Literature DB >> 27499235

A new animal model containing human SCARB2 and lacking stat-1 is highly susceptible to EV71.

An-Ting Liou1,2,3, Szu-Yao Wu2,4, Chun-Che Liao2, Ya-Shu Chang2, Chih-Shin Chang2,4, Chiaho Shih1,2.   

Abstract

Enterovirus 71 (EV71) is a major threat to children worldwide. Children infected with EV71 could develop subclinical infection and hand-foot-and -mouth disease (HFMD). In severe cases, patients could develop encephalitis, paralysis, pulmonary edema, and death. A more user-friendly and robust animal model is essential to investigating EV71 pathogenesis. Here, we established a hybrid (hSCARB2(+/+)/stat-1(-/-)) mouse strain from crossbreeding SCARB2 transgenic and stat-1 KO mice, and compared the susceptibilities to EV71 infection and pathogenesis between parental and hybrid mice. Virus-encoded VP1 protein can be detected in the streaking nerve fibers in brain and spinal cord. This hybrid mouse strain at 2-week-old age can still be infected with different genotypes of EV71 at 1000-fold lower titer via an ip route. Infected hybrid mice developed earlier onset of CNS disease, paralysis, and death at a higher incidence. These advantages of this novel model meet the urgent need from the scientific community in basic and preclinical research in therapeutics and pathogenesis.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27499235      PMCID: PMC4976353          DOI: 10.1038/srep31151

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Enterovirus 71 (EV71) was first identified in California in 19691. It is a member of the Picornaviridae family, and is related to poliovirus2, hepatitis A virus (EV72)3, and EV-D68, a recent outbreak in United States in 20144. EV71 causes cold-like symptoms, hand-foot-and-mouth disease (HFMD), encephalitis, acute flaccid paralysis, and death in children156. In addition, patients recovered from EV71 infection could have long-term neurological and cognition disorders7. EV71 has become a critical epidemic problem in recent years in Taiwan and Asia-Pacific area89. A user-friendly small animal model is an urgent need for EV71 research. Previously, successful in vivo EV71 infection and pathogenesis can be achieved by intraperitoneal (i.p.) inoculation of adaptive viral strains into 1–3 day old ICR mice1011. This model provided an in vivo platform for EV71 research. However, serially passaged adaptive strains of the RNA virus quasispecies are known to have undergone extensive variations and evolution, leading to diverse viral populations from the parental strain1012. In addition, 1–3 day old newborns are very fragile to handle experimentally. Recently, many cellular receptors have been proposed for EV71 viral entry in vitro, including hSCARB2 (human Scavenger receptor class B), PSGL1 (P-selectin glycoprotein ligand 1), annexin II, and nucleolin13141516. It is important to demonstrate that these proposed receptors can indeed facilitate viral entry of EV71 in vivo. So far, human SCARB2 transgenic mouse is the only model shown to provide a functional role of hSCARB2 in the EV71 in vivo infection. In one of the hSCARB2 transgenic mouse models, EV71 infection was successful at the age of 3-week-old, particularly when using a so-called Isehara strain of EV71 via an intracranial (i.c.) or intravenous (i.v.) route. Other viral strains were not as virulent and robust as the Isehara strain in this model. Because disease manifestations were assessed by combining ataxia, paralysis, and death into one single score17, it is difficult to compare the combined score to the conventional individual scores for paralysis and survival, without the inclusion of ataxia. In another hSCARB2 transgenic model18, no significant difference in the incidence of limb paralysis was observed between the hSCARB2 transgenic and non-transgenic control mice, when infected subcutaneously with EV71 genotypes B4 and C4. An approximately 2-fold difference in the paralysis rates was noted between transgenic and non-transgenic mice, when infected with genotypes C2 and B5. Another feature of this model is that only 1-day-old mice can be infected productively with EV71 genotype B. Newborns older than 1-day appeared to be rather resistant to EV71 infection and pathogenesis. Currently, there is no data available to side-by-side cross compare the phenotypes and susceptibility of various hSCARB2 Tg mouse models to EV71 infection. Therefore, careful choice of particular EV71 strains and particular mouse models could be critical for productive infection and pathogenesis. Immunodeficient mouse models without bearing a hSCARB2 transgene, such as AG129, G129, NOD/SCID, and stat-1 KO (stat-1−/−) mice, can also support efficient in vivo infection with EV71192021. This result raises an issue whether hSCARB2 is the only receptor for EV71, and whether hSCARB2 plays a significant role in in vivo infection. The stat-1 KO model is known to be deficient in interferon (IFN) signaling22. Similarly, G129 is deficient in IFN-gamma receptor, and AG129 is deficient in both IFN-alpha and IFN-gamma receptors23. The NOD/SCID model is deficient in both B and T cell maturation24. Overall, both adaptive and innate immunity are important against EV71 infection. Interestingly, different arms of the immune system predisposed the host infected with the same clinical isolate to different disease manifestations and tissue tropism20. Despite the fact that immune deficient mouse models can support in vivo infection with EV71, they generally require very high virus titer for efficient and productive infection (108 pfu per mouse). In addition, newborn mice younger than 1-week after birth are required for susceptibility to experimental infection with clinical isolates of EV71. In contrast, the young age requirement for productive infection and pathogenesis was less stringent, or not observed, when mice were inoculated with mouse-adapted strains of EV711021. In this study, we established an hSCARB2 transgenic mouse lineage and generated a hybrid mouse strain by crossbreeding the hSCARB2 transgenic mice with the stat-1 KO mice (hSCARB2 Tg/stat-1 KO). We found that this hybrid strain can be infected at 500-fold to 1000-fold lower titer of EV71 than the parental stat-1 KO mice or the hSCARB2 transgenic mice. In addition, this hybrid strain can be infected in a robust manner at the age of 2-week old after birth. Infected hybrid mice exhibited streaking of nerve fibers positive for viral protein VP1 in both brain and spinal cord. Neuropathology and microglial amplification are evident by Nissl’s staining and immunohistochemistry (IHC) for IBA1, an inflammation marker of microglial cells. These hybrid mice also tend to develop an earlier onset of limb paralysis and death. Taken together, both hSCARB2 receptor and innate immunity are important determinants for EV71 infection and pathogenesis. A striking synergistic effect from hSCARB2 and the deficiency in innate immunity enables in vivo infection with different genotypes of EV71 at a 2-3 log lower dose of viral inoculation.

Results

Generation of a new animal model highly susceptible to EV71 infection

We generated human SCARB2 transgenic mice using a hSCARB2 cDNA expression vector under the native promoter of hSCARB2 (Fig. 1a). The construction of this expression vector is as detailed in Materials and Methods. We screened the presence of the transgene hSCARB2 by using PCR primers specific for hSCARB2 (Fig. 1a). Generation of the homozygous hSCARB2 transgenic mouse is also detailed in Materials and Methods. We crossed the homozygous hSCARB2 transgenic mouse with stat-1 KO mouse (stat-1−/−)20, and obtained heterozygote F1 with a genotype SCARB2+/−/stat-1+/− (Fig. 1b). Self-crossing of this heterozygote hSCARB2+/−/stat-1+/− mice generated the hybrid strain hSCARB2+/+/stat-1−/−. We first selected stat-1−/− mice from the putative hybrid strains by using PCR primers specific for the mutant allele of stat-1 (Fig. 1c). These identified stat-1−/− mice were then mated with wild type C57BL/6. If all the progeny littermates were hSCARB2 positive, it would indicate that the hybrid mouse was the desired hybrid strain hSCARB2+/+/stat-1−/−. The expression of hSCARB2 protein can be detected in brain and spinal cord in homozygous hSCARB2+/+ mice and the hybrid strain hSCARB2+/+/stat-1−/− by immunoblot analysis (upper panel, Fig. 1d). The weak signal in stat-1−/− mice is from the endogenous mouse SCARB2 protein, which can cross-react with the anti-SCARB2 antibody.In contrast, we detected no apparent difference in SCARB2 protein expression in spleen and muscle (lower panel, Fig. 1d), which could be due to the low level expression of the exogenous hSCARB2 driven by the native promoter of hSCARB2 in spleen and muscle.
Figure 1

Generation of a hybrid mouse model SCARB2/stat-1 KO by crossbreeding hSCARB2 transgenic mice and stat-1 KO mice.

(a) Human SCARB2 (hSCARB2) cDNA was cloned under its own native promoter in an SV40 expression vector. (b) The generation of homozygous hSCARB2+/+ transgenic mice was as detailed in M&M. The heterozygote strain of hSCARB2+/−/stat-1+/− mice were generated by crossing the stat-1−/− and the hSCARB2+/+ parental mice. The hybrid strain hSCARB2+/+/stat-1−/− was generated by crossing the heterozygote mice hSCARB2+/−/stat-1+/− to each other. (c) Genotyping of parental and hybrid mouse strains was performed by PCR assay using genomic DNAs extracted from mouse tail. The transgene of hSCARB2 was screened by detection of a 369 bp PCR product using primers specific for hSCARB2. For the stat-1+/− heterozygote mice, 320 bp and 150 bp PCR products were used as markers for screening. The former indicates a mutant stat-1 allele, while the latter indicates a wild type stat-1 allele. (d) The expressions of hSCARB2 protein were compared among parental and hybrid mouse strains in brain, spinal cord, spleen and muscle by immunoblot via an anti-SCARB2 antibody. The weaker signals of the SCARB2 protein detected in stat-1 KO mice reflect cross reactivity between human and mouse SCARB2 proteins to the anti-SCARB2 antibody.

To compare the susceptibilities among this hybrid strain and its parental strains, we inoculated one-week-old mice at high (108 pfu/mouse) or low doses (106 pfu/mouse) of EV71-(C2) (genotype C2) via ip route and monitored disease manifestation daily until 21 dpi. At both high and low doses of EV71, we observed significant differences in clinical scores (Fig. 2a) and paralysis rates (Fig. 2b), between the hybrid strain and its two parental strains. Similarly, significant difference in the survival rates was observed at either high or low doses of EV71 between the two parental and hybrid strains (Fig. 2c). The hybrid strain showed 100% death rate at 108 pfu/mouse before 9 dpi, while the two parental strains showed less than 20% mortality on 21 dpi. At the lower dose of 106 pfu/mouse, the difference in the death rate was apparent on 7 dpi (Table 1). At the lower dose of 105 pfu/mouse, we detected in the hybrid strain approximately 57% of paralysis rate on 7 dpi, and all paralyzed mice died on 11 dpi. We detected no paralysis and death at 104 pfu/mouse until 30 dpi. In addition to genotype C2, this hybrid strain can also be infected with genotype B5, albeit B5 required 10-fold higher inoculation titer than C2 for pathogenesis (Table 1). As summarized in Table 1, our results demonstrated that the hybrid strain hSCARB2+/+/stat-1−/− is more susceptible to EV71 infection and pathogenesis than its two parental strains at either high or low doses of viral inoculation.
Figure 2

The hybrid mouse strain hSCARB2+/+/stat-1−/− is most susceptible to infection and pathogenesis.

One-week-old newborns of parental stat-1−/−, parental hSCARB2+/+ transgenic, and hybrid hSCARB2+/+/stat-1−/− mice were i.p. infected with EV71 (genotype C2) at high titer (108 pfu/mouse) and low titer (106 pfu/mouse). Clinical scores, paralysis rates, and survival rates were compared among three different mouse strains. Disease manifestation and death were monitored daily post-injection. Clinical scores were defined as follows: 0, healthy; 1, hair loss, wasting, or ruffled hair; 2, limb weakness; 3, paralysis in only 1 limb; 4, paralysis in 2 to 4 limbs; 5, death. The hybrid strain exhibited the highest clinical score (a) paralysis rate (b) and the lowest survival rate (c). Numbers of infected mice were as summarized in Table 1.

Table 1

Summary of disease manifestations in three different animal models.

Host AgeEV71 GenotypeMouse StrainsLimb paralysis to death/total number of infected mice
108 pfu/mouse107 pfu/mouse@106 pfu/mouse
1-wkC2SCARB2 Tg3/17 (*11/17)2/93/11
Hybrid5/59/98/11
stat-1 KO3/27 (*7/27)1/172/9
wt C57BL/60/80/15ND#
B5SCARB2 Tg0/3NDND
Hybrid10/122/6ND
stat-1 KO4/41/7ND
2-wkC2SCARB2 TgND0/11ND
HybridND20/2412/15
stat-1 KOND0/4ND
B5SCARB2 Tg1/4NDND
Hybrid7/78/84/9
stat-1 KO1/4NDND
3-wkC2HybridND0/20ND

@Approximately 57% of hybrid mice can be infected with EV71-(C2) at 105 pfu/mouse, but no mouse can be infected at 104 pfu/mouse.

*Hindlimb weakness/total infected mice. Some mice with limb weakness did not die, and some recovered from paralysis.

#ND: not done.

Hybrid mice can be infected with clinical isolates of EV71 at an older age

Next, we compared 1-week, 2-week, and 3-week old mice of the hybrid strain for their pathogenesis upon EV71 infection at 107 pfu/mouse. Disease manifestation was monitored daily up to 21 dpi. The result demonstrated that only 1- and 2-week old mice showed disease manifestation and death. The 3-week-old group displayed no detectable clinical score and exhibited 100% survival rate (Fig. 3a,b, Table 1). In the previous stat-1−/− mouse model, only 1-week-old or younger neonates can be successfully infected with a clinical isolate of EV71 (genotype B5)20. Here, we demonstrated that 2-week-old hybrid mice can be infected with either genotype C2 or B5 in a highly robust manner.
Figure 3

Young age is critical for the clinical score and survival rate in the hybrid mouse model infected with EV71.

Clinical score (a) and survival rate (b) were compared in hybrid mice i.p. infected with EV71 (107 pfu/mouse) at one-, two-, and three-week-old ages. Three-week-old hybrid mice showed no clinical symptoms and death. Numbers of infected mice were as summarized in Table 1.

Streaking VP1 positive nerve fibers and inflammation in the CNS of infected hybrid mice

Previously, we observed virus-specific VP1 protein in brain and spinal cord of stat-1−/− mice infected with EV7120. We compared here the histopathologies of brain and spinal cord among the parental and hybrid strains by H&E staining and immunohistochemistry (IHC) using anti-VP1 antibody. All strains of mice showed VP1 positive signals in brain and spinal cord (Fig. 4a), but not in muscle (Fig. S1). While there is no apparent difference in the H&E staining in sections of brain and spinal cord among these three different mouse strains, we detected higher density and stronger intensity of VP1 positive signals in neurons of the hybrid mice by IHC. These VP1 positive signals can be easily identified in retrosplenial granular cortex of the mid-brain in both hSCARB2+/+ and the hybrid hSCARB2+/+/stat-1−/− mice. Interestingly, we observed an array of VP1-positive nerve fibers streaking in parallel to each other in mid-brain sections (upper panels, Fig. 4b). In addition, VP1-positive signals were detected in neuronal bodies from sections of brain stem (lower left panel, Fig. 4b). Similarly, VP1-positive neuronal bodies and streaking nerve fibers can be seen in sections of grey matter of the thoracic and lumbar vertebrate of spinal cord (arrowheads in Fig. 4c). Since lumbar spinal cord is known to be responsible for hindlimb movement, this result in Fig. 4c could explain the hindlimb paralysis observed in EV71 infected hybrid mice. By Nissl staining, we noted that neuronal cells in the spinal cord from EV71-infected hybrid mice lost the characteristic cytoplasmic blue dots (Nissl Bodies). In addition, these neuronal cells contained significant numbers of vacuoles as well as abundant numbers of small cells (Fig. 4d). Amplification of microglial cells is a known phenomenon of CNS inflammation and IBA1 is a known marker for microglial cells25. By immunohistochemistry (IHC) staining, IBA1 and Ki67 (a proliferation marker) proteins can be visualized in spinal cord sections from EV71 infected hybrid mice (Fig. 4e). We also detected increasing amount of IBA1 protein by Western blot analysis, when the clinical scores are increasing in EV71-infected hybrid mice (Fig. 4f). Taken together, our results suggest that both hSCARB2 receptor and stat-1 mediated innate immunity are important for CNS infection and pathogenesis of EV71.
Figure 4

Histopathological examination of CNS sections in three different mouse models.

(a) One-week-old of parental stat-1−/−, parental hSCARB2+/+ transgenic, and hybrid hSCARB2+/+/stat-1−/− mice were in vivo infected with 108 pfu/mouse of EV71 (genotype C2) by i.p. route, respectively. Moribund mice were sacrificed. Paraffin-embedded sections of brain and spinal cord were examined with H&E stain at x100 and x200 magnifications, respectively (left panel). IHC staining detected the strongest expression of viral VP1 protein in brain and spinal cord in the hybrid mice (right panel). Black arrowheads in IHC of the transgenic hSCARB2+/+ mice indicate the VP1 positive signals. (b) Upper panel: Parallel streakings of VP1-positive nerve fibers and neuron cells in the mid-brain were detected by IHC staining in 2-week-old hybrid mice infected with EV71. Lower panel: A section from brain stem displayed VP1 positive signals. (c) Left panel: VP1 signal can be detected in lumbar section. Right panel: Streaking of nerve fibers was also detected in spinal cord sections (x400). Black arrowheads highlight the streaking nerve fibers. (d) Spinal cord sections were examined by Nissl Staining at 400x and 800x magnifications. Upper panel: EV71-infected hybrid strain mouse. Black arrowheads highlight abnormal neurons with extensive vaccuoles. Lower panel: PBS injected control mouse. (e) A microglial marker IBA1 was detected in spinal cord of infected hybrid strain mouse by immunohistochemistry (magnification at 400x in left panel). A cell proliferation marker Ki67 was strongly increased in infected spinal cord of hybrid strain mouse (magnification at 400x in right panel). (f) The expression of IBA1 protein in spinal cord appeared to correlate with the disease severity by immunoblot analysis. Each lane represents one spinal cord sample from each infected mouse with different clinical scores.

Viral proteins and inflammatory cytokines were increased in CNS pathogenesis

In our previous studies, we found elevations of a number of cytokines in EV71-infected mouse models20. Here, we focused on IL-6 and IFN-beta, since these two are important inflammatory cytokines expressed in EV71 infected patients2627. To follow the time course of virus-host interactions post-inoculation, we compared the levels of EV71-specific RNA and protein, as well as IL-6 and IFN-beta before, during, and after disease onset (Fig. 5). VP1 specific RNA increased steadily from before-onset to after-onset in both brain and spinal cord by real-time RT-PCR analysis (Fig. 5a). VP1 protein followed a similar trend (Fig. 5b). We detected no EV71-specific RNA and protein (Fig. 5b) in spleen and muscle. We also monitored the profiles of inflammatory cytokines in brain and spinal cord. Unlike the expression patterns in spleen and muscle (Fig. S2), the patterns of IFN-beta (Fig. 5c) and IL-6 (Fig. 5d) in brain and spinal cord resembled those of VP1 RNA (Fig. 5a).
Figure 5

Expression profiles of EV71 specific RNA, protein and cellular cytokines in CNS of infected hybrid strain mice before, during, and after onset of limb paralysis.

Two-week-old hybrid strain mice were infected with EV71 (genotype C2) at 107 pfu/mouse by i.p. route. Brain, spinal cord, spleen and muscle were collected on dpi 4 (before-onset), dpi 7 (onset), and dpi 9 (after-onset). Extractions of viral RNA and protein were as described in Materials and Methods. (a) VP1 specific RNA in brain and spinal cord was both significantly increased at disease onset by RT-qPCR analysis. The results were normalized by GAPDH. (b) Viral proteins in brain (3D protein) and spinal cord (VP1 protein) peaked after disease-onset by immunoblot analysis. In contrast, no viral protein VP1 in spleen and muscle was ever detected throughout the entire time course. Lysates of EV71-infected RD cells were included as a positive control. (c) Expression of IFNB (IFN-beta) mRNA in brain and spinal cord was significantly increased at disease onset by RT-qPCR analysis. (d) Expression of IL-6 mRNA in spinal cord, but not in brain, was also increased at disease onset (Student’s t test). The results in (c,d) were normalized by GAPDH.

Discussion

We generated here a novel mouse model containing both hSCARB2 transgene and stat-1 KO. This new mouse model exhibited neuropathology in both brain and spinal cord, and thus recapitulated disease manifestations in EV71 natural infection in humans8. This model is more user-friendly than previous models in several ways, including the susceptibility to in vivo infection with EV71 of both genotypes C2 and B5 at a lower virus titer and an older age of mice. In our hSCARB2 transgenic model and the stat-1 KO model, mouse age younger than 1-week old is necessary for successful EV71 infection and pathogenesis. We experienced no successful infection and pathogenesis in 2-week old mice in either hSCARB2 transgenic model or the stat-1 KO model. While we were able to infect the 2-week-old hybrid strain at 100% efficiency (107pfu/mouse), we had no success in 20 inoculated hybrid mice at 3-week-old age (Table 1). We found no significant difference in hSCARB2 protein expression in brain and spinal cord by Western blot between 2-week-old and 3-week-old hybrid mice (Fig. S3). We also found no difference in the response of IFN-alpha, beta, and gamma in the brain and spinal cord between 2-week-old and 3-week-old hybrid mice inoculated with EV71 (Fig. S3). This age-dependent phenomenon of EV71 infection and pathogenesis is reminiscent of the age-dependent paralysis in a poliovirus receptor transgenic mouse model2829. It remains to be investigated what kind of host factors could contribute to the age dependency, such as the neonatal development of the CNS or immune systems. In the survival rate studies in Fig. 2c, the low dose inoculation (106 pfu/mouse) of the two parental strains of mice appeared to have a higher tendency to develop death than the high dose (108 pfu/mouse) group. In addition, both low dose and high dose inoculations developed onset of death at almost the same time in both hybrid mice and hSCARB2 transgenic mice. At present, we have no clear explanation for this phenomenon. We observed no pathology in many tissues other than the CNS in the hybrid mice by H&E staining (Fig. S1). Nor could we detect any VP1 protein expression in muscle and spleen by IHC (Fig. S1). The lack of muscle tropism of EV71 in all three mouse strains could be related to the lower expression of hSCARB2 or the higher protective immunity in muscle. The most striking observation in the brain sections of EV71 infected hybrid mice is the streaking nerve fibers positive for the EV71 specific VP1 protein (Fig. 4). In addition, by H&E and Nissl stainings of spinal cord, we observed three major differences between the hybrid mice infected with EV71 and PBS. Upon infection with EV71, hybrid mice exhibited 1) extensive vacuole formation in neuronal cells; 2) microglial cell amplification; and 3) loss of Nissl bodies (rough ER) and reduced intensity in blue color (Fig. 4). Previous postmortem studies on fatal cases of EV71 infected children revealed severe involvement of brain stem and spinal cord, including inflammatory infiltrate of microglial cells83031. Consistent with the neuropathology in brain and spinal cord, we detected significant increase in the mRNA levels of pro-inflammatory cytokine IL-6 and type 1 IFN at disease onset (Fig. 5c,d). In our previous studies, deficiency in IFN signaling in G129 mice and stat-1 KO mice facilitated EV71 infection and pathogenesis20. In summary, we established a new mouse model for EV71 in vivo infection and pathogenesis. This new model provides a user-friendly platform, which could facilitate the development of antiviral research in clinical medicine.

Methods

Ethics statement

All animal experiments were conducted under protocols approved by Academia Sinica Institutional Animal Care & Utilization Committee (ASIACUC Protocol number 13-12-622). Research was conducted in compliance with the principles stated in the Guide for the Care and Use of Laboratory Animals, National Research Council, 1996.

Cell and virus preparation

Genotypes C2 (GenBank accession number: DQ060149) and B5 of EV71 were kindly provided by Dr. Mei-Shang Ho, IBMS, Academia Sinica, Taiwan15, and Changhua Christian Hospital, Changhua, Taiwan20, respectively. Both C2 and B5 of EV71 were clinical isolates from EV71 patients. Human rhabdomyosarcoma (RD) cells (ATCC CCL-136) were cultured in Dulbecco’s modified Eagle medium (DMEM; Gibco) with 10% fetal bovine serum (FBS; Hyclone) and 1% penicillin-streptomycin (Gibco) at 37 °C. For virus preparation, RD cells were cultured in T175 flask with 0.2% FBS and infected with EV71 at multiplicity of infection (MOI) of 0.01 at 37 °C for 24 hours. Virus was harvested by three cycles of freeze-and -thaw and centrifuged at 3000 × g at 4 °C for 30 minutes. Supernatant was concentrated by ultracentrifugation in Beckman SW28 rotors at 26000 rpm at 4 °C for 4–6 hours with 30% sucrose cushion and was resuspended in phosphate-buffered saline (PBS). EV71 titer was determined by plaque assy.

Virus Titration

RD cell monolayer was cultured at a density around 5 × 105 cells/well in 6-well plates (SPL life science). EV71 stock was 10-fold serially diluted with DMEM and RD cells were infected with virus at various dilutions. After 1 hour incubation, virus was removed from RD cells and covered with 4 mL DMEM containing 0.3% soft agar (Lonza) and 0.2% FBS at 37 °C for 72 hours. After 72 hours, RD cells were fixed by 3.7% formalin (Merck) for 1 hour at room temperature and the number of plaques was scored after crystal violet staining.

Generation of hSCARB2 transgenic mouse

Human SCARB2 (hSCARB2) cDNA was amplified by PCR with primers NotI-SCARB2-F (GAGAGCGGCCGCCGGCCCGTGAGCGGCGCACA) and AscI-SCARB2-R (GAGAGGCGCGCCCCAAGCAAAGGCAATGTTTA) from a human SCARB2 cDNA clone (OriGene). The cDNA fragment was purified and cloned into a Pol’II-IVS expression vector (a kind gift from Dr. Ting-Fen Tsai, National Yang-Ming University, Taiwan) at NotI and AscI restriction sites. Human SCARB2 promoter (pSC2) sequences were amplified from the BAC clone RP-11-67-M24 (Invitrogen) by PCR with specific primers SacII-pSC2-F (GAGACCGCGGTTAGAGTCTGTGAAGAAAGCTCT) and EcoRI-pSC2-R (GAGAGAATTCCTCGCCGCAACCCCGCGAGG). The fragment of promoter sequences was purified and cloned into pol’II-IVS-hSCARB2 vector by SacII and EcoRI digestion. For the generation of transgenic mice, the pSC2-hSCARB2 expression vector was digested by SacII and PvuI, followed by purification and pronuclear injection in Transgenic Core Facility, Academia Sinica, Taiwan. Homozygous hSCARB2 transgenic mice were established by first mating the F0 putative transgenic mice with wild type C57BL/6. The heterozygote F1 mice were crossed with each other to generate F2 mice. The F2 hSCARB2 transgenic mice were further crossed to wild type C57BL/6 mice to generate F3 mice. If F3 mice are 100% positive for the hSCARB2 transgene, then this F2 hSCARB2 transgenic line would be considered as a homozygous hSCARB2 transgenic lineage.

Experimental infection

All mice were housed under specific-pathogen-free conditions in individual ventilated cages. One-to-three-week-old mice were infected with EV71 at the dose of 106-108 pfu/mouse via intraperitoneal route. Disease manifestations were monitored daily post-infection.

Genotyping

Mouse DNA was extracted from mouse tail by using tissue DNA extraction kit (Thermo). Extracted DNA was used for PCR genotyping (My taq; Bioline). For SCARB2 Tg mice, specific PCR primers were: AGAGGGGAGACCCCTCGGGTG (forward) and AAAATA GGGAGAGATATCGGGCC (reverse). PCR product was 369 bp if the mouse carried human SCARB2 gene. For stat-1−/− mice, three specific PCR primers were used. P1:GAGATAATTCACAAAATCAGAGAG, P2:CTGATCCAGGCAGGCGTTC, and P3:TAATGTTTCATAGTTGGATATCAT. For stat-1−/− mice, PCR product should be 320 bp, while heterozygotes should be 320 and 150 bp.

Histopathological and immunohistochemical (IHC) stain

The euthanized mice were perfused transcardially with PBS, followed by 10% neutral buffered formalin (CHIN I PAO CO., LTD, Taiwan). Tissue blocks were fixed in 10% neutral buffered formalin overnight. Fixed tissues were paraffin embedded, sliced, and stained with H&E by the Pathology Core Laboratory, IBMS, Academia Sinica. Xylene and ethanol were used for deparaffinization and rehydration. Retrieval buffer pH 6.0 (Dako) and endogenous enzyme blocker (Dako) were used for antigen retrieval and blocking steps. The slides were washed with PBS containing 0.1% Tween 20 (PBST) and incubated with rabbit anti-VP1 polyclonal antibody (PB7631, Abnova, Taiwan), rabbit anti-IBA1 polyclonal antibody (GTX 101495, Genetex, Taiwan), rabbit anti-Ki67 monoclonal antibody (GTX16667, Genetex, Taiwan), respectively. These slides were washed with PBST and incubated in secondary anti-rabbit antibody. DAB system (Dako) was used to visualize signals of antigens. Sections were counterstained with haematoxylin (J.T. Baker), and mounted with mounting reagent (MUTO Pure Chemicals). Images were scanned and presented via Pannoramic 250 FLASH (3DHISTECH Ltd).

Real time reverse transcription–PCR

Infected mouse organs were harvested on Day 4 (before-onset), Day 6–7 (onset) and Day 8–10 (after-onset) post-infection. Organs were homogenized in PBS and aliquoted for RNA extraction. Tissue RNA extraction was conducted by following the WelPrep Tissue RNA Workbench protocol (Welgene). Complementary DNA was obtained by oligo dT-containing reverse transcriptase kit (Q-Amp MMuLV CDNA Synthesis Kit, Taiwan). Specific primers for VP1 were: forward: CTGGTAAAGGTCCAGCACTC, reverse: GGGAGGTCTATCTCTCCAAC; mouse GAPDH: forward: GTTCCTACCCCCAATGTG, reverse: CAACCTGGTCCTCAGTGTAG; IFNB: forward: GTACGTCTCCTGGATGAACTCC, reverse: CCTTTGCACCCTCCAGTAATAG; IL-6: forward: CCTCTCTGCAAGAGACTTCCAT, reverse: ACAGGTCTGTTGGGAGTGGTAT. The results of VP1, IFNB and IL-6 expression were normalized by GAPDH, respectively.

Immunoblotting

Radioimmunoprecipitation assay (RIPA) buffer was used to extract proteins from minced mouse tissue. Human SCARB2, VP1, EV71 3D protein, and GAPDH were detected by goat anti-SCARB2 (AF1966, R&D syst em) antibody, rabbit anti-VP1 polyclonal antibody (PB7631, Abnova, Taiwan), mouse anti-3D monoclonal antibody (GTX630193, Genetex, Taiwan) and rabbit anti-GAPDH polyclonal antibody (GTX100118, Genetex, Taiwan), respectively.

Statistical analysis

Clinical scores of experimental mice were analyzed by one-way ANOVA. Survival rates of infected mice were analyzed with Log-rank test. Cytokine expression from 5 independent experiments was analyzed by Student’s t test. *P < 0.05; **P < 0.001; ***P < 0.0001.

Additional Information

How to cite this article: Liou, A.-T. et al. A new animal model containing human SCARB2 and lacking stat-1 is highly susceptible to EV71. Sci. Rep. 6, 31151; doi: 10.1038/srep31151 (2016).
  31 in total

Review 1.  Neural pathogenesis of enterovirus 71 infection.

Authors:  Kuo-Feng Weng; Li-Lien Chen; Peng-Nien Huang; Shin-Ru Shih
Journal:  Microbes Infect       Date:  2010-03-27       Impact factor: 2.700

2.  Immunodeficient mouse models with different disease profiles by in vivo infection with the same clinical isolate of enterovirus 71.

Authors:  Chun-Che Liao; An-Ting Liou; Ya-Shu Chang; Szu-Yao Wu; Chih-Shin Chang; Chien-Kuo Lee; John T Kung; Pang-Hsien Tu; Ya-Yen Yu; Chi-Yung Lin; Jen-Shiou Lin; Chiaho Shih
Journal:  J Virol       Date:  2014-08-20       Impact factor: 5.103

3.  A non-mouse-adapted enterovirus 71 (EV71) strain exhibits neurotropism, causing neurological manifestations in a novel mouse model of EV71 infection.

Authors:  Wei Xin Khong; Benedict Yan; Huimin Yeo; Eng Lee Tan; Jia Jun Lee; Jowin K W Ng; Vincent T Chow; Sylvie Alonso
Journal:  J Virol       Date:  2011-11-30       Impact factor: 5.103

Review 4.  Virology, epidemiology, pathogenesis, and control of enterovirus 71.

Authors:  Tom Solomon; Penny Lewthwaite; David Perera; Mary Jane Cardosa; Peter McMinn; Mong How Ooi
Journal:  Lancet Infect Dis       Date:  2010-10-18       Impact factor: 25.071

Review 5.  The JAK-STAT pathway at twenty.

Authors:  George R Stark; James E Darnell
Journal:  Immunity       Date:  2012-04-20       Impact factor: 31.745

Review 6.  Immune defence in mice lacking type I and/or type II interferon receptors.

Authors:  M F van den Broek; U Müller; S Huang; R M Zinkernagel; M Aguet
Journal:  Immunol Rev       Date:  1995-12       Impact factor: 12.988

7.  Microglia/macrophage-specific protein Iba1 binds to fimbrin and enhances its actin-bundling activity.

Authors:  Keiko Ohsawa; Yoshinori Imai; Yo Sasaki; Shinichi Kohsaka
Journal:  J Neurochem       Date:  2004-02       Impact factor: 5.372

8.  Scavenger receptor B2 is a cellular receptor for enterovirus 71.

Authors:  Seiya Yamayoshi; Yasuko Yamashita; Jifen Li; Nobutaka Hanagata; Takashi Minowa; Taro Takemura; Satoshi Koike
Journal:  Nat Med       Date:  2009-06-21       Impact factor: 53.440

Review 9.  Clinical features, diagnosis, and management of enterovirus 71.

Authors:  Mong How Ooi; See Chang Wong; Penny Lewthwaite; Mary Jane Cardosa; Tom Solomon
Journal:  Lancet Neurol       Date:  2010-11       Impact factor: 44.182

Review 10.  Cytokine immunopathogenesis of enterovirus 71 brain stem encephalitis.

Authors:  Shih-Min Wang; Huan-Yao Lei; Ching-Chuan Liu
Journal:  Clin Dev Immunol       Date:  2012-08-23
View more
  16 in total

1.  A Novel Murine Model Expressing a Chimeric mSCARB2/hSCARB2 Receptor Is Highly Susceptible to Oral Infection with Clinical Isolates of Enterovirus 71.

Authors:  Cheng-Hung Yang; Chung-Tiang Liang; Si-Tse Jiang; Kuan-Hsing Chen; Chun-Chiao Yang; Mei-Ling Cheng; Hung-Yao Ho
Journal:  J Virol       Date:  2019-05-15       Impact factor: 5.103

2.  Enterovirus A71 Induces Neurological Diseases and Dynamic Variants in Oral Infection of Human SCARB2-Transgenic Weaned Mice.

Authors:  Jing-Yi Lin; Kuo-Feng Weng; Chih-Kuang Chang; Yu-Nong Gong; Guo-Jen Huang; Hui-Lan Lee; Yen-Cheng Chen; Chien-Chih Huang; Jia-Ying Lu; Peng-Nien Huang; Huan-Jung Chiang; Che-Min Chen; Shin-Ru Shih
Journal:  J Virol       Date:  2021-08-11       Impact factor: 5.103

3.  [Angiotensin-converting enzyme 2 particapates in ozone-induced lung inflammation and airway remodeling in mice].

Authors:  Y Wang; Y Zhang; L Zhang; M Li; P Zhu; W Ji; R Liang; L Qiin; W Wu; F Feng; Y Jin
Journal:  Nan Fang Yi Ke Da Xue Xue Bao       Date:  2022-06-20

Review 4.  Immunopathogenesis and Virus-Host Interactions of Enterovirus 71 in Patients with Hand, Foot and Mouth Disease.

Authors:  Jonathan A Cox; Julian A Hiscox; Tom Solomon; Mong-How Ooi; Lisa F P Ng
Journal:  Front Microbiol       Date:  2017-11-28       Impact factor: 5.640

5.  Severity of enterovirus A71 infection in a human SCARB2 knock-in mouse model is dependent on infectious strain and route.

Authors:  Junping Zhu; Ning Chen; Shuya Zhou; Kai Zheng; Lin Sun; Yuxiao Zhang; Lina Cao; Xiaoyan Zhang; Qiaoyan Xiang; Zhiyun Chen; Chenfei Wang; Changfa Fan; Qiushui He
Journal:  Emerg Microbes Infect       Date:  2018-12-05       Impact factor: 7.163

6.  Enterovirus A71 VP1 Variation A289T Decreases the Central Nervous System Infectivity via Attenuation of Interactions between VP1 and Vimentin In Vitro and In Vivo.

Authors:  Huimin Zhu; Yujuan Cao; Weitao Su; Shan Huang; Weizhi Lu; Yezhen Zhou; Jing Gao; Wei Zhao; Bao Zhang; Xianbo Wu
Journal:  Viruses       Date:  2019-05-22       Impact factor: 5.048

7.  Enterovirus 71 targets the cardiopulmonary system in a robust oral infection mouse model.

Authors:  Chih-Shin Chang; Chun-Che Liao; An-Ting Liou; Ya-Shu Chang; Ya-Ting Chang; Bing-Hsiean Tzeng; Chien-Chang Chen; Chiaho Shih
Journal:  Sci Rep       Date:  2019-07-31       Impact factor: 4.379

8.  Pathological Features of Enterovirus 71-Associated Brain and Lung Damage in Mice Based on Quantitative Proteomic Analysis.

Authors:  Yuefei Jin; Dong Li; Tiantian Sun; Yue Du; Yanlei Gao; Ronghua Ding; Wangquan Ji; Weiguo Zhang; Haiyan Yang; Shuaiyin Chen; Guangcai Duan
Journal:  Front Microbiol       Date:  2021-06-18       Impact factor: 5.640

9.  A practical method for evaluating the in vivo efficacy of EVA-71 vaccine using a hSCARB2 knock-in mouse model.

Authors:  Yong Wu; Zhe Qu; Rui Xiong; Yanwei Yang; Susu Liu; Jianhui Nie; Chunnan Liang; Weijin Huang; Youchun Wang; Changfa Fan
Journal:  Emerg Microbes Infect       Date:  2021-12       Impact factor: 7.163

Review 10.  Immunocompetent and Immunodeficient Mouse Models for Enterovirus 71 Pathogenesis and Therapy.

Authors:  Chiaho Shih; Chun-Che Liao; Ya-Shu Chang; Szu-Yao Wu; Chih-Shin Chang; An-Ting Liou
Journal:  Viruses       Date:  2018-11-28       Impact factor: 5.048

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.