Literature DB >> 27489722

Real-time quantitative PCR assay with Taqman(®) probe for rapid detection of MCR-1 plasmid-mediated colistin resistance.

S Chabou1, T Leangapichart1, L Okdah1, S Le Page1, L Hadjadj1, J-M Rolain1.   

Abstract

Here we report the development of two rapid real-time quantitative PCR assays with TaqMan(®) probes to detect the MCR-1 plasmid-mediated colistin resistance gene from bacterial isolates and faecal samples from chickens. Specificity and sensitivity of the assay were 100% on bacterial isolates including 18 colistin-resistant isolates carrying the mcr-1 gene (six Klebsiella pneumoniae and 12 Escherichia coli) with a calibration curve that was linear from 10(1) to 10(8) DNA copies. Five out of 833 faecal samples from chickens from Algeria were positive, from which three E. coli strains were isolated and confirmed to harbour the mcr-1 gene by standard PCR and sequencing.

Entities:  

Keywords:  Antibiotic resistance surveillance; PCR detection, Taqman probe; colistin resistance; mcr-1 gene

Year:  2016        PMID: 27489722      PMCID: PMC4961677          DOI: 10.1016/j.nmni.2016.06.017

Source DB:  PubMed          Journal:  New Microbes New Infect        ISSN: 2052-2975


Introduction

The increasing prevalence of infections caused by multidrug-resistant Gram-negative bacteria combined with few antimicrobial agents being in development has led to a resurgence in interest in colistin as a last-line therapy with the inevitable risk of emerging resistance [1], [2], [3]. MCR-1 plasmid-mediated colistin resistance is a member of the phosphoethanolamine transferase enzyme family, with expression in Escherichia coli resulting in the addition of phosphoethanolamine to lipid A and resistance to colistin [4]. This plasmid-mediated colistin resistance is an emerging concern that has already spread worldwide [5] in E. coli and Klebsiella pneumoniae from pigs, chicken, retail meat (pork, chicken), humans [4]. In animal health, colistin is used to prevent infections from E. coli isolates that are known to cause serious adverse effects such as diarrhoea, sepsis and colibacillosis, which result in huge economic losses [6]. The extensive use of antibiotics in food-animal production has been shown to increase the risk of transferring resistant bacteria to humans [7]. There is a need to screen for colistin resistance even in patients without a history of colistin usage for the timely detection and isolation of patients harbouring such resistant strains to prevent clonal transmission [8]. For this reason the aim of this study was to develop rapid real-time quantitative PCR (qPCR) to detect the MCR-1 plasmid-mediated colistin resistance and to evaluate its sensitivity and specificity both from strains and stool samples.

Materials and methods

Specific primers and probes design

Primers and probes design. We designed specific primers and probes to develop two real-time qPCR assays (PE1 and PE2) for the detection of MCR-1-encoding gene (Table 1). Specificity of the primers and probes were verified in silico by blastN analysis on the National Center for Biotechnology Information (NCBI) database.
Table 1

Primers and probe designed to target the plasmid-mediated colistin resistance (MCR-1)

Primer/probe nameSequencePCR product size (bp)References
Real-time PCR
 PE_F1GCAGCATACTTCTGTGTGGTAC145This study
 PE_R1ACAAAGCCGAGATTGTCCGCG
 PE_Probe 16 FAM –GACCGCGACCGCCAATCTTACC-TAMRA
 PE_F2GGGTGTGCTACCAAGTTTGCTT
 PE_R3TATGCACGCGAAAGAAACTGGC
 PE_Probe6 FAM –GCGCTGATTTTACTGCCTGTGGTG-TAMRA
Standard PCR
 PE_F1GCAGCATACTTCTGTGTGGTAC554This study
 PE_R3TATGCACGCGAAAGAAACTGGC
 CLR5-F5′-CGGTCAGTCCGTTTGTTC-3′[4]
 CLR5-R5′-CTTGGTCGGTCTGTA GGG-3′

Sample collection

Bacterial strains. A total of 100 strains from humans and animals were used in this study including 18 colistin-resistant isolates carrying the mcr-1 gene (six K. pneumoniae and 12 E. coli). Phenotypic and genotypic features of these strains are summarized in Table 2.
Table 2

Presentation of strains of the study with the genes specificity

SpeciesPresence of gene MCR-1COL MIC (mg/L)Genes specificityCT value with PE1 systemCT value with PE2 systemOriginsReferences
Escherichia coli (n = 25)+ (n = 12)− (n = 13)4–16<1–16None18–25019–250Thailand, Laos, Algeria, France, Nigeria.[5], [7]unpublished data
Klebsiella pneumoniae (n = 33)+ (n = 6)− (n = 27)4–32<1–32mgrB* (n = 2) pmrB*(n = 1)mgrB* (12)18–24019–250Thailand, Laos, France, Nigeria, Algeria[9]unpublished data
Klebsiella oxytoca (n = 2)612mgrB* (n = 1)00[9]
Salmonella enterica subsp. enterica (n = 5)0.12516pmrB* (n = 2)blaCTX-M-2 (n = 5)00France[10]
Pseudomonas aeruginosa (n = 10)<1blaVIM-2 (n = 10)00Lebanon[11]
Acinetobacter baumannii (n = 10)<1blaOXA23 (n = 2), blaOXA24 (n = 2), blaOXA58 (n = 1), blaVEB (n = 1)00Algeria[12], [13], [14]
Providencia rettgeri (n = 2)>256blaNDM-1 (n = 1)00Israel[15]
Morganella morganii (n = 2)>256blaNDM-1 (n = 1)00Israel[16]
Enterobacter cloacae (n = 5)<1None00Laos, Nigeria.unpublished data
Proteus mirabilis (n = 2)>256None00Algeriaunpublished data
Proteus vulgaris (n = 2)>256None00Algeriaunpublished data
Serratia marcescens (n = 2)>256None00Algeriaunpublished data

* Mutation; +, positive; −, negative.

COL MIC, minimum inhibitory concentration of colistin.

Chicken stool collection. A total of 833 faeces samples from broilers were collected between August and February 2015 from eight regions in Algeria (El Tarf, Souk Ahras, Skikda, Setif, Jijel, Algiers, Biskra and Ourgla; n = 503) and in three slaughterhouses in Marseille (n = 330). All the extracted DNA from the 833 faeces of broilers was tested using our qPCR assay and positive samples were inoculated on agar for isolation of positive mcr-1 isolates.

Molecular analysis

Strategy for PCR amplification and sequencing. Standard PCR amplification and sequencing of the MCR-1-encoding gene was used as the gold standard and performed as previously described [4]. Quantification of the MCR-1-encoding gene using our two sets of primers and probes was performed using a quantitative CFX96™ Real Time system C1000™ Touch thermal cycler (Bio-Rad, Singapore). The qPCR conditions were as follows: the reaction mixtures were kept at 95°C for 15 min and subsequently put through 35 cycles of 95°C for 30 s and 60°C for 1 min. Specificity and reproducibility of the new system of real-time PCR. The specificity of the primers and probes were verified in vitro using our local collection of 100 strains (Table 2). The sensitivity of our assays was determined using ten-fold serial dilutions (between 108 and 101 DNA copies) of E. coli strain P10 by triplicate amplification, the number of mcr-1 in each sample was calculated based on the DNA copy numbers. The obtained Ct values were used to generate the calibration curves compared with the number of bacteria quantified by standard bacterial count on agar plates. The standard curve was constructed on the basis of the concordance between Ct values and number of log CFU/mL. The limit of detection was based on the final dilution detected by PCR. Efficacy of qPCR was calculated from a standard curve according to Rutledge and Cote [17].

Results

Specificity and technical sensitivity of the qPCR

blastN analysis of the primers and probe designed for the development of the real-time PCR assay showed in silico a 100% homology with the MCR-1-encoding gene only. The sensitivity of the real-time PCR using the 18 mcr-1-positive strains using serial ten-fold dilutions of a calibrated inoculum was excellent with a calibration curve that was linear from 101–108 DNA copies corresponding to 35–21 Ct (Fig. 1). Regression formulae and PCR efficiency of the two real-time PCR assays are shown in Fig. 1. The reproducibility of the two qPCR assays was excellent, with a positive PCR at 21.4 ± 0.4 Ct for PE1 and 20.8 × 0.4 Ct for PE2 when testing one colony re-suspended in 200 μL of sterile water (Table 2). The specificity of the two qPCR assays in vitro against a panel of 82 clinically relevant bacteria negative for mcr-1 gene was 100% (all real-time PCR were negative, Table 2).
Fig. 1

Real-time PCR sensitivity test to detect -encoding plasmid-mediated colistin resistance (MCR-1) encoding gene from Escherichia coli strain P10. PE1 and PE2 are two quantitative PCR assays developed.

Screening of faeces from broilers

Five of the 503 faecal samples from chickens from Algeria were positive, from which three E. coli strains were isolated and confirmed to harbour the mcr-1 gene by standard PCR and sequencing. None of the 330 samples from France were positive.

Discussion

The recent description and emergence of MCR-1 plasmid-mediated resistance to colistin in humans and animals is a major concern worldwide [5]. In this study, two new qPCR assays using Taqman probes were developed that demonstrate high sensitivity and specificity for confirmation of the presence of this gene in colistin-resistant bacterial isolates as well as for screening directly from stool samples. Indeed both systems have the same performance to screen for the presence of MCR-1-containing isolates and in stools. We recommend the use of PE1 as a first set of primers for the rapid screening of mcr-1 and PE2 system to confirm the positive results. Recently, Bontron et al. have reported a real-time PCR assay using SYBR green as fluorescent marker with similar sensitivity [18]. However it is well known that Taqman probes enhance specificity, which is a critical point when testing directly from biological samples. Our real-time PCR assays had advantages including sensitivity, specificity and the possibility of detecting MCR-1 plasmid-mediated colistin resistance very quickly (<2 h). We believe that these real-time PCR assays would be important and powerful tools that could be implemented easily in clinical microbiological laboratories that have molecular facilities, including at point of care, for identification of MCR-1 and implementation of healthcare policies.

Conflict of interest and financial disclosure

There is no potential conflict of interest or financial disclosure for all authors.
  18 in total

1.  Carbapenemase-producing Acinetobacter baumannii in two university hospitals in Algeria.

Authors:  Sofiane Bakour; Marie Kempf; Abdelaziz Touati; Abdennour Ait Ameur; Djamila Haouchine; Farida Sahli; Jean-Marc Rolain
Journal:  J Med Microbiol       Date:  2012-05-24       Impact factor: 2.472

2.  Clonal transmission of a colistin-resistant Escherichia coli from a domesticated pig to a human in Laos.

Authors:  Abiola Olumuyiwa Olaitan; Boupha Thongmalayvong; Kongsap Akkhavong; Silaphet Somphavong; Phimpha Paboriboune; Syseng Khounsy; Serge Morand; Jean-Marc Rolain
Journal:  J Antimicrob Chemother       Date:  2015-08-17       Impact factor: 5.790

3.  Plasmid-mediated colistin resistance: the final blow to colistin?

Authors:  Jean-Marc Rolain; Abiola Olumuyiwa Olaitan
Journal:  Int J Antimicrob Agents       Date:  2015-12-12       Impact factor: 5.283

Review 4.  What do we know about resistance to colistin in Enterobacteriaceae in avian and pig production in Europe?

Authors:  Isabelle Kempf; Mickaël Alain Fleury; Djamel Drider; Mireille Bruneau; Pascal Sanders; Claire Chauvin; Jean-Yves Madec; Eric Jouy
Journal:  Int J Antimicrob Agents       Date:  2013-09-26       Impact factor: 5.283

5.  Worldwide emergence of colistin resistance in Klebsiella pneumoniae from healthy humans and patients in Lao PDR, Thailand, Israel, Nigeria and France owing to inactivation of the PhoP/PhoQ regulator mgrB: an epidemiological and molecular study.

Authors:  Abiola Olumuyiwa Olaitan; Seydina M Diene; Marie Kempf; Meryem Berrazeg; Sofiane Bakour; Sushim Kumar Gupta; Boupha Thongmalayvong; Kongsap Akkhavong; Silaphet Somphavong; Phimpha Paboriboune; Kittipong Chaisiri; Chalit Komalamisra; Olawale Olufemi Adelowo; Obasola Ezekiel Fagade; Omowunmi Abosede Banjo; Adeyeye James Oke; Amos Adler; Marc Victor Assous; Serge Morand; Didier Raoult; Jean-Marc Rolain
Journal:  Int J Antimicrob Agents       Date:  2014-09-06       Impact factor: 5.283

6.  Real-time PCR for detection of plasmid-mediated polymyxin resistance (mcr-1) from cultured bacteria and stools.

Authors:  Séverine Bontron; Laurent Poirel; Patrice Nordmann
Journal:  J Antimicrob Chemother       Date:  2016-04-27       Impact factor: 5.790

7.  Emergence of colistin-resistant bacteria in humans without colistin usage: a new worry and cause for vigilance.

Authors:  Abiola Olumuyiwa Olaitan; Serge Morand; Jean-Marc Rolain
Journal:  Int J Antimicrob Agents       Date:  2015-12-12       Impact factor: 5.283

8.  Acquisition of extended-spectrum cephalosporin- and colistin-resistant Salmonella enterica subsp. enterica serotype Newport by pilgrims during Hajj.

Authors:  Abiola Olumuyiwa Olaitan; Ndèye Méry Dia; Philippe Gautret; Samir Benkouiten; Khadidja Belhouchat; Tassadit Drali; Philippe Parola; Philippe Brouqui; Ziad Memish; Didier Raoult; Jean-Marc Rolain
Journal:  Int J Antimicrob Agents       Date:  2015-02-23       Impact factor: 5.283

9.  First report of 16S rRNA methylase ArmA-producing Acinetobacter baumannii and rapid spread of metallo-β-lactamase NDM-1 in Algerian hospitals.

Authors:  Sofiane Bakour; Abdelaziz Touati; Taous Bachiri; Farida Sahli; Djamel Tiouit; Malek Naim; Mounia Azouaou; Jean-Marc Rolain
Journal:  J Infect Chemother       Date:  2014-09-16       Impact factor: 2.211

10.  Genomic Plasticity of Multidrug-Resistant NDM-1 Positive Clinical Isolate of Providencia rettgeri.

Authors:  Abiola Olumuyiwa Olaitan; Seydina M Diene; Marc Victor Assous; Jean-Marc Rolain
Journal:  Genome Biol Evol       Date:  2016-03       Impact factor: 3.416

View more
  25 in total

1.  MCR-1.6, a New MCR Variant Carried by an IncP Plasmid in a Colistin-Resistant Salmonella enterica Serovar Typhimurium Isolate from a Healthy Individual.

Authors:  Xin Lu; Yongfei Hu; Ming Luo; Haijian Zhou; Xiaoxun Wang; Yu Du; Zhenpeng Li; Jialiang Xu; Baoli Zhu; Xuebin Xu; Biao Kan
Journal:  Antimicrob Agents Chemother       Date:  2017-04-24       Impact factor: 5.191

2.  Acquisition of multidrug-resistant bacteria and encoding genes among French pilgrims during the 2017 and 2018 Hajj.

Authors:  Van-Thuan Hoang; Thi-Loi Dao; Tran Duc Anh Ly; Frédérique Gouriet; Linda Hadjadj; Khadidja Belhouchat; Kamel Larbi Chaht; Saber Yezli; Badriah Alotaibi; Didier Raoult; Philippe Parola; Sophie Alexandra Baron; Vincent Pommier de Santi; Jean-Marc Rolain; Philippe Gautret
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2021-01-07       Impact factor: 3.267

3.  Deciphering Heteroresistance to Colistin in a Klebsiella pneumoniae Isolate from Marseille, France.

Authors:  Lucie Bardet; Sophie Baron; Thongpan Leangapichart; Liliane Okdah; Seydina M Diene; Jean-Marc Rolain
Journal:  Antimicrob Agents Chemother       Date:  2017-05-24       Impact factor: 5.191

4.  Plasmid-Mediated mcr-1 Gene in Colistin-Resistant Clinical Isolates of Klebsiella pneumoniae in France and Laos.

Authors:  Jean-Marc Rolain; Marie Kempf; Thongpan Leangapichart; Selma Chabou; Abiola Olumuyiwa Olaitan; Stéphanie Le Page; Serge Morand; Didier Raoult
Journal:  Antimicrob Agents Chemother       Date:  2016-10-21       Impact factor: 5.191

5.  Acquisition of mcr-1 Plasmid-Mediated Colistin Resistance in Escherichia coli and Klebsiella pneumoniae during Hajj 2013 and 2014.

Authors:  Thongpan Leangapichart; Philippe Gautret; Philippe Brouqui; Ziad A Memish; Didier Raoult; Jean-Marc Rolain
Journal:  Antimicrob Agents Chemother       Date:  2016-10-21       Impact factor: 5.191

6.  Evaluation of a New Commercial Microarray Platform for the Simultaneous Detection of β-Lactamase and mcr-1 and mcr-2 Genes in Enterobacteriaceae.

Authors:  Odette J Bernasconi; Luigi Principe; Regula Tinguely; Aneta Karczmarek; Vincent Perreten; Francesco Luzzaro; Andrea Endimiani
Journal:  J Clin Microbiol       Date:  2017-08-02       Impact factor: 5.948

7.  Detection of blaOXA-48 and mcr-1 Genes in Escherichia coli Isolates from Pigeon (Columba livia) in Algeria.

Authors:  Lotfi Loucif; Widad Chelaghma; Esma Bendjama; Zineb Cherak; Meriem Khellaf; Asma Khemri; Jean-Marc Rolain
Journal:  Microorganisms       Date:  2022-05-06

8.  LBJMR medium: a new polyvalent culture medium for isolating and selecting vancomycin and colistin-resistant bacteria.

Authors:  Lucie Bardet; Stéphanie Le Page; Thongpan Leangapichart; Jean-Marc Rolain
Journal:  BMC Microbiol       Date:  2017-11-23       Impact factor: 3.605

9.  Study of mcr-1 Gene-Mediated Colistin Resistance in Enterobacteriaceae Isolated from Humans and Animals in Different Countries.

Authors:  Linda Hadjadj; Toilhata Riziki; Yan Zhu; Jian Li; Seydina M Diene; Jean-Marc Rolain
Journal:  Genes (Basel)       Date:  2017-12-19       Impact factor: 4.096

10.  The Occurrence of the Colistin Resistance Gene mcr-1 in the Haihe River (China).

Authors:  Dong Yang; Zhigang Qiu; Zhiqiang Shen; Hong Zhao; Min Jin; Huaying Li; Weili Liu; Jun-Wen Li
Journal:  Int J Environ Res Public Health       Date:  2017-05-29       Impact factor: 3.390

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.