Literature DB >> 27362639

Investigating Biological Control Agents for Controlling Invasive Populations of the Mealybug Pseudococcus comstocki in France.

Thibaut Malausa1, Mathilde Delaunay1, Alexandre Fleisch1, Géraldine Groussier-Bout1, Sylvie Warot1, Didier Crochard1, Emilio Guerrieri2, Gérard Delvare3, Giuseppina Pellizzari4, M Bora Kaydan5, Nadia Al-Khateeb6, Jean-François Germain7, Lisa Brancaccio1, Isabelle Le Goff1, Melissa Bessac1, Nicolas Ris1, Philippe Kreiter1.   

Abstract

Pseudococcus comstocki (Hemiptera: Pseudococcidae) is a mealybug species native to Eastern Asia and present as an invasive pest in northern Italy and southern France since the start of the century. It infests apple and pear trees, grapevines and some ornamental trees. Biocontrol programmes against this pest proved successful in central Asia and North America in the second half of the 20th century. In this study, we investigated possible biocontrol agents against P. comstocki, with the aim of developing a biocontrol programme in France. We carried out systematic DNA-barcoding at each step in the search for a specialist parasitoid. First we characterised the French target populations of P. comstocki. We then identified the parasitoids attacking P. comstocki in France. Finally, we searched for foreign mealybug populations identified a priori as P. comstocki and surveyed their hymenopteran parasitoids. Three mealybug species (P. comstocki, P. viburni and P. cryptus) were identified during the survey, together with at least 16 different parasitoid taxa. We selected candidate biological control agent populations for use against P. comstocki in France, from the species Allotropa burrelli (Hymenoptera: Platygastridae) and Acerophagus malinus (Hymenoptera: Encyrtidae). The coupling of molecular and morphological characterisation for both pests and natural enemies facilitated the programme development and the rejection of unsuitable or generalist parasitoids.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27362639      PMCID: PMC4928892          DOI: 10.1371/journal.pone.0157965

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Pseudococcus comstocki (Hemiptera: Pseudococcidae) is a mealybug species native to Eastern Asia that has been present as an invasive pest in northern Italy and southern France since the turn of the century [1, 2], infesting apple, pear and ornamental trees of the genera Morus and Catalpa in particular. P. comstocki causes economic losses, principally due to a decrease in fruit marketability as a consequence of the massive development of sooty mould on the honeydew excreted by the mealybug which accumulates on the leaves and fruits. For example, in several infested orchards in southern France up to 80% of the harvested fruits are discarded when infestation rates are high and accumulation of sooty mould is particularly severe on the surface or the carpel of the fruits (Philippe Kreiter, 2009, pers. com.). The presence of P. comstocki populations also weakens the plants in other ways, through sap-feeding and virus transmission [3]. Biological control is often used as an alternative to pesticides for the control of mealybugs [4]. This approach has repeatedly proven to be successful and safe for non-target organisms [5, 6]. Specific hymenopteran parasitoids have been used to control P. comstocki, including Acerophagus (= Pseudaphycus) malinus (Hymenoptera: Encyrtidae) in the former USSR [7-12] and in the USA [13, 14], and Allotropa burrelli (Hymenoptera: Platygastridae) in the USA [14, 15]. In 2008, the French National Institute of Agronomy (INRA) set up a classical biological control programme for P. comstocki in France. This programme began with a study of the French populations of P. comstocki and a survey of the natural enemies associated with P. comstocki in France. From 2009 to 2011 we looked for P. comstocki populations abroad (Italy, Syria, China, Japan, Turkey) and surveyed their natural enemies. The first samples of exotic material were imported in 2010 from Japan and the first releases of natural enemies took place in 2012. It has been repeatedly argued and observed that classical biological control benefits from the use of molecular tools [16-19]. DNA-based methods help to identify the target pest and its possible natural enemies with precision in the native area and in areas in which biocontrol is considered. This makes it possible to avoid (i) a mismatch between the target pest and the biological control agent released, and (ii) the choice of a natural enemy with highly generalist behaviour in the native area that might have unintended effects on local biodiversity in the region in which it is released. The use of DNA techniques to characterise the biological material used throughout the biocontrol programme also makes it possible to implement quality and traceability procedures, which may be required to obtain governmental authorisation for the importation of biological material. At each step in the P. comstocki biological control programme, we made use of molecular characterisation methods, the results of which helped to guide key decisions. We first used DNA sequencing to characterise French P. comstocki populations, by methods recently used for the DNA barcoding of mealybugs [20-23]. We then used molecular and morphological methods to characterise the parasitoids present in these mealybugs in France. The next step was the search for exotic candidate biocontrol agents. We used DNA sequencing to check that the foreign mealybugs identified as P. comstocki did indeed have DNA sequences similar to those of the French P. comstocki populations. We then used DNA sequencing and morphological examination to characterise and identify as accurately as possible all of the parasitoids collected from the foreign P. comstocki populations. We present here (i) an overview of the classical biocontrol programme, which resulted in the field release of two natural enemies: augmentative biological control using French populations of A. malinus, and the introduction of exotic A. burrelli populations, (ii) the methods and results of the molecular and morphological characterisations carried out at each step in the classical biocontrol programme, and (iii) a discussion of the added value provided by the molecular identification methods.

Materials and Methods

Description of the biocontrol programme and the sampling strategy

The biological control programme was initiated in 2008, following the detection of P. comstocki in apple orchards in southern France in 2005 [1]. The programme was coordinated by INRA (France) and focused on orchards located along the French Mediterranean coast and in the southern Rhone valley. From 2008 to 2010, populations of P. comstocki and its natural enemies were sampled in the field in France. The material collected was used for morphological and DNA-based identification [24]. In total, 16 mealybug population samples were collected (Table 1), together with the parasitoids emerging from them. The collected mealybugs and parasitoids were conserved in 70% to 96% ethanol and stored at -20°C for further characterisation.
Table 1

Sampling sites: code, host plant, collection date, country, region and site of sampling, number of individuals with DNA data: mealybugs with sequence data, mealybugs with rapid PCR identification data, most likely mealybug species present based on molecular data (between P. comstocki–PC—and P. viburni–PV which were often encountered in sympatry), parasitoids with DNA sequence data.

Site codeHost plantDateCountryCountySite / CityN sequenced mealybugsN PCR identified mealybugsMost likely host (PC, PV)N sequenced parasitoids
C01Vitis vinifera07/2010ChinaShangdongShangdong6-PC?-
F01Morus kagayamae2009–2010FranceVarRoquebrune-sur-Argens7-PC71
F02Malus pumila08/2008FranceGardBeaucaire-5PV3
F03Malus pumila09/2008FranceGardManduel-7PC(1),PV(6)1
F04Malus pumila09/2008FranceHéraultMarsillargues-13PC(12),PV(1)26
F05Malus pumila07-10/2008FranceHéraultMauguio--PC/PV4
F06Malus pumila08/2007FranceHéraultMontpellier-5PC4
F07Malus pumila07-09/2008FranceGardRodilhan--PC/PV2
F08Morus kagayamae07-09/2008FranceBouches du RhôneSaintes-Maries-de-la-Mer-20PC26
F09Malus pumila07/2008FranceGardSaint-Geniès-des-Mourgues--PC/PV1
F10Malus pumila09/2008FranceGardSaint-Gilles-7PC42
F11Malus pumila07-09/2008FranceBouches du RhôneSambuc--PC/PV5
F12Malus pumila08/2011FranceBouches du RhôneMallemort-5PC4
F13Malus pumila07-09/2008FranceGardJonquières-Saint-Vincent-4PC(3),PV(1)-
F14Malus pumila09/2008FranceGardFourques-9PV-
F15Malus pumila08/2008FranceGardCaissargues7PC(1),PV(6)-
F16Solanum tuberosum (lab)12/2010FranceAlpes-MaritimesSophia Antipolis5-PC-
F17Malus pumila08/2010FranceGardBellegarde3---
I01Viburnum tinus09/2009ItalyVenetoTreviso6-PV-
I02Morus nigra09/2009ItalyVenetoDossobuono4-PC10
I03Prunus persica09/2009ItalyVenetoAlpo di Villafranca4-PC-
I04Catalpa sp.09/2009ItalyVenetoCastelnuovo del Garda5-PC1
J01Pyrus sp.08/2010JapanTottoriTottori5-PC12
J02Vitis sp.08/2010JapanIzumoIzumo15-PC20
J03Malus sp.08/2010JapanUtsunomiyaUtsunomiya6-PC3
J04Solanum tuberosum (lab)08/2010JapanUtsunomiyaUtsunomiya2-PC-
S01Citrus sp.09/2009SyriaLatakiaLatakia60--38
T01Morus sp.2010TurkeyIgdirIgdir4-PC10
T02Punica granatum2010TurkeyArtvinArtvin16-PC32
From 2009 to 2011, we sampled and characterised exotic populations of P. comstocki and their associated natural enemies (Table 1) in regions where the occurrence of P. comstocki had been recorded recently. The first samples were obtained from Syria and Italy in 2009. In 2010, samples were obtained from China and Japan. In 2011, other populations were sampled in eastern Turkey. In total, 14 populations of mealybugs were collected outside France (Table 1). Parasitoids were collected from infested mealybugs in Syria, Italy, Japan and Turkey (Table 1). The samples of mealybugs and parasitoids were conserved in 70% to 96% ethanol and stored at -20°C for further characterisation (“Characterisation of mealybug and parasitoid material” section).

Characterisation of mealybug and parasitoid material

Mealybug DNA extraction, amplification and sequencing

For each individual (whatever its development stage), genomic DNA was extracted with the DNeasy Tissue Kit (QIAGEN, Hilden, Germany). Animals were not crushed before extraction. Instead, we extended the cell lysis time beyond that recommended by the manufacturer (6–8 h, rather than the recommended 4–6 h). Two elution steps were performed with AE buffer to increase the amount of DNA extracted: 2 x 20 μL for the smallest mealybugs (L1), 2 x 30 μL for L2 and L3, 2 x 50 μL for adults. Three DNA regions were studied for the mealybug samples: 28S, ITS2 and the LCO region of the cytochrome oxidase subunit I (COI) gene (hereafter referred to as M-28S, M-ITS2 and M-LCO, respectively). PCRs for the M-28S and M-ITS2 markers was performed with the Phusion High-Fidelity DNA polymerase 530L (FINNZYMES, Espoo, Finland). PCR for the M-LCO marker was performed with the Qiagen Multiplex PCR kit (QIAGEN, Hilden, Germany). All PCRs were performed in a total volume of 25 μL: 23 μL of mix + 2 μL of diluted DNA (between 1 and 20 ng). For M-28S and M-ITS2, the reagent concentrations were: 1x Phusion HF buffer, 0.01 U/μL Phusion enzyme, 200 μM dNTPs and 0.5 μM of each primer. For M-ITS2, we added 1.5 mM MgCl2 and 6% DMSO. For M-LCO, the reagent concentrations were: 12.5 μL Qiagen buffer and 0.2 μL of each primer in the total volume. All the primers used are listed in Table 2.
Table 2

List of the markers used in the PCR protocols: organism (mealybug or parasitoid), name of the target region, name of primers, 5’–3’ primer sequence, reference from which the sequences were obtained.

Organism typeLocus namePrimer nameF/RPrimer sequenceReferences
MealybugsM-28SM28S-FFAGAGAGAGTTCAAGAGTACGTGBelshaw and Quicke [36]
M28S-RRTTGGTCCGTGTTTCAAGACGGG
M-LCOMLCOn-FFAYAATATAATRATTACWWTWCATGCAbd-Rabou et al. [22]
MLCOn-RRTTTWCCATTTAAWGTTATTATTC
M-ITS2MITS2-FFCTCGTGACCAAAGAGTCCTGMalausa et al. [20]
MITS2-RRTGCTTAAGTTCAGCGGGTAG
ParasitoidsP-28SP28S-FFCGTGTTGCTTGATAGTGCAGCHeraty et al. [37]
P28S-RRTCAAGACGGGTCCTGAAAGT
P-C1PC1-FFCAACATTTATTTTGATTTTTTGGSimon et al. [38]
PC1-RRTCCAATGCACTAATCTGCCATA
P-LCOLCOFGGTCAACAAATCATAAAGATATTGGFolmer et al. [39]
HCORTAAACTTCAGGGTGACCAAAAAATCA
P-ITS2PITS2-FFGGGTCGATGAAGAACGCAGCNavajas et al. [40]
PITS2-RRATATGCTTAAATTCAGCGGG
For M-28S and M-ITS2, PCR conditions were: initial denaturation at 98°C for 30 s, followed by 35 cycles of (i) denaturation at 98°C for 10 s, (ii) annealing at 58°C for 15 s, (iii) elongation at 72°C for 15 s and a final extension period at 72°C for 5 minutes. For M-LCO, the PCR conditions were: initial denaturation at 95°C for 15 min, followed by 35 cycles of (i) denaturation at 95°C for 30 s, (ii) annealing at 48°C for 90 s, (iii) elongation at 72°C for 90 s and a final extension period at 72°C for 10 minutes. PCR products were screened with the Qiaxcel Advanced system (QIAGEN, Hilden, Germany), with Fast Analysis cartridges (DM80 protocol). PCR products were then sent to Genoscreen (Lille, France) or Beckman Genomics (Takeley, United Kingdom) for bidirectional Sanger sequencing. Consensus sequences were generated and checked with Seqscape v2.7 (ABI). Alignments were edited manually with Bioedit 7.01 [25]. Sequences were deposited in Genbank.

Morphological examination of mealybugs

When possible, a few adult mealybug females per multi-locus haplotype determined by DNA sequencing were prepared for morphological examination, following the procedure described in Malausa et al. [20]. Briefly, mealybugs were prepared as follows: (i) the specimen was heated (≤ 40°C) in 10% KOH for 20 minutes; (ii) it was then rinsed in distilled water for 20 minutes; (iii) it was stained by incubation for one hour in a saturated solution of fuchsin in a 1:1:1 mixture of distilled water, lactic acid and glycerol; (iv) the specimen was washed in glacial acetic acid for one hour to stabilise the staining; (v) the specimen was transferred to lavender oil for at least one hour, placed in a drop of Canada balsam on a slide and covered with a coverslip. The slide was then labelled and observed under a microscope. In most cases, identification was based on the keys of Beardsley [26], Cox [27], Williams & Watson [28], Williams & Granara de Willink [29] and Williams [30]. The reference slide-mounted specimens used were obtained from the ANSES collection stored at the Laboratoire de la Santé des végétaux, Unité d’entomologie et plantes invasives (Montferrier-sur-Lez Cedex, France).

Parasitoid DNA extraction, amplification and sequencing

For each adult parasitoid, genomic DNA was extracted with the Prepgem Insect kit (Zygem, Hamilton, New Zealand). Parasitoids were not crushed before extraction and the time period over which the Prepgem enzyme was allowed to act was extended beyond the manufacturer’s recommendations (2 h rather than 30 minutes). The total volume of 1X Prepgem Buffer and enzyme used was 30 μL per individual. Four DNA regions were studied: 28S, ITS2 and two regions of the cytochrome oxidase subunit I gene (hereafter referred to as P-28S, P-ITS2, P-LCO and P-C1, respectively). The primers used for each region are listed in Table 2. PCR was performed with the Qiagen Multiplex PCR Kit (QIAGEN, Hilden, Germany), with a reaction mixture of the same composition as for the mealybugs. PCR conditions were as follows: initial denaturation at 95°C for 15 minutes, followed by 35 cycles of (i) denaturation at 95°C for 30 s, (ii) annealing for 90 s at 54°C, 56°C, 48°C and 48°C for P-28S, P-ITS2, P-C1 and P-LCO, respectively, (iii) elongation at 72°C for 90 s, followed by a final extension period at 72°C for 10 minutes. PCR products were screened with the Qiaxcel Advanced system (QIAGEN, Hilden, Germany), sequenced and analysed using the same methods as those used for mealybugs. A neighbour-joining (NJ) tree was generated based on the number of nucleotide differences between 28S sequences, with Mega4 [31], in order to provide a visual representation of the data obtained for Encyrtidae parasitoids (this tree is not to provide phylogenetic information).

Morphological examination of parasitoids

Each of the parasitoids preserved in 70% to 96% ethanol was initially assigned to a morphospecies. Card mounting: when available, at least five adult females and five adult males of each morphospecies were dried by placing them for 24 h in a 1:1 mixture of absolute ethanol-xylene. Specimens were then transferred to amyl acetate for 24 h and were rinsed in amyl acetate until the solvent completely evaporated. The dry specimens were mounted on card with water-soluble glue. Slide mounting: when available, one male and one female from each morphospecies were selected from card-mounted material and processed as described by Noyes [32]. In brief, wings were dissected and mounted in a drop of Canada balsam, and the rest of the insect was detached from the card by applying a drop of distilled water, incubated with 10% KOH 100°C for five minutes and then with acetic acid at room temperature for 5 minutes. It was then dehydrated in a progressive series of ethanol solutions (concentrations from 70 to 100%). A drop of clove oil was added to the specimen in absolute ethanol, and the ethanol was allowed to evaporate off completely. Head, mouthparts, antennae, thorax, hypopygium (for females only) and genitalia were dissected and mounted in Canada Balm. Slide-mounted voucher specimens were deposited in the collection of the laboratory of Entomology “E. Tremblay”, Department of Agriculture University of Naples “Federico II”, Italy. Identification of species was performed by comparing the material with type specimens and authoritatively identified material preserved at the Natural History Museum of London, UK, which houses the largest and best preserved collection of Hymenoptera parasitoids in the world.

Assignment of the parasitoid host species

At least one of the mealybugs collected from each site outside France was systematically subjected to DNA sequencing. In France, during the parasitoid survey, only a small proportion of the mealybugs were identified by DNA sequencing, to decrease costs. Indeed, a rapid identification method based on species-specific PCR (Correa et al. in preparation) was used for mealybugs collected at sites located in regions for which DNA sequence data were already available (Table 1). The assignment of each parasitoid to a host was not 100% reliable, as identification was performed at population rather than individual level. We therefore did not necessarily identify the mealybug from which each parasitoid emerged. Outside France, only one mealybug species was found to be present at each sampling site, suggesting that host assignment was probably reliable. In France, P. viburni and P. comstocki often occurred together. Hence, in France, the reliability of host assignment was proportional to the number of mealybugs identified.

Results

Comparisons between invasive French P. comstocki populations and other populations worldwide

In total, we obtained 152 DNA sequences for M-28S, 144 for M-ITS2, 83 for M-LCO. The P. comstocki individuals collected in France had the M-28S-1, M-ITS2-1/2 and M-LCO-1 haplotypes (Table 3, including Genbank accession numbers).
Table 3

Haplotypes identified for the mealybugs collected in this study: most probable identification based on morphology and molecular data, haplotypes at 28S, ITS2, COI-LCO (and the corresponding NCBI genbank accession numbers), specimen codes of the individuals identified and codes of the sites at which they were collected.

IdentificationHaplotypesIndividual sample codesSites
28SITS2LCO
Pseudococcus comstockiM28S-01 (KU499441)MITS2-01 (KU499508), MITS-02 (KU499509)MLCO-01 (KU499444), MLCO-02 (KU499445)1383–1386, 1632, 1634, 1635, 1639, 1640, 1645, 5723, 5724, 5726, 5727, 5729, 5730, 5732, 5735–5738, 5741–5744, 5746, 5748–5752, 5754, 5960–5963, 6012–6015, 6019, 6022–6024, 6032, 6033, 8386, 8388–8390, 8392, 8397–8400, 8403, 8405–8408, 8410, 8411, 8413–8415, 9100–9103, 9110, 9111, 9113C01, F01, F16, F17, T01-T02,
Pseudococcus cryptusM28S-02 (KU499442)MITS2-03 (KU499510)MLCOn-03 (KU499446)1022–1044, 1054–1061, 1305–1310, 1313, 1494–1508, 1513–1516, 1602, 1603, 1605, 8417–8420, 8422–8424S01
Pseudococcus viburniM28S-03 (KU499443)MITS2-04 (KU499511)MLCOn-04 (KU499447)1623, 1625–1627, 9109, 9114–9116F02-F04
Most of the samples collected in Italy were identified morphologically as P. comstocki (Table 3) and were found to display the same haplotypes as the French P. comstocki populations. At one site, mealybugs considered a priori to belong to the species P. comstocki were identified as P. viburni, with haplotypes M-28S-3, M-ITS-4 and M-LCO-4. In Syria, all the mealybugs initially collected as P. comstocki were identified as P. cryptus, with haplotypes M-28S-2, M-ITS2-3 and M-LCO-3. In Turkey, the mealybugs were identified as P. comstocki, with the haplotypes M-28S-1, ITS2-2 and M-LCO-1. In China, the collected mealybugs were identified morphologically as P. comstocki and displayed haplotypes M-28S-1, M-ITS2-1 and M-LCO-2. The M-LCO-02 haplotype (1.7% divergence from M-LCO-01) was found only in China. Finally, in Japan, all the mealybugs collected were identified as P. comstocki, with haplotypes M-28S-1, M-ITS2-1, M-LCO-1.

Survey and characterisation of French and exotic parasitoids infesting P. comstocki

In total, 314 parasitoid sequences were obtained for P-28S, 179 for P-ITS2, 97 for P-C1 and 59 for P-LCO (Tables 4 and 5). At each site of collection, the most probable host of the characterised parasitoids was determined by identifying a number of mealybugs collected from the site concerned, by DNA sequencing or rapid PCR identification.
Table 4

Molecular and morphological characterisation of the mealybug parasitoids collected: morphological identification (the family is provided if not Encyrtidae), haplotypes at 28S, ITS2 and COI (two regions), specimen codes (best preserved slide-mounted specimens in bold).

IdentificationHaplotypesSite codesSample codes
P-28SITS2P-COIP-LCO
Anagyrus sp. nr pseudococci (sensu Triapitsyn et al. 2007)P28S-01PITS2-08-11PC1-01PLCO-02F01, F03, F04, F06, F08, F10, I02, I04, S013231, 3264–3266, 3268–3270, 3271–3275, 3737, 5809, 5811, 5820, 5833, 5848–5850, 5867, 5873–5875, 5876, 5878, 5881–5883, 5884, 5885–5887, 5900–5902, 5906–5908, 5915, 5917, 5922–5923, 5933–5935, 5945
P28S-02PITS2-14PC1-03-F01, T013215, 9138
P28S-03PITS2-12,13PC1-02-08-F013208, 3209–3214, 3224, 3225, 3226–3229, 3230, 3260
Leptomastix eponaP28S-04PITS2-01-03PC1-17,18PLCO-05F01, F04, F05, F06, F08, F103240–3242, 3243, 3245, 3246–3247, 3257, 3262–3263, 5784, 5791, 5793, 5794–5795, 5796, 5797–5798, 5815–5817, 5822, 5823, 5824, 5827, 5830–5832, 5834, 5836–5838, 5842, 5851, 5853, 5857–5858, 5879, 5880, 5898, 5903–5905, 5936, 5952
Leptomastix histrioP28S-05PITS2-04,05PC1-19-F01, F103244, 5813
Anagyrus fusciventrisP28S-06PITS2-15,16PC1-20-F01, F103232–3234, 3235, 3706–3708, 3709, 3710, 3711–3712, 3713, 3735
Leptomastix dactylopiiP28S-07---S011526, 1528–1536, 5928, 5929–5932
Clausenia purpureaP28S-08---S01, T021519, 1521–1525, 5910, 5912–5913, 5918, 5927, 8547–8548, 9428–9429
P28S-09PITS2-17,18PC1-09PLCO-03F01, J01, J023652–3653, 3664–3665, 3666–3668, 3679–3680, 3691–3693
Leptomastidea bifasciataP28S-10PITS2-23-27PC1-12-16PLCO-04F01, F043201–3203, 3205, 3207, 3216–3221, 3222, 3223, 5845–5847
P28S-11PITS2-25PC1-13PLCO-04F013204, 3206
P28S-12PITS2-23PC1-12-F013200
Acerophagus malinusP28S-13PITS2-06,07PC1-10,11PLCO-07-09F01, F12, J02, J03, T01, T023650, 3654–3658, 3659, 3660, 3361–3663, 3681–3685, 3686–3690, 9140–9151, 9154–9160, 9162–9164, 9397–9400, 9402–9413, 9422, 9431–9434
Aphelinidae sp.P28S-14PITS2-28PC1-23,24PLCO-10F043730, 3732–3733, 5783, 5786, 5792, 5860–5861, 5863–5865
Pachyneuron sp. (Pteromalidae)P28S-15PITS2-33--F105800, 5805
P28S-16---S015920
P28S-17PITS2-34--F10, S015802, 5924
P28S-18---F10, S015844, 5919, 5921
Acerophagus flavidulusP28S-19PITS2-31--F02, F07, F09, F115866, 5938, 5939–5941, 5943–5944, 5953–5954, 5955
Thysanus sp. (Signiphoridae)P28S-20PITS2-36--F105804
Acerophagus maculipennisP28S-21PITS2-32--F04, F055855–5856, 5949–5951
Cheiloneurus ceroplastisP28S-22PITS2-30PC1-21,22PLCO-06F01, F103256, 32583259, 3261, 5799, 5810, 5818
P28S-23PITS2-29--F105829, 58395840
Allotropa burrelli (Platygastridae)P28S-24PITS2-18-22-PLCO-01J01, J02, J033644–3645, 3648–3649, 3651, 3669–3673, 3674–3676, 3677–3678
PteromalidaeP28S-25S015909
AphelinidaeP28S-26--F105803
PteromalidaeP28S-27PITS2-35-F105843
P28S-28---S015911
Thomsonisca sp.P28S-29---F105828
Table 5

Sequence Genbank accession number for each haplotype found with the markers P-28S, P-ITS2, P-C1 and P-ITS2.

P-28SP-ITS2P-C1P-LCO
P28S-01KU499412PITS2-01KU499472PC1-01KU499448PLCO-01KU499514
P28S-02KU499413PITS2-02KU499473PC1-02KU499449PLCO-02KU499515
P28S-03KU499414PITS2-03KU499474PC1-03KU499450PLCO-03KU499516
P28S-04KU499415PITS2-04KU499475PC1-04KU499451PLCO-04KU499517
P28S-05KU499416PITS2-05KU499476PC1-05KU499452PLCO-05KU499518
P28S-06KU499417PITS2-06KU499477PC1-06KU499453PLCO-06KU499519
P28S-07KU499418PITS2-07KU499478PC1-07KU499454PLCO-07KU499520
P28S-08KU499419PITS2-08KU499479PC1-08KU499455PLCO-08KU499521
P28S-09KU499420PITS2-09KU499480PC1-09KU499456PLCO-09KU499522
P28S-10KU499421PITS2-10KU499481PC1-10KU499457PLCO-10KU499523
P28S-11KU499422PITS2-11KU499482PC1-11KU499458
P28S-12KU499423PITS2-12KU499483PC1-12KU499459
P28S-13KU499424PITS2-13KU499484PC1-13KU499460
P28S-14KU499425PITS2-14KU499485PC1-14KU499461
P28S-15KU499426PITS2-15KU499486PC1-15KU499462
P28S-16KU499427PITS2-16KU499487PC1-16KU499463
P28S-17KU499428PITS2-17KU499488PC1-17KU499464
P28S-18KU499429PITS2-18KU499489PC1-18KU499465
P28S-19KU499430PITS2-19KU499490PC1-19KU499466
P28S-20KU499431PITS2-20KU499491PC1-20KU499467
P28S-21KU499432PITS2-21KU499492PC1-21KU499468
P28S-22KU499433PITS2-22KU499493PC1-22KU499469
P28S-23KU499434PITS2-23KU499494PC1-23KU499470
P28S-24KU499435PITS2-24KU499495PC1-24KU499471
P28S-25KU499436PITS2-25KU499496
P28S-26KU499437PITS2-26KU499497
P28S-27KU499438PITS2-27KU499498
P28S-28KU499439PITS2-28KU499499
P28S-29KU499440PITS2-29KU499500
PITS2-30KU499501
PITS2-31KU499502
PITS2-32KU499503
PITS2-33KU499504
PITS2-34KU499505
PITS2-35KU499506
PITS2-36KU499507
On the basis of these mealybug identification data, the parasitoids identified were sorted into three categories: (i) parasitoids collected from sites at which only P. comstocki was detected, (ii) parasitoids collected from sites at which P. comstocki and other mealybug species were detected, and (iii) parasitoids collected from sites at which only other mealybug species were detected. In France, at the sites at which only P. comstocki was observed, six parasitoid taxa of Encyrtidae were identified: Anagyrus nr pseudococci (sensu Triapitsyn et al., 2007) (P-28S-01 to P-28S-03, P-C1-02 to P-C1-08, P-ITS2-08/09, P-ITS2-12 to P-ITS2-14, P-LCO-02/11), Leptomastix epona (Walker) (P-28S-04, P-C1-17/18, P-ITS2-01 to P-ITS2-03, P-LCO-05), Anagyrus fusciventris (Girault) (P-28S-06, P-C1-20, P-ITS2-15/16), Clausenia purpurea Ishii (P-28S-09, P-C1-09, P-ITS2-17, P-LCO-03), Leptomastidea bifasciata (Mayr) (P-28S-10 to P-28S-12, P-C1-12 to P-C1-16, P-ITS2-23 to P-ITS2-27, P-LCO-04), Acerophagus malinus (Gahan) (P-28S-13, P-C1-11, P-ITS2-07, P-LCO-09). A number of other taxa could not be identified with confidence by morphological examination. Two specimens assigned to the species Leptomastix histrio (Förster) (P-28S-05, P-C1-19, P-ITS2-04/05) (Hymenoptera: Encyrtidae) were collected, but both were male, making it impossible to be sure about this identification. The hyperparasitoid Cheiloneurus ceroplastis Ishii (Hymenoptera: Encyrtidae) was probably present (haplotypes P-28S-22 and P-28S-23, P-C1-21/22, P-ITS-29/30, P-LCO-06). An unidentified member of the Aphelinidae, possibly from the genus Coccophagus, was characterised for 28S only (P-28S-26). An unidentified member of the Signiphoridae (P-28S-20, P-ITS2-36) was also collected. A set of probable Pteromalidae hyperparasitoids of the genus Pachyneuron, which may contain several species, was also found (P-28S-15/17/18/27; P-ITS2-33 to P-ITS2-35). Finally, one specimen of Thomsonisca sp. was collected (P-28S-29). In France, at sites at which both P. comstocki and P. viburni were observed, fixe Encyrtidae taxa were identified: A. nr pseudococci (P-28S-01, P-ITS2-08), Leptomastix epona (P-28S-04, P-ITS2-01, P-ITS2-02), Acerophagus flavidulus (Brèthes) (P-28S-19, P-ITS2-31), Acerophagus maculipennis (Mercet) (P-28S-21, P-ITS2-32), Leptomastidea bifasciata (Mayr) (P-28S10, P-ITS2-26). An unidentified member of the Aphelinidae was also recorded (P-28S-14, P-C1-23/24, P-ITS2-28, P-LCO-10). In Italy, at sites from which only P. comstocki was collected, the only identified taxon was Anagyrus nr pseudococci (P-28S-01, P-C1-01, P-ITS2-08 to P-ITS2-11, P-LCO-02). In Japan, where only P. comstocki was detected at the collection sites, three taxa were observed: Clausenia purpurea (P-28S-09, P-C1-09, P-ITS2-17/18 and P-LCO-03), Acerophagus malinus (P-28S-13, P-C1-10, P-ITS-06 and P-LCO-08) and Allotropa burrelli Muesebeck (P-28S-24, P-ITS2-18 to P-ITS2-22, P-LCO-01). In Turkey, P. comstocki was the only species found at the collection sites and three species of parasitoids were identified: Anagyrus nr pseudococci (haplotype P-28S-02), Clausenia purpurea (haplotype P-28S-08) and Acerophagus malinus (P-28S-13, P-LCO-07) (Hymenoptera: Encyrtidae). In Syria, where no P. comstocki was detected, three parasitoid taxa were observed: Anagyrus nr pseudococci (displaying the haplotype P-28S-01), Leptomastix dactylopii (P-28S-07) and Clausenia purpurea (P-28S-08) (Hymenoptera: Encyrtidae). A group of specimens could not be identified accurately but probably corresponded to pteromalid hyperparasitoids of the genus Pachyneuron (P-28S-16 to P-28S-18, P-28S-25/28). In China, no parasitoids were detected at the collection site studied.

Discussion

Overview of the outcomes of the parasitoid research

The molecular and morphological identification results provided useful information for guiding the decisions made in the biological control programme. In 2009, after a two-year survey in France, no parasitoid species known to be specialist on P. comstocki had been recorded in apple orchards. This triggered the decision to look for exotic parasitoids attacking P. comstocki. The mealybug identification obtained from Syria (P. cryptus) in 2009 led us to discard Syria as a source country for the importation of a natural enemy. The parasitisation of Syrian P. cryptus by Clausenia purpurea, a species also used for the biological control of P. comstocki, also led us to avoid using this parasitoid in the biological control programme. This finding confirmed published observations of C. purpurea parasitising several species of mealybugs [33, 34]. In 2010, DNA sequence data from the samples collected in China, revealing the presence of a taxon very closely related to but which maybe different from P. comstocki, led us to discard the Chinese site as a source of natural enemies for importation. This same year, genetically similar populations of the specialist parasitoid A. malinus were collected and imported from Japan and unexpectedly collected from ornamental trees in France. We thus decided to start an augmentation programme, making use of the A. malinus populations already present in France, to avoid the risks associated with the use of exotic material. C. purpurea was also collected in Japan and France (from ornamental Morus spp. only) in 2010. However, the 28S haplotype of these C. purpurea specimens (P28S-09) was slightly different from that of the C. purpurea from P. cryptus in Syria (P28S-08). It therefore remains unclear whether these two taxa are actually the same species. We maintained our decision to exclude this species, which may not be a specialist, from the programme. Again in 2010, populations of Allotropa burrelli, known to be a specialist parasitoid of P. comstocki, were sampled in Japan from P. comstocki populations apparently similar to the French P. comstocki populations. A. burrelli was not detected in the survey performed in France or, more generally, in Western Europe. We therefore decided to introduce this species in the framework of a classical biological control programme. Releases were performed in 2014 and 2015 in Southern France. At the time of the writing of this article, the outcomes of the programme are not known yet. The complementary sampling carried out in eastern Turkey in 2011 did not identify any new biocontrol agent candidates and, therefore, did not modify our strategy. Instead, the data for the specimens collected revealed the presence of Clausenia purpurea of the same haplotype (P28S-08) as the C. purpurea collected from P. cryptus in Syria. This provides further support for the hypothesis that C. purpurea is not a specialist parasitoid of P. comstocki, instead being able to parasitise two closely related species, P. comstocki and P. cryptus, in natural conditions.

Production of data on Pseudococcus parasitoids

In addition to the data used to design the biological control programme for French populations of P. comstocki, this study generated data concerning the biodiversity of parasitoids of Pseudococcus species from various regions of the world. In particular, the DNA data provided insight into the host ranges of several parasitoid species. For example, they revealed that P. comstocki and P. viburni were hosts of Anagyrus nr pseudococci [35], which had previously been collected mainly on Planococcus species. The study also provided molecular data for the Leptomastix epona populations repeatedly found at sites at which P. comstocki was likely the only mealybug present (based on mealybug PCR identification results). This material will be used for a thorough revision of the L. epona group of Leptomastix, including the species L. algirica Trjapitzin and L. flava Mercet, which may be synonymous, a possibility that should be tested by assessing their interfecundity, as suggested by Anga and Noyes (1999). Our results also suggest that, regardless of its massive introduction into the surveyed region between 2003 and 2006, A. flavidulus likely does not parasitise P. comstocki. Indeed, this parasitoid was collected only from sites at which P. viburni was recorded (regardless of the occurrence of P. comstocki). Finally, specimens of a range of parasitoid species (from the families Aphelinidae, Encyrtidae, Pteromalidae and Signiphoridae) were occasionally collected. However their low frequency suggests that some of them might have emerged from other hosts located on the plant material brought to the laboratory with the mealybugs. As a consequence, no emphasis was placed on the identification of these specimens.

Added value of the molecular identification methods

Our consortium benefited from the expertise of taxonomists specialising in the Pseudococcidae (J-F Germain) and their parasitoids (G Delvare and E. Guerrieri), who were able to provide us rapidly with accurate identifications. The use of molecular tools may therefore have been less crucial than in most biological control programmes. Nevertheless, the use of molecular tools was highly advantageous to the programme. Firstly, the molecular data facilitated the choice of relevant material for examination and the sharing of complementary information (sequence haplotypes versus morphological characters), leading to particularly fruitful collaborations. In total, 145 of the 314 specimens for which DNA sequences were obtained were sent for morphological identification, and comparisons of morphological and molecular data greatly increased the reliability of both types of data (Fig 1).
Fig 1

Neighbour-joining tree of 28S haplotypes of Encyrtidae parasitoids (Allotropa burrelli, Platygastridae, is used as an outgroup) subjected to morphological examination.

Black dots indicate a discrepancy between the molecular and morphological results. Rectangles indicate that the morphological identification, although compatible with the molecular identification, was not conclusive, because the insect was not well preserved or was not of the appropriate sex for identification with the key. The neighbour-joining tree is based on the number of differences. Branch support was calculated by bootstrapping (10,000 iterations).

Neighbour-joining tree of 28S haplotypes of Encyrtidae parasitoids (Allotropa burrelli, Platygastridae, is used as an outgroup) subjected to morphological examination.

Black dots indicate a discrepancy between the molecular and morphological results. Rectangles indicate that the morphological identification, although compatible with the molecular identification, was not conclusive, because the insect was not well preserved or was not of the appropriate sex for identification with the key. The neighbour-joining tree is based on the number of differences. Branch support was calculated by bootstrapping (10,000 iterations). Secondly, molecular data ensured that identifications were consistent despite the heterogeneity of the material to be identified, in terms of both sample conservation state and development stage. Indeed, it would not have been possible to identify most of the material purely by morphological methods. We estimate that only about 25% of the material collected was suitable for morphological identification. Moreover, even among the specimens selected for morphological identification after DNA sequencing, 24 of the 142 specimens could not be identified and two identifications were inconsistent with the molecular analysis. These difficulties reflect the fact that most of the taxonomic keys for mealybugs and their parasitoids were generally developed for a single sex at a single developmental stage, and an absence of any body parts (legs, antennae) can be problematic. Thirdly, molecular characterisation ensured that identification was repeatable throughout the programme, providing reliable and consistent identifications on which the team could base their decisions. For example, C. purpurea and A. nr pseudococci, which were found at many sites and displayed morphological variability, would have been very difficult to identify in the absence of sequence data revealing similarities and differences between the populations. From a population genetics standpoint, the type of DNA data generated in this study cannot distinguish unambiguously between polymorphic populations within a single species and very closely related taxa (host races, sibling species, etc.). Populations displaying identical haplotypes at several loci cannot therefore necessarily be considered to belong to the same species. However, in practical terms, the probability of such populations being reproductively isolated species with high levels of divergence appears to be low. The data obtained in this study therefore made it easier to take some difficult decisions, such as the decision to rule out C. purpurea as a specialist candidate biocontrol agent because populations with identical haplotypes were found to parasitize several host species. Finally, the availability of DNA barcodes for most of the biological material collected made it possible to comply with the requirements of the French government regarding the importation and use of exotic biological material. In particular, the existence of multilocus DNA data for A. burrelli populations facilitated the obtainment of authorisation for importation from French government services.
  8 in total

1.  Molecular and morphological characterisation of Pseudococcidae surveyed on crops and ornamental plants in Spain.

Authors:  A Beltrà; A Soto; T Malausa
Journal:  Bull Entomol Res       Date:  2011-10-10       Impact factor: 1.750

2.  MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0.

Authors:  Koichiro Tamura; Joel Dudley; Masatoshi Nei; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2007-05-07       Impact factor: 16.240

3.  A molecular phylogeny of the Aphidiinae (Hymenoptera: Braconidae).

Authors:  R Belshaw; D L Quicke
Journal:  Mol Phylogenet Evol       Date:  1997-06       Impact factor: 4.286

4.  Identification of mealybug pest species (Hemiptera: Pseudococcidae) in Egypt and France, using a DNA barcoding approach.

Authors:  S Abd-Rabou; H Shalaby; J-F Germain; N Ris; P Kreiter; T Malausa
Journal:  Bull Entomol Res       Date:  2012-02-24       Impact factor: 1.750

5.  Molecular and morphological characterization of mealybugs (Hemiptera: Pseudococcidae) from Chilean vineyards.

Authors:  M C G Correa; J-F Germain; T Malausa; T Zaviezo
Journal:  Bull Entomol Res       Date:  2012-02-24       Impact factor: 1.750

6.  Identification and characterization of a new vitivirus from grapevine.

Authors:  Ryoji Nakaune; Satoshi Toda; Masatoshi Mochizuki; Masaaki Nakano
Journal:  Arch Virol       Date:  2008-09-11       Impact factor: 2.574

7.  DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

Authors:  O Folmer; M Black; W Hoeh; R Lutz; R Vrijenhoek
Journal:  Mol Mar Biol Biotechnol       Date:  1994-10

8.  Species-wide homogeneity of nuclear ribosomal ITS2 sequences in the spider mite Tetranychus urticae contrasts with extensive mitochondrial COI polymorphism.

Authors:  M Navajas; J Lagnel; J Gutierrez; P Boursot
Journal:  Heredity (Edinb)       Date:  1998-06       Impact factor: 3.821

  8 in total
  4 in total

1.  Natural enemies of armored scales (Hemiptera: Diaspididae) and soft scales (Hemiptera: Coccidae) in Chile: Molecular and morphological identification.

Authors:  Paul Amouroux; Didier Crochard; Margarita Correa; Géraldine Groussier; Philippe Kreiter; Carola Roman; Emilio Guerrieri; Antonio Garonna; Thibaut Malausa; Tania Zaviezo
Journal:  PLoS One       Date:  2019-03-18       Impact factor: 3.240

2.  Investigating the Parasitoid Community Associated with the Invasive Mealybug Phenacoccus solenopsis in Southern China.

Authors:  Hua-Yan Chen; Hong-Liang Li; Hong Pang; Chao-Dong Zhu; Yan-Zhou Zhang
Journal:  Insects       Date:  2021-03-26       Impact factor: 2.769

3.  Pest categorisation of Pseudococcus cryptus.

Authors:  Claude Bragard; Paula Baptista; Elisavet Chatzivassiliou; Francesco Di Serio; Paolo Gonthier; Josep Anton Jaques Miret; Annemarie Fejer Justesen; Christer Sven Magnusson; Panagiotis Milonas; Juan A Navas-Cortes; Stephen Parnell; Roel Potting; Philippe Lucien Reignault; Emilio Stefani; Hans-Hermann Thulke; Wopke Van der Werf; Antonio Vicent Civera; Jonathan Yuen; Lucia Zappalà; Jean-Claude Grégoire; Chris Malumphy; Spyridon Antonatos; Virag Kertesz; Andrea Maiorano; Dimitrios Papachristos; Alan MacLeod
Journal:  EFSA J       Date:  2022-03-07

4.  Old Parasitoids for New Mealybugs: Host Location Behavior and Parasitization Efficacy of Anagyrus vladimiri on Pseudococcus comstocki.

Authors:  Renato Ricciardi; Valeria Zeni; Davide Michelotti; Filippo Di Giovanni; Francesca Cosci; Angelo Canale; Lian-Sheng Zang; Andrea Lucchi; Giovanni Benelli
Journal:  Insects       Date:  2021-03-18       Impact factor: 2.769

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.