell Physiol       Date:  2019-04-04       Impact factor: 6.384

8.  NLRP3 inflammasome priming and activation in cholestatic liver injury via the sphingosine 1-phosphate/S1P receptor 2/Gα(12/13)/MAPK signaling pathway.

Authors:  Lei Hou; Zhi Zhang; Le Yang; Na Chang; Xinhao Zhao; Xuan Zhou; Lin Yang; Liying Li
Journal:  J Mol Med (Berl)       Date:  2021-01-02       Impact factor: 4.599

Review 9.  Inflammasomes and Fibrosis.

Authors:  Wen-Juan Zhang; Shu-Juan Chen; Shun-Chang Zhou; Su-Zhen Wu; Hui Wang
Journal:  Front Immunol       Date:  2021-06-11       Impact factor: 7.561

10.  METTL3/N6-methyladenosine/ miR-21-5p promotes obstructive renal fibrosis by regulating inflammation through SPRY1/ERK/NF-κB pathway activation.

Authors:  Erpeng Liu; Lei Lv; Yonghao Zhan; Yuan Ma; Jinjin Feng; Yulin He; Yibo Wen; Yanping Zhang; Qingsong Pu; Fengping Ji; Xinghuan Yang; Jian Guo Wen
Journal:  J Cell Mol Med       Date:  2021-06-24       Impact factor: 5.310

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.