Literature DB >> 27465241

Citrobacter freundii carrying blaKPC-2 and blaNDM-1: characterization by whole genome sequencing.

Wenjing Wu1, Björn Espedido2, Yu Feng1, Zhiyong Zong1.   

Abstract

A carbapenem-resistant Citrobacter freundii strain WCHCF65 was recovered from hospital sewage and was characterized by genome sequencing and conjugation experiments. The strain carried nine genes encoding β-lactamases including two carbapenemase genes, blaNDM-1 and blaKPC-2. blaNDM-1 was carried on an IncX3 plasmid, which was identical to a plasmid found in a local Escherichia coli, suggesting interspecies horizontal transfer. blaKPC-2 was bracketed by two copies of insertion sequence ISKpn19, which could form a composite transposon with the potential to mobilize blaKPC-2, on a new type of plasmid. The coexistence of blaNDM-1 and blaKPC-2 conferred higher levels of resistance to carbapenems compared with blaNDM-1 or blaKPC-2 alone. The coexistence of these carbapenemase genes, on two different plasmids, in one strain may allow new genetic platforms to be generated to mediate their spread.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27465241      PMCID: PMC4964652          DOI: 10.1038/srep30670

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Antimicrobial resistance of clinically significant bacteria is a global problem with carbapenem-resistant Enterobacteriaceae (CRE), in particular, emerging as a major threat for medical care. Carbapenem resistance among the Enterobacteriaceae is largely mediated by the production of carbapenemases, which are enzymes able to hydrolyse carbapenems and most other β-lactam antibiotics1. There are many types of carbapenemases, among which KPC and NDM were the two major groups produced in the Enterobacteriaceae1. blaKPC and blaNDM genes (encoding the KPC or NDM carbapenemases, respectively) are commonly found individually in CRE, but there have been several reports of isolates carrying both blaKPC and blaNDM worldwide2345. We previously reported an Enterobacter cloacae carrying blaKPC and blaNDM from a blood culture of an ICU patient and demonstrated that the coexistence of both genes in that strain resulted in a slightly higher level of resistance to carbapenems6. During a study that specifically screened CRE from hospital sewage, we found a Citrobacter freundii isolate also carrying both blaKPC and blaNDM. Here we report the genomic and plasmid characterization of the isolate.

Results and Discussion

C. freundii WCHCF65 was recovered from the sewage input in West China Hospital, Chengdu, western China in January 2015. This isolate was resistant to ceftazidime (minimum inhibitory concentration [MIC], >1024 μg/mL), ciprofloxacin (8 μg/mL), imipenem (1024 μg/mL) and meropenem (512 μg/mL) but was susceptible to amikacin (4 μg/mL), colistin (1 μg/mL) and tigecycline (0.125 μg/mL). Among acquired carbapenemase-encoding genes screened, both blaNDM and blaKPC were detected in WCHCF65. blaNDM-1 and blaKPC-2 were identified by sequencing the complete β-lactamase gene sequences. Both blaNDM-1 and blaKPC-2 were able to be transferred by conjugation, suggesting that they were carried by self-transmissible plasmids. Transconjugants obtained were found harbouring either blaNDM-1 or blaKPC-2, indicating that the two carbapenemase genes were carried by separate plasmids, designated pNDM1_CF65 and pKPC2_CF65, respectively. An E. coli J53 strain containing both plasmids was obtained by electroporation of a J53:pKPC2_CF65 transconjugant with purified pNDM1_CF65 DNA obtained from a respective transconjugant. A two- or four-fold increase in MIC was observed for imipenem and meropenem when comparing E. coli J53 with both blaNDM-1 and blaKPC-2 compared to J53 having either gene alone (Table 1). This confirmed our previous observation that the coexistence of blaNDM-1 and blaKPC-2 in a single strain could confer slightly elevated levels of carbapenem resistance6. Nonetheless, MICs of imipenem and meropenem against J53 containing both carbapenemase genes were still much lower than strain WCHCF65, suggesting that there were additional mechanisms mediating resistance to carbapenems. Previous studies have suggested that impermeability due to alterations of outer membrane porins could lead to resistance to carbapenems78.
Table 1

MICs (μg/mL) of carbapenems and ceftazidime against J53 containing one or both carbapenemase gene-carrying plasmids.

StrainCeftazidimeImipenemMeropenem
J530.50.030.25
J53: pNDM1_CF65>10243216
J53: pKPC2_CF6564328
J53: pNDM1_CF65: pKPC2_CF65>10246432
WCHCF65>10241024512
Whole genome sequencing of C. freundii WCHCF65 generated 3,794,588 reads and 474,268,104 clean bases, from which 269 contigs ≥500 bp in length (N50, 72,950 bp) were assembled with a 51.9% GC content. Strain WCHCF65 belonged to a new C. freundii sequence type: ST88. Among the other 48 C. freundii strains with whole genome sequences available in GenBank, strain WCHCF65 was closest to strain ballerup 7851/39 based on phylogenetic analysis. Interestingly, strain ballerup 7851/39 also belonged to a new ST (ST106) and was isolated from a female patient in 1939 in Denmark9 (Fig. 1). None of the seven alleles of ST88 were identical to those of ST106. The genome of WCHCF65 has the highest average nucleotide identity (ANI; 98.1%) with that of ballerup 7851/39, while the ANI between the genome of WCHCF65 and the remaining 47 C. freundii genomes varied from 90.22% to 92.91%.
Figure 1

Phylogenetic tree of available C. freundii genomes.

GenBank accession numbers of the strains are available at http://www.ncbi.nlm.nih.gov/genome/2850.

Strain WCHCF65 had 16 known antimicrobial resistance genes, corresponding to its phenotype of resistance to carbapenems, ceftazidime and ciprofloxacin. In addition to blaNDM-1 and blaKPC-2, other β-lactamase genes were identified in strain WCHCF65 including blaCTX-M-12, blaCTX-M-14 and blaSHV-12 (encoding extended-spectrum β-lactamases [ESBLs]), blaCMY-6 and blaCMY-137 (encoding AmpC-type cephalosporinases), and blaOXA-1 (encoding a non-ESBL β-lactamase). Of note, this is the first report of blaCMY-137, which is chromosomally located and encodes a novel CMY enzyme, CMY-137 (assigned by the NCBI β-lactamase classification system: www.ncbi.nlm.nih.gov/pathogens/submit_beta_lactamase/). CMY-137 differs from its closest CMY enzyme, CMY-101, by a single amino acid substitution (Thr to Ser at position 195; position is assigned from the ATG start codon) but from CMY-6 by 19 amino acid substitutions (95% identity, 362/381 amino acids). As blaCMY-137 encoded a new CMY enzyme, it was cloned onto the pBC SK vector and was then introduced into E. coli DH5α. Transformants containing blaCMY-137 were resistant to ampicillin (MIC, >256 μg/mL), ceftazidime (32 μg/mL), cefotaxime (16 μg/mL) and cefoxitin (128 μg/mL) but were susceptible to piperacillin (16 μg/mL), piperacillin-tazobactam (1/4 μg/mL) and imipenem (1 μg/mL). The resistance spectrum conferred by CMY-137 was consistence with CMY-210. The genetic context of blaCMY-137 was the same as other chromosome-based blaCMY genes in C. freundii (e.g., strain P10159; GenBank accession number CP012554) whereby blaCMY-137 and its ampR regulator gene were flanked upstream by genes encoding a fumarate reductase and a succinate dehydrogenase and downstream by a gene encoding an entericidin. The remaining seven resistance genes identified in strain WCHCF65 conferred resistance to aminoglycosides (aac(6′)-Ib-cr), chloramphenicol (catB3), fosfomycin (fosA3), macrolides (mph), quinolones (qnrB10), rifampicin (aar3) and sulphonamides (sul1). pNDM1_CF65 is a 54-kb IncX3 plasmid that carries blaSHV-12 in addition to blaNDM-1 but no known acquired virulence factors. Interestingly, pNDM1_CF65 is identical to pNDM1_EC8 from an E. coli strain recovered in the same hospital in 201211 and to pNDM-HF727 (GenBank accession number KF976405) from an E. cloacae strain isolated from Guangdong province, China in 201212. The fact that the same plasmid has been found in different species of the Enterobacteriaceae at different locations suggests IncX3 plasmid-mediated horizontal transfer of blaNDM-1. It appears that IncX3 plasmids have emerged recently as a common vehicle mediating the transfer of blaNDM-1, particularly in China11 and blaNDM-4-like genes13. Plasmid pKPC2_CF65 was 40.9 kb in size and contained genes for conjugation and partitioning but genes encoding the replicon are yet to be determined. The backbone of pKPC2_CF65 had only 67% nucleotide identity (65% coverage) with the closest plasmid matches: p34399-43.500 kb (GenBank accession number CP010387) and p35734-109.753 kb (CP012163) and pCAV1669-34 (CP011648) from E. cloacae, pKPC_CAV1741 (CP011656) from C. freundii, and pCAV1374-34 (CP011629) from Klebsiella oxytoca. Both the PlasmidFinder tool and PCR-based replicon typing could not assign pKPC2_CF to a known incompatibility group. The above findings suggest that pKPC2_CF65 is a novel type of plasmid. On pKPC2_CF65, blaKPC-2 was the only known and complete antimicrobial resistance gene with no known acquired virulence factors being detected. Two copies of ISKpn19 flank blaKPC-2 on pKPC2_CF65 and potentially represent a composite transposon, which has not seen before. However, blaKPC-2 is seen in a similar immediate genetic context on pKPC2_EC14653, a plasmid from an E. cloacae isolate recovered in the same hospital6 (Fig. 2). On both plasmids, a Tn3-like transposon interrupted by the insertion of insertion sequence ISKpn27 can be found upstream of blaKPC-2 (Fig. 2). Downstream of blaKPC-2 there was a copy of ISKpn6 and several open reading frames including korC (function unknown) and klcA (encoding antirestriction protein) that are often seen with blaKPC-2 in other genetic contexts such as in pKPC2_EC14653. However, the repB gene (encoding a putative replication initiation protein), which was present on pKPC2_EC146536, was truncated by the second copy of ISKpn19 in pKPC2_CF65. Given the similarity between the genetic contexts of blaKPC-2 between these two plasmids from the same hospital, it can be suggested that the insertion of two copies of ISKpn19 into a pKPC2_EC14653-like plasmid prior to the movement of blaKPC-2 via an ISKpn19-mediated composite transposon or homologous recombination to a pKPC2_CF65 progenitor.
Figure 2

Genetic context of blaKPC-2 on pKPC2_CF65.

Genetic context of blaKPC-2 on pKPC2_EC14653 (GenBank accession numbers KP868646), which was from a local E. cloacae clinical isolate, is shown for comparison. Regions seen on both plasmids are indicated by the grey shadings (nucleotide identity 99.8%). The inverted repeats of Tn3 (black) and Tn1722 (cyan) are indicated by vertical lines.

The coexistence of blaNDM-1 and blaKPC-2 has been previously identified in five enterobacterial isolates of different species (i.e. C. freundii, E. cloacae, Enterobacter hormaechei and Klebsiella pneumoniae)23456. In all previous isolates and strain WCHCF65, the two carbapenemase genes were not located on a common plasmid. However, the coexistence of two or more plasmids in a single strain may allow new platforms for spreading carbapenemase genes to be generated. Of note, during this study, another C. freundii isolate (strain 112298) was reported to carry both blaNDM-1 and blaKPC-2, which was recovered from a patient in Guangzhou, southern China in 20135. There was no obvious epidemiological link between strain 112298 and strain WCHCF65 that were recovered from these two hospitals (approximately 1,200 km apart in distance). pNDM_CF65 and the plasmid carrying blaNDM-1 in C. freundii strain 112298 were almost identical except a 3.5 kb inversion and 546 bp deletion in the latter plasmid. Both plasmids were also highly similar to other IncX3 plasmids from strains recovered in China11. In contrast, the plasmids carrying blaKPC-2 in the two C. freundii isolates had completely different backbones. In conclusion, the study characterized a C. freundii isolate carrying both blaKPC-2 and blaNDM-1 that were carried by different plasmids. The coexistence of two carbapenemase genes in a single strain is of significance as it confers a higher level of resistance to carbapenems and may allow new platforms to be generated for mediating the further spread of the carbapenemase genes. Two copies of ISKpn19, which bracketed blaKPC-2, could form a composite transposon, representing a new mechanism for mediating the mobilization of blaKPC-2.

Material and Methods

The isolate, in vitro susceptibility and screening for carbapenemase genes

Hospital sewage (1 mL) was obtained from the influx of the wastewater treatment plant in West China Hospital of Sichuan University, Chengdu, western China, in January 2015. The sewage was diluted 1:10 and an aliquot (100 μL) was spread onto a CHROMAgar Orientation (CHROMAgar, Paris, France) agar plate containing 2 μg/mL meropenem and then incubated at 35 °C overnight under aerobic conditions. Colonies were patched on CHROMAgar plates containing 2 μg/mL meropenem to ensure they were resistant to carbapenems and were then screened for acquired carbapenemase-encoding genes blaGES, blaKPC, blaIMP, blaIMI, blaNDM, blaOXA-48 and blaVIM using PCR as described previously14151617. Amplicons containing the complete coding sequence of blaNDM14 or blaKPC17 were sequenced in both directions using an ABI 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA) at the Beijing Genomics Institute (Beijing, China). Preliminary species identification was performed by partially sequencing the gyrB gene as described previously18. MICs of amikacin, ceftazidime, ciprofloxacin, colistin, imipenem, meropenem and tigecycline were determined using the microdilution broth method and breakpoints following recommendations of the Clinical Laboratory Standards Institute (CLSI)19. As no CLSI-defined breakpoints for tigecycline and colistin were available, those defined by the Food and Drug Administration (FDA) were used for tigecycline and those by the European Committee on Antimicrobial Susceptibility Testing (EUCAST)20 were used for colistin.

Cloning of bla CMY-137

The complete coding sequence of blaCMY-137 was amplified with primers 65_N92-1EcoRI (AGAATTCAGTCGCTCAACAGAGGGAAA, the EcoRI restriction site was underlined; binding to ampR, upstream of blaCMY-137) and CMY137-dowEcoRI (AGAATTCTCGCCAGTGAAGTAGGCTTT; binding to a gene downstream of blaCMY-137). The amplicon was 2 kb in size and contained the 1,146-bp complete coding sequence of blaCMY-137. The amplicon was restricted using EcoRI (NEB, Ipswich, MA, USA) and then was ligated to EcoRI-restricted pBC SK vector (Agilent, Santa Clara, CA, USA) using T4 ligase (NEB). The ligated fragments were electroporated into E. coli DH5α and the blaCMY-137-containing transformants were selected on LB agar plates containing 100 μg/mL ampicillin. The presence of blaCMY-137 in transformants was confirmed by PCR and sequencing. MICs of ampicillin, ceftazidime, cefotaxime, cefoxitin, imipenem, piperacillin and piperacillin-tazobactam were determined using the broth microdilution method following recommendations of CLSI.

Whole genome sequencing and analysis

Genomic DNA of strain WCHCF65 was prepared using QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) and was subjected to paired-end (2 × 125 bp) whole genome sequencing with approximately 100× coverage using the HiSeq 2500 Sequencer (Illumina, San Diego, CA, USA) following the manufacturer’s protocol at the Beijing Genomics Institute. The Spades program21 was used to de novo assemble reads into contigs and annotation of the genomic sequence was carried out using the Prokka program22. ST was determined by using the genomic sequence to query the multi-locus sequence typing (MLST) database of C. freundii (http://pubmlst.org/cfreundii/) and the MLST tool from the Center for Genomic Epidemiology (http://genomicepidemiology.org/). Antimicrobial resistance genes were predicted using the ResFinder tool (80%, minimum threshold for identity; 60%, minimum coverage) from the Center for Genomic Epidemiology. To confirm the chromosomal location of blaCMY-137, the contig containing this gene was linked to a contig containing genes encoding ribosomal proteins by PCRs using primers designed based on available contig sequences and Sanger dideoxy sequencing. Acquired virulence factors were predicted using the VirulenceFinder tool (85%, minimum threshold for identity; 60%, minimum coverage) from the Center for Genomic Epidemiology to query the known virulence factors of E. coli. Phylogenetic relatedness of WCHCF65 to the 48 C. freundii genomes available in GenBank (http://www.ncbi.nlm.nih.gov/genome/2850, accessed November 24, 2015) was investigated using the Harvest suite23. The ANI between the genome sequence of WCHCF65 and the 48 C. freundii genomes was calculated using the web-based JSpeciesWS tool24. Plasmid replicons carried by WCHCF65 were determined using the PlasmidFinder tool (80%, minimum threshold for identity) from the Center for Genomic Epidemiology. The sequence of plasmids carrying blaNDM-1 or blaKPC-2 were completely circularised with gaps between contigs closed by Sanger dideoxy sequencing of amplicons from PCRs using primers designed based on available contig sequences. For pKPC2_CF65, PCR-based replicon typing was performed as described previously25.

Plasmid manipulation experiments

Conjugation experiments of WCHCF65 were carried out in broth using azide-resistant E. coli strain J53 as the recipient; potential transconjugants were selected on LB agar plates containing 4 μg/mL meropenem and 150 μg/mL sodium azide. To obtain a J53 strain containing both blaNDM- and blaKPC-carrying plasmids (pNDM1_CF65 and pKPC2_CF65, respectively), plasmid DNA was prepared from J53 containing pNDM1_CF65 by alkaline lysis and was then electroporated into J53 containing pKPC2_CF65. Potential transformants were selected on LB agar plates with 250 μg/mL zeocin (Invitrogen, Waltham, MA, USA), a bleomycin antibiotic. As the recipient carried blaKPC-2 and was resistant to carbapenems, the use of carbapenems was therefore no longer able to distinguish the recipient and the transformant. Nonetheless, the recipient did not carry any bleomycin-resistant genes but the bleomycin-resistant gene ble was located downstream of blaNDM-1. Therefore, bleomycin could be used to screen the transformants. The presence of blaNDM and blaKPC in transconjugants and transformants were confirmed by PCR.

Nucleotide sequence accession number

Reads and the Whole Genome Shotgun Sequencing project of C. freundii WCHCF65 have been deposited into DDBJ/EMBL/GenBank under the accession numbers SRR2153225 and LIDR01000000, respectively. The sequence of pKPC2_CF65 has been deposited into DDBJ/EMBL/GenBank under accession number KU176944.

Additional Information

How to cite this article: Wu, W. et al. Citrobacter freundii carrying blaKPC-2 and blaNDM-1: characterization by whole genome sequencing. Sci. Rep. 6, 30670; doi: 10.1038/srep30670 (2016).
  24 in total

1.  Biochemical sequence analyses of GES-1, a novel class A extended-spectrum beta-lactamase, and the class 1 integron In52 from Klebsiella pneumoniae.

Authors:  L Poirel; I Le Thomas; T Naas; A Karim; P Nordmann
Journal:  Antimicrob Agents Chemother       Date:  2000-03       Impact factor: 5.191

2.  Rapid detection and identification of metallo-beta-lactamase-encoding genes by multiplex real-time PCR assay and melt curve analysis.

Authors:  Rodrigo E Mendes; Katia A Kiyota; Jussimara Monteiro; Mariana Castanheira; Soraya S Andrade; Ana C Gales; Antonio C C Pignatari; Sergio Tufik
Journal:  J Clin Microbiol       Date:  2006-11-08       Impact factor: 5.948

3.  Klebsiella pneumoniae outer membrane porins OmpK35 and OmpK36 play roles in both antimicrobial resistance and virulence.

Authors:  Yu-Kuo Tsai; Chang-Phone Fung; Jung-Chung Lin; Jiun-Han Chen; Feng-Yee Chang; Te-Li Chen; L Kristopher Siu
Journal:  Antimicrob Agents Chemother       Date:  2011-01-31       Impact factor: 5.191

4.  Coproduction of NDM-1 and KPC-2 in Enterobacter hormaechei from Brazil.

Authors:  Polyana Silva Pereira; Mirla Borghi; Rodolpho Mattos Albano; Jonathan Christian Oliveira Lopes; Melise Chaves Silveira; Elizabeth Andrade Marques; Jane Cleide Ribeiro Oliveira; Marise Dutra Asensi; Ana Paula D'Alincourt Carvalho-Assef
Journal:  Microb Drug Resist       Date:  2014-12-04       Impact factor: 3.431

5.  Prokka: rapid prokaryotic genome annotation.

Authors:  Torsten Seemann
Journal:  Bioinformatics       Date:  2014-03-18       Impact factor: 6.937

6.  Identification of plasmids by PCR-based replicon typing.

Authors:  Alessandra Carattoli; Alessia Bertini; Laura Villa; Vincenzo Falbo; Katie L Hopkins; E John Threlfall
Journal:  J Microbiol Methods       Date:  2005-06-02       Impact factor: 2.363

7.  blaNDM-1-carrying Acinetobacter johnsonii detected in hospital sewage.

Authors:  Zhiyong Zong; Xingzhuo Zhang
Journal:  J Antimicrob Chemother       Date:  2013-01-03       Impact factor: 5.790

8.  The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli.

Authors:  Nicola K Petty; Richard Bulgin; Valerie F Crepin; Ana M Cerdeño-Tárraga; Gunnar N Schroeder; Michael A Quail; Nicola Lennard; Craig Corton; Andrew Barron; Louise Clark; Ana L Toribio; Julian Parkhill; Gordon Dougan; Gad Frankel; Nicholas R Thomson
Journal:  J Bacteriol       Date:  2009-11-06       Impact factor: 3.490

9.  Identification and characterization of a novel incompatibility group X3 plasmid carrying bla NDM-1 in Enterobacteriaceae isolates with epidemiological links to multiple geographical areas in China.

Authors:  Pak-Leung Ho; Zhen Li; Wai-U Lo; Yuk-Yam Cheung; Chi-Ho Lin; Pak-Chung Sham; Vincent Chi Chung Cheng; Tak-Keung Ng; Tak-Lun Que; Kin-Hung Chow
Journal:  Emerg Microbes Infect       Date:  2012-11-07       Impact factor: 7.163

10.  JSpeciesWS: a web server for prokaryotic species circumscription based on pairwise genome comparison.

Authors:  Michael Richter; Ramon Rosselló-Móra; Frank Oliver Glöckner; Jörg Peplies
Journal:  Bioinformatics       Date:  2015-11-16       Impact factor: 6.937

View more
  14 in total

1.  Interplay among IncA and bla KPC-Carrying Plasmids in Citrobacter freundii.

Authors:  Ibrahim Bitar; Mariasofia Caltagirone; Laura Villa; Vittoria Mattioni Marchetti; Elisabetta Nucleo; Mario Sarti; Roberta Migliavacca; Alessandra Carattoli
Journal:  Antimicrob Agents Chemother       Date:  2019-04-25       Impact factor: 5.191

2.  Plasmid-Mediated Novel blaNDM-17 Gene Encoding a Carbapenemase with Enhanced Activity in a Sequence Type 48 Escherichia coli Strain.

Authors:  Zhihai Liu; Yang Wang; Timothy R Walsh; Dejun Liu; Zhangqi Shen; Rongmin Zhang; Wenjuan Yin; Hong Yao; Jiyun Li; Jianzhong Shen
Journal:  Antimicrob Agents Chemother       Date:  2017-04-24       Impact factor: 5.191

3.  KPC-3-, GES-5-, and VIM-1-Producing Enterobacterales Isolated from Urban Ponds.

Authors:  Pedro Teixeira; Nuno Pinto; Isabel Henriques; Marta Tacão
Journal:  Int J Environ Res Public Health       Date:  2022-05-11       Impact factor: 4.614

4.  blaKPC-2-Encoding IncP-6 Plasmids in Citrobacter freundii and Klebsiella variicola Strains from Hospital Sewage in Japan.

Authors:  Yusuke Ota; Isaac Prah; Yoko Nukui; Ryuji Koike; Ryoichi Saito
Journal:  Appl Environ Microbiol       Date:  2022-04-05       Impact factor: 5.005

5.  Complete Genome Sequence of Citrobacter freundii 705SK3, an OXA-48-Encoding Wastewater Isolate.

Authors:  Katrin Zurfluh; Roger Stephan; Jochen Klumpp; Magdalena Nüesch-Inderbinen; Jörg Hummerjohann; Claudia Bagutti; Roger Marti
Journal:  Genome Announc       Date:  2017-08-17

6.  Genetic characterization of a novel sequence type of multidrug-resistant Citrobacter freundii strain recovered from wastewater treatment plant.

Authors:  Xiawei Jiang; Xinjie Cui; Wenhong Liu; Hao Xu; Beiwen Zheng
Journal:  Infect Drug Resist       Date:  2019-09-06       Impact factor: 4.003

7.  Multidrug-resistant Citrobacter freundii ST139 co-producing NDM-1 and CMY-152 from China.

Authors:  Lang Yang; Peihan Li; Beibei Liang; Xiaofeng Hu; Jinhui Li; Jing Xie; Chaojie Yang; Rongzhang Hao; Ligui Wang; Leili Jia; Peng Li; Shaofu Qiu; Hongbin Song
Journal:  Sci Rep       Date:  2018-07-13       Impact factor: 4.379

8.  Comparative genomics of five different resistance plasmids coexisting in a clinical multi-drug resistant Citrobacter freundii isolate.

Authors:  Jing Ouyang; Fengjun Sun; Dongsheng Zhou; Jiao Feng; Zhe Zhan; Zhijian Xiong; Bo Yang; Zhirui Liu; Tingbo Li; Yigang Tong; Peiyuan Xia
Journal:  Infect Drug Resist       Date:  2018-09-12       Impact factor: 4.003

9.  Prevalence of extensive drug resistance in bacterial isolates harboring blaNDM-1 in Quetta Pakistan.

Authors:  Mohammad Din; Khan M Babar; Shabir Ahmed; Abdul Aleem; Dawood Shah; Dawood Ghilzai; Nazeer Ahmed
Journal:  Pak J Med Sci       Date:  2019 Jul-Aug       Impact factor: 1.088

10.  Novel IncR/IncP6 Hybrid Plasmid pCRE3-KPC Recovered from a Clinical KPC-2-Producing Citrobacter braakii Isolate.

Authors:  Dandan Dong; Ziqiang Mi; Dujun Li; Mingming Gao; Nan Jia; Manli Li; Yigang Tong; Xianglilan Zhang; Yuanqi Zhu
Journal:  mSphere       Date:  2020-03-25       Impact factor: 4.389

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.