Literature DB >> 27350987

Molecular Typing of Hospital-Acquired Staphylococcus aureus Isolated from Isfahan, Iran.

Seyed Asghar Havaei1, Fahimeh Ghanbari2, Ali Asghar Rastegari3, Amir Azimian4, Farzad Khademi5, Nafiseh Hosseini1, Amirmorteza Ebrahimzadeh Namvar1, Hamid Vaez1, Seyed Mehdi Havaei6, Mojtaba Shahin7.   

Abstract

Background. Staphylococcus aureus (S. aureus) is one of the most common pathogens that cause hospital- and community-acquired infections in the world. The use of molecular typing methods is essential for determining the origin of the strains, their clonal relations, and also in epidemiological investigations. The purpose of this study was to determine the prevalence of antibiotic resistant S. aureus isolates and using spa, agr, and SCCmec typing to determine the dominant types in Iran. Material and Method. Fifty isolates of S. aureus were collected from January to May 2010. S. aureus identification was performed by biochemical tests. Disk diffusion method was employed to assess the sensitivity of S. aureus strains to antibiotics and then genetic analysis of bacteria was performed using SCCmec, agr, and spa typing. Results. S. aureus resistance to tetracycline, cefoxitin, clindamycin, ciprofloxacin, gentamicin, Cot: cotrimoxazole, levofloxacin, rifampin, and vancomycin were found to be 36%, 18%, 12%, 12%, 22%, 6%, 6%, and 0%, respectively. The results of this study showed that 16% of the isolates were resistant to methicillin (MRSA) and the majority of isolates were SSC mec type IV. In addition spa and agr typing revealed agr typeI and spa type t7688 to be the most predominant. Conclusion. In this study, spa typing showed 100% reliability and the t7688 spa type had a frequency of 26% compared to the frequency of 0.0% in the Ridom SpaServer. The frequency of t304 spa type was higher than the global average.

Entities:  

Year:  2014        PMID: 27350987      PMCID: PMC4897504          DOI: 10.1155/2014/185272

Source DB:  PubMed          Journal:  Int Sch Res Notices        ISSN: 2356-7872


1. Introduction

Staphylococcus aureus (S. aureus) is one of the most prevalent pathogens that cause both community and nosocomial acquired infections and can produce a wide variety of diseases from skin surface infections, such as folliculitis and furunculosis, to life threating conditions, such as endocarditis, pneumonia, and septicemia [1-3]. The expression of many virulence factors in S. aureus is under control of the agr system and to date four major agr types in S. aureus have been recognized [4, 5]. Resistance to methicillin is due to mecA gene that is part of the staphylococcal cassette chromosome. This gene encodes the protein PBP2A (protein binding to penicillin) that inhibits the action of β-lactam antibiotics. SCCmec elements have been classified into eight different types (I–VIII) and some of them are divided further into subtypes [6, 7]. The increasing antibiotic resistance in this bacterium is a major concern that underlines the importance of the use of efficient typing methods for monitoring and limiting the spread of epidemic clones between hospitals [1, 8, 9]. Of the various molecular methods, PFGE, due to its high differentiation potential, was considered the gold standard for strain typing of S. aureus. However since it is time consuming, expensive, complicated, and difficult to standardize among different laboratories, DNA sequence-based methods have become increasingly popular during the recent years [10, 11]. Genetic analysis of strain types of S. aureus can be performed by spa sequence typing. The spa gene (approximately 2150 bp) is composed of three regions, namely, the fc protein, the x region, and the c terminal. The spa typing is based on sequencing of the polymorphic x region of protein A and depends on PCR amplification of this hypervariable region. The x region is composed of a variable number of 24 base pair repeats which may differ by spontaneous mutation or deletion and duplication of the repeats. Each repeat is attributed to one alpha-numerical code and the spa type is derived from the order of specific repeats [12-14]. It can be useful in describing the natural population of S. aureus strains as well as in outbreak investigations. However sometimes similar or related spa types are located in different clonal lineage which limits the discriminating power of this method [8]. The purpose of this study was to determine the prevalence of antibiotic resistant S. aureus isolates and the use of spa, agr, and SCCmec typing to determine the dominant types in Iran.

2. Material and Method

Fifty isolates of S. aureus were collected from clinical samples of patients who referred to Isfahan's Alzahra hospital (Iran) from January to May 2010. These isolates were obtained from different clinical sources including wound, blood, urine, and sputum. S. aureus identification was performed by standard tests including gram staining, catalase, DNase, mannitol fermentation, slide, and tube coagulase. Thereafter they were classified as community-acquired (CA-MRSA) or hospital-acquired (HA-MRSA) based on the patients recorded data.

2.1. Susceptibility Test

The susceptibility of S. aureus isolates to antimicrobial agents was determined by the disk diffusion method according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI) [15]. The antibiotics utilized were as follows: vancomycin, tetracycline, gentamicin, clindamycin, ciprofloxacin, rifampin, cefoxitin, levofloxacin, and cotrimoxazol. S. aureus strain ATCC25923 was used as a control strain for the quality control of antibiotic susceptibility testing.

2.2. Molecular Detection of mecA Gene

DNA extraction was performed from all isolates using Fermentas DNA kit in accordance with the manufacturer's protocol. PCR was performed for the detection of mecA gene using primers displayed in Table 1. PCR conditions were as follows: initial denaturation, 94°C for 5 min, 40 cycles of denaturation at 94°C for 30 s, annealing at 57°C for 45 s, and extension at 72°C for 30 s and final extension at 72°C for 5 min.
Table 1

Primers used in this study.

TargetPrimerSequenceProduct size (bp)Reference
mecAFAAAATCGATGGTAAAGGTTGGC533 [2]
RAGTTCTGCAGTACCGGATTTG

SCCmec βFATTGCCTTGATAATAGCCYTCT937 [3]
α3RTAAAGGCATCAATGCACAAACACT
ccrCFCGTCTATTACAAGATGTTAAGGATAAT
ccrCRCCTTTATAGACTGGATTATTCAAAATAT518
1272F1GCCACTCATAACATATGGAA
1272R1CATCCGAGTGAAACCCAAA1415
5RmecATATACCAAACCCGACAACTAC
5R431CGGCTACAGTGATAACATCC359

AgrPanFATGCACATGGTGCACATGC [20]
RI GTCACAAGTACTATAAGCTGCGAT439
RII GTATTACTAATTGAAAAGTGCCATAGC572
RIII CTGTTGAAAAAGTCAACTAAAAGCTC406
RI V CGATAATGCCGTAATACCCG659

Spa1113FTAAAGACGATCCTTCGGTGAGCVariable [22]
1514RCAGCAGTAGTGCCGTTTGCTT

2.3. Multiplex PCR for SCCmec and Agr Typing

SCCmec typing for 9 isolates resistant to methicillin (MRSA) was determined by multiplex PCR method. Primers shown in Table 1 were used for this purpose. The PCR protocol comprised an initial denaturation step at 94°C for 4 min followed by 30 cycles of denaturation at 94°C for 30 s, annealing step at 55°C for 30 s, and extension at 72°C for 60 s and a final extension step at 72°C for 4 min. Agr typing was also performed on all isolates of S. aureus using primers shown in Table 1. PCR conditions were as follows: initial denaturation at 94°C for 5 min followed by 40 cycles of denaturation at 94°C for 40 s, annealing at 60°C for 40 s, and extension at 72°C for 60 s and a final extension at 72°C for 5 min.

2.4. Spa Typing

The polymorphic X region of the spa gene was amplified from all S. aureus isolates using the spa primers exhibited in Table 1. All sequencing reactions were performed at Bioneer (Korea) and then the data were analyzed using MEGA 4 software. Finally, spa types were assigned by Ridom <span class="Gene">SpaServer (http://spaserver.ridom.de) [12].

3. Results

In the present study, from January to May 2010, 50 isolates of S. aureus from various clinical specimens including wound (38%), septicemia (26%), UTI (18%), pneumonia (10%), and others (2%) were collected from Alzahra Hospital in Isfahan. In this study, antimicrobial susceptibility tests were performed by disk diffusion method. S. aureus resistance to tetracycline, cotrimoxazol, cefoxitin, clindamycin, ciprofloxacin, gentamicin, levofloxacin, rifampin, and vancomycin was 36%, 22%, 18%, 12%, 12%, 10%, 6%, 6%, and 0%, respectively. In our study, presence of mecA gene in all isolates were evaluated by susceptibility test and then confirmed by PCR. Of the 50 S. aureus isolates, 8 (16%) were MRSA and mecA positive. To determine the type of MRSA isolates, SCCmec typing was performed in which 4 (44.4%) were found to be SCCmec type IV, 2 (22.2%) were SCCmec type III, and 2 (22.2%) were SCCmec type I. Agr typing results revealed that 45 (90%) isolates were agr type I, 2 (4%) were agr type III, and 3 (6%) were nontypeable. Ultimately, typing of 50 isolates of S. aureus was performed using spa typing method. Genotyping of spa gene revealed 22 different spa types with Spa type t7688 (26%) being the most frequent and other types with the following frequencies: t304 (10%), t037 (8%), t005 (8%), t230 (8%), t024 (6%), and t4892 (4%). Spa types including t352, t8015, t937, t138, t436, t439, t045, t2790, t084, t1741, t267, t021, t7685, t5005, and t275 were found only once among the isolates (Table 2).
Table 2

Correlation between the different molecular typing methods.

StrainSample spa type agr type mecA gene Sccmec typePVL gene1 Antimicrobialresistance2, 3
1 Woundt230I
2Septicemiat230I+
3Septicemiat024I
4Septicemiat304Itet
5Urinet304Itet
6Woundt4892I+cot
7Woundt024I
8Woundt304I
9CSFt2790I
10Woundt304I+tet
11Woundt024I+
12Woundt7688I+tet
13Bloodt045I+
14Sputumt005I+IV+cx
15Bloodt7688I
16Urinet439I
17Woundt7688Icx
18Woundt005I+Icx
19Urinet7688I
20Woundt7688I+
21Bloodt7688I
22Bloodt7688I
23Woundt7688I
24Woundt7688I+
25Urinet7688I
26Woundt230I
27Bloodt230I
28Sputumt005I
29Woundt7688I
30Woundt7688I+
31CSFt7688I
32Sputumt4892I
33Urinet304I+Icx
34Woundt138I+III+cx, cot
35Woundt037I+IIICip, gen, cd, tet, le, rif, cx, cot
36Perituent037III+IVCip, gen, cd, tet, le, cx, cot
37Urinet937ICip, gen, cd, tet, le
38Woundt436I gen, cd, tet, cx
39Woundt8015III gen, cd, tet, cx
40Abscesst037I+IVCip, gen, cd, tet, rif, cx, cot
41Bloodt352I tet, rif, cx
42Sputumt084Itet, cot
43Urinet1741tet
44Sputumt005I
45Woundt037Itet, cot
46Bloodt267ICip, tet, cot
47Urinet021tet
48Bloodt7685ICip, tet
49Bloodt5005Itet
50Woundt275I

1PVL: Panton-Valentine Leukocidin.

2Oxa: oxacillin, Lev: levofloxacin, Cip: ciprofloxacin, Tet: tetracycline, Cot: cotrimoxazole, Gen: gentamycin, Cli: clindamycin, Rif: rifampicin.

3No resistance was observed for vancomycin and minocycline.

4. Discussion

S. aureus, particularly methicillin-resistant Staphylococcus aureus (MRSA), is one of the most common causes of infection both in the community and in hospitals. Due to its diverse pathogenicity and high antibiotic resistance, drug therapy has been problematic causing great burdens for patients and healthcare providers. Molecular typing of this bacterium is therefore essential to determine the origin of the strains, its clonal relations, and for epidemiological investigations, playing an important role in the prevention and treatment of infections [16]. In this study, we investigated the antibiotic resistance of S. aureus to tetracycline, cefoxitin, clindamycin, ciprofloxacin, gentamycin, cotrimoxazol, levofloxacin, rifampin, and vancomycin using disk diffusion method. Resistance of S. aureus to antibiotics was as follows: tetracycline 36%, cefoxitin 18%, clindamycin and ciprofloxacin 12%, gentamicin 10%, cotrimoxazol 22%, levofloxacin and rifampin 6%, and 0% to vancomycin. Resistance rates found in this study were lower than the global average [5, 17, 18]. Several different phenotypic and genotypic methods can be employed for classifying strains used in epidemiological investigations, and for detection and monitoring nosocomial outbreaks. In the current study, we used SCCmec, agr, and spa typing for this purpose [18, 19]. Our results revealed that 16% of the isolates were MRSA and mecA positive. MRSA classification requires a thorough understanding of their genetic structure as well as detection of all SCCmec types and carriers of the mecA gene. SCCmec typing provides important information about the movable genetic components responsible for resistance to methicillin and it is a marker for differentiation between HA-MRSA and CA-MRSA strains [6, 9, 19]. SCCmec typing was performed on MRSA isolates in which 4 (44.4%) were SCCmec type IV (2 of them were related to t037 spa type and agr types I and III, and the other two isolates were t325 and t005 spa types and agr type I), 2 (22.2%) were SCCmec type III (related to t037 and t138 spa types and agr type I), and 2 (22.2%) were SCCmec type I (related to t005 and t304 spa types and agr type I). The high frequency of SCCmec types IV compared to other SCCmec types may be due to their small size that facilitates their spread among S. aureus strains [6]. In our study, 3 isolates with SCCmec type IV belonged to HA-MRSA, whereas types IV and V were shown to belong to CA-MRSA. As expected, in this study we have shown 4 isolates related to SCCmec I and III which belong to HA-MRSA [9]. Similar results were shown by Vindel et al. [17]. In agreement with previous reports from Iran, the majority 45(90%) of the isolates were agr I, 3 (6%) were agr III, and 2 (4%) were nontypeable [4, 5] Similar to many previous studies, the agr type IV was absent in our study [2, 20]. Spa typing is an effective molecular typing technique based on sequencing of only single locus of S. aureus and has advantages such as rapidity, ease, and convenience of interpreting the results and exchangeability of results among laboratories and creates a global database based on spa typing for national and international control of S. aureus. The use of spa typing in our study revealed 22 different spa types where Spa type t7688 (26%) was the most frequent followed by Spa type t304. Its global prevalence has been shown to be 0.32% in different countries including Austria, Belgium, Canada, Denmark, Finland, France, Gabon, Germany, Iceland, Sweden, Switzerland, United Arab Emirates, United Kingdom, United States, Lebanon, Netherlands, Norway, South Africa, and Spain (http://spaserver.ridom.de), whereas the frequency of this type was higher (10%) in our study. In addition the frequency of spa t304 has been found to be higher than that reported in previous studies in Iran [21]. Spa types t037, t005, and t230 have been isolated from different parts of the world [1, 8, 21]. However, in our study each one was 8% and Spa types t024 and t4892 were 6% and 4%, respectively. Other spa types including t325, t267, t021, t275, t7685, t045, t005, t439, t138, t937, t436, t8015, t325, t084, t1741, and t5005 were found only once among the isolates. In a study by Wiśniewska et al. the prevalent spa types in Poland were reported to be t003, t151, and t008 [9]. Neela et al. showed that Spa type t037 and SCCmecIII were prevalent in Malaysia [22]. Tokajian et al. found Spa types t044 and t037 and SCCmec IV as the prevalent types in Lebanon [18]. The use of molecular typing in Spain revealed Spa types t067 and t002, agr II, and SCCmec IV to be dominant [17]. In a study conducted by Emaneini et al. Spa type t7685 was shown to be prevalent in Iran [21]. There seems to be a geographical difference in the distribution of various spa types.

5. Conclusion

Overall in the current study, spa typing showed 100% type ability. An interesting point to note was the dominance of Spa type t7688 which has been only reported from Iran to date. Moreover the spa types of t084 and t037 are associated with the top ten spa types worldwide between MRSA and MSSA isolates in which t037 is one of the prevalent types in Asian countries. It is our understanding that the current results will aid in the characterization of S. aureus in neighboring countries. We suggest the use of additional typing methods such as BURP and MLST to overcome the limitation of a single locus-based molecular typing (spa typing).
  21 in total

1.  Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting by using novel software for spa repeat determination and database management.

Authors:  Dag Harmsen; Heike Claus; Wolfgang Witte; Jörg Rothgänger; Hermann Claus; Doris Turnwald; Ulrich Vogel
Journal:  J Clin Microbiol       Date:  2003-12       Impact factor: 5.948

2.  Genotyping of methicillin-resistant Staphylococcus aureus strains from two hospitals in Bangalore, South India.

Authors:  Gayathri Arakere; Savitha Nadig; Göte Swedberg; Ragini Macaden; Satish K Amarnath; Dasarathy Raghunath
Journal:  J Clin Microbiol       Date:  2005-07       Impact factor: 5.948

3.  A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V.

Authors:  K Boye; M D Bartels; I S Andersen; J A Møller; H Westh
Journal:  Clin Microbiol Infect       Date:  2007-04-02       Impact factor: 8.067

4.  Evaluation of molecular typing methods in characterizing a European collection of epidemic methicillin-resistant Staphylococcus aureus strains: the HARMONY collection.

Authors:  Barry D Cookson; D Ashley Robinson; Alastair B Monk; Stephen Murchan; Ariane Deplano; Rafaël de Ryck; Marc J Struelens; Christina Scheel; Vivian Fussing; Saara Salmenlinna; Jaana Vuopio-Varkila; Christina Cuny; Wolfgang Witte; Panayotis T Tassios; Nikolas J Legakis; Willem van Leeuwen; Alex van Belkum; Anna Vindel; Javier Garaizar; Sara Haeggman; Barbro Olsson-Liljequist; Ulrika Ransjo; Manica Muller-Premru; Waleria Hryniewicz; Angela Rossney; Brian O'Connell; Benjamin D Short; Jonathan Thomas; Simon O'Hanlon; Mark C Enright
Journal:  J Clin Microbiol       Date:  2007-04-11       Impact factor: 5.948

5.  The use of spa and phage typing for characterization of a MRSA population in a Belgian hospital: comparison between 2002 and 2007.

Authors:  C Wildemauwe; D De Brouwer; C Godard; P Buyssens; J Dewit; R Joseph; R Vanhoof
Journal:  Pathol Biol (Paris)       Date:  2009-10-24

6.  spa typing of methicillin-resistant Staphylococcus aureus isolated from domestic animals and veterinary staff in the UK and Ireland.

Authors:  Arshnee Moodley; Marc Stegger; Arzu F Bagcigil; Keith E Baptiste; Anette Loeffler; David H Lloyd; Nicola J Williams; Nola Leonard; Yvonne Abbott; Robert Skov; Luca Guardabassi
Journal:  J Antimicrob Chemother       Date:  2006-10-09       Impact factor: 5.790

7.  Characterization of Staphylococcus aureus isolates with a partial or complete absence of staphylococcal cassette chromosome elements.

Authors:  Henry Wong; Lisa Louie; Reggie Y C Lo; Andrew E Simor
Journal:  J Clin Microbiol       Date:  2010-07-28       Impact factor: 5.948

8.  spa Typing of Staphylococcus aureus as a frontline tool in epidemiological typing.

Authors:  B Strommenger; C Braulke; D Heuck; C Schmidt; B Pasemann; U Nübel; W Witte
Journal:  J Clin Microbiol       Date:  2007-11-21       Impact factor: 5.948

9.  Methicillin-resistant Staphylococcus aureus in Spain: molecular epidemiology and utility of different typing methods.

Authors:  Ana Vindel; Oscar Cuevas; Emilia Cercenado; Carmen Marcos; Verónica Bautista; Carol Castellares; Pilar Trincado; Teresa Boquete; Maria Pérez-Vázquez; Mercedes Marín; Emilio Bouza
Journal:  J Clin Microbiol       Date:  2009-04-01       Impact factor: 5.948

10.  Occurrence of methicillin resistant Staphylococcus aureus (MRSA) among clinical samples in tehran-iran and its correlation with polymorphism of specific accessory gene regulator (AGR) groups.

Authors:  Amir Azimian; Shahin Najar-Pirayeh; Siamak Mirab-Samiee; Mahmood Naderi
Journal:  Braz J Microbiol       Date:  2012-06-01       Impact factor: 2.476

View more
  6 in total

1.  Distribution of SCCmec Elements and Presence of Panton-Valentine Leukocidin in Methicillin-Resistant Staphylococcusepidermidis Isolated from Clinical Samples in a University Hospital of Isfahan City, Iran.

Authors:  Mehrdad Halaji; Ashkan Karimi; Parisa Shoaei; Mohammadreza Nahaei; Farzin Khorvash; Behrooz Ataei; Majid Yaran; Seyed Asghar Havaei
Journal:  J Clin Diagn Res       Date:  2017-07-01

2.  Elimination of Staphylococcus aureus nasal carriage in intensive care patients lowers infection rates.

Authors:  Leila Akhtar Danesh; Zeinab Saiedi Nejad; Hossein Sarmadian; Saeed Fooladvand; Alex van Belkum; Ehsanollah Ghaznavi-Rad
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2019-11-12       Impact factor: 3.267

3.  Antimicrobial resistance and genotyping of Staphylococcus aureus obtained from food animals in Sichuan Province, China.

Authors:  Ting Gan; Gang Shu; Hualin Fu; Qigui Yan; Wei Zhang; Huaqiao Tang; Lizi Yin; Ling Zhao; Juchun Lin
Journal:  BMC Vet Res       Date:  2021-04-26       Impact factor: 2.741

4.  High prevalence and expression of antiseptic resistance genes among infectious t037/ST239 methicillin-resistant Staphylococcus aureus (MRSA) strains in North Khorasan Province, Iran.

Authors:  Hamed Ghasemzadeh-Moghaddam; Amir Azimian; Ghasem Bayani; Vahid Dashti; Sara Nojoomi; Nojoomi Shirazi; Akbar Solati; Alex Van Belkum
Journal:  Iran J Basic Med Sci       Date:  2022-06       Impact factor: 2.532

5.  Molecular characterization of Staphylococcus aureus strains isolated among hospital staff nasal carriers of Babol, Iran.

Authors:  Parisa Sabbagh; Amirmorteza Ebrahimzadeh-Namvar; Elaheh Ferdosi-Shahandashti; Mostafa Javanian; Soraya Khafri; Mehdi Rajabnia
Journal:  Caspian J Intern Med       Date:  2017

Review 6.  Distribution of the Most Prevalent Spa Types among Clinical Isolates of Methicillin-Resistant and -Susceptible Staphylococcus aureus around the World: A Review.

Authors:  Parisa Asadollahi; Narges Nodeh Farahani; Mehdi Mirzaii; Seyed Sajjad Khoramrooz; Alex van Belkum; Khairollah Asadollahi; Masoud Dadashi; Davood Darban-Sarokhalil
Journal:  Front Microbiol       Date:  2018-02-12       Impact factor: 5.640

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.