Literature DB >> 27347165

Effects of HCG on human epithelial ovarian cancer vasculogenic mimicry formation in vivo.

Sainan Gao1, Chao Fan1, Hua Huang2, Changlai Zhu3, Min Su1, Yuquan Zhang1.   

Abstract

Ovarian cancer is the leading cause of mortality due to gynecological malignancy, and vasculogenic mimicry (VM) formation is correlated with poor prognosis. In a previous study, the present authors observed that human chorionic gonadotropin (HCG) could promote VM formation in three-dimensional OVCAR-3 cell cultures. In order to investigate whether HCG could promote VM formation in ovarian cancer in vivo, the role of OVCAR-3 cells overexpressing or depleted of chorionic gonadotropin, beta polypeptide 5 (CGB5, which is the fifth subunit of β-HCG and was identified as the key part of HCG) were injected into nude mice in the present study, while BeWo cells were used as a positive control. The results demonstrated that overexpressed CGB5 promoted xenografts tumor formation in nude mice, and the results of hematoxylin and eosin and cluster of differentiation (CD)34-periodic acid-Schiff dual staining revealed that CGB5 promoted VM formation. Furthermore, reverse transcription-polymerase chain reaction and immunochemistry staining demonstrated that the expression of the vascular markers CD31, vascular endothelial growth factor and factor VIII was also upregulated in the CGB5-overexpressing xenografts tumors. In addition, the expression of luteinizing hormone receptor (LHR), the receptor of CGB5, was increased in CGB5-overexpressing cells. In conclusion, CGB5 may promote tumor growth and VM formation via activation of the LHR signal transduction pathway, which may support a novel strategy for ovarian cancer therapy.

Entities:  

Keywords:  beta polypeptide 5; chorionic gonadotropin; human chorionic gonadotropin; in vivo; ovarian cancer; vasculogenic mimicry

Year:  2016        PMID: 27347165      PMCID: PMC4907296          DOI: 10.3892/ol.2016.4630

Source DB:  PubMed          Journal:  Oncol Lett        ISSN: 1792-1074            Impact factor:   2.967


Introduction

Ovarian cancer is the leading cause of mortality due to gynecological malignancy in recent years (1). Although the diagnosis and treatments of ovarian cancer are constantly under development, the prognosis of the patients remains poor, which is due to the biological behavior of the tumor (2). Ovarian cancer cells are able to migrate and invade into the peritoneal/pelvic cavity. Therefore, clarification of the mechanisms of cell migration and invasion is important to identify novel therapy methods for ovarian cancer treatment. Blood supply is essential for tumors metastasis (3). Previous studies have suggested that the development of tumor microcirculation appears to be a rate-limiting step for metastasis (3–5). In 1999, Maniotis et al (6) identified a novel phenomenon in the biology of tumor vascularization known as vasculogenic mimicry (VM). VM is the unique ability of highly aggressive tumor cells, but not of poorly aggressive cells, to mimic the presence and function of endothelial cells and form matrix-rich networks de novo, which are able to convey blood plasma and red blood cells (6–8). In VM, the blood vessels wall is lined exclusively by tumor cells, without the participation of endothelial cells (9,10). As a secondary circulation system, VM has been recognized as an important form of vasculogenic structure in solid tumors, including melanoma, breast cancer, hepatocellular carcinoma, prostate cancer, clear cell renal cell carcinoma, glioblastoma, gastric adenocarcinoma, colorectal cancer and gestational choriocarcinoma (6,11–19). In ovarian cancer, VM has been correlated with poor prognosis, low survival and increased risk of cancer recurrence (6). However, the mechanisms involved in the generation of VM in ovarian cancer remain obscure. Human chorionic gonadotropin (HCG), a hormone of trophoblastic origin, was considered to be a proangiogenic factor (20). HCG increases uterine arterial blood flow and stimulates angiogenesis in the ovary by stimulating the proliferation of vascular endothelial cells and the expression of vascular endothelial growth factor (VEGF) (21–23). HCG induces neovascularization in placenta during pregnancy (24). In ovarian cancer, the HCG protein and its receptor, luteinizing hormone receptor (LHR), exhibited positive expression (25). HCG is also ‘ectopically’ expressed in numerous malignant tumors such as endometrial carcinoma and ovarian, testicular and breast cancer (26–30). A previous study by the present authors demonstrated that HCG promotes VM formation in three-dimensional cultures of OVCAR-3 cells, and anoxia could promote VM formation via activation of hypoxia-inducible factor-1 (31). Therefore, the present authors hypothesize that HCG may be important in the development of VM in ovarian cancer. To further investigate the role of chorionic gonadotropin, beta polypeptide 5 (CGB5, which is the fifth subunit of β-HCG and was identified as the key part of HCG) in ovarian cancer VM formation in vivo, a tumor formation model in vivo was constructed in the present study, and the effect of HCG binding to its receptor in VM formation was investigated in vivo. The results demonstrated the role of CGB5 in VM formation in vivo, and support a novel approach for ovarian cancer therapy.

Materials and methods

Cell lines and cell culture

The human epithelial ovarian cancer cell line OVCAR-3 and the human choriocarcinoma cell line BeWo were purchased from the American Type Culture Collection (Manassas, VA, USA). OVCAR-3 cells were cultured at 37°C and 5% CO2, in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.). BeWo cells were cultured in F-12 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 15% FBS.

CGB5 expression and small interfering RNA (siRNA) lentivirus production and infection

Human CGB complementary DNA (cDNA; accession no. NM_033043.1) was obtained from a human fetal ovary library, and subcloned into the pLenti6/entre-EGFP vector (Invitrogen; Thermo Fisher Scientific, Inc.), which led to pLenti/EGFP-CGB5. The siRNA template sequence 5′-AGCAGCAACAGCAGCAGCCTC-3′, which targeted CGB5, was constructed into the pcDNA™6.2-GW/EmGFP-miR vector (Invitrogen; Thermo Fisher Scientific, Inc.), and the construct was named pGFP-CGB5_siR. A total of 3 µg pLenti/EGFP-CGB5 vector, pGFP-CGB5_siR or pLenti6/entre-EGFP (which served as a control) and 9 µg ViraPower™ Packaging Mix (Invitrogen; Thermo Fisher Scientific, Inc.) were used to co-transfect 5×106 293FT cells (Thermo Fisher Scientific, Inc.) with Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according the manufacturer's protocol. After transfection for 48 h, the supernatant containing the lentiviruses was harvested, centrifuged and stored at −80°C. For infection, the cells were seeded at 1×105 cells/well into a 6-well plate and cultured overnight, and then lentiviruses were added. After 24 h of infection, 10 ng blastin (Invitrogen; Thermo Fisher Scientific, Inc.) was added to the cells to obtain a stable cell clone, and the cells were then sorted by flow cytometry.

Animals and experiments

BALB/c female nude mice were purchased from the laboratory animal center of the Chinese Academy of Sciences (Beijing, China). Mice that were 4–6 weeks old and had an average body weight of 18–20 g were used in the study. The experimental procedures were performed according to the standards established by the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (32). For tumor formation in vivo, 36 mice were randomly divided into 6 groups, and injected with normal OVCAR-3 cells, control vector-transfected OVCAR-3 cells, CGB5-overexpressing OVCAR-3 cells, CGB5-knockdown OVCAR-3 cells or BeWo cells (6 mice/group). Tumors were allowed to grow for 2–6 weeks after tumor inoculation, and the mice were then sacrificed by cervical decapitation. Next, tumors were subjected to histopathological examination, transmission electron microscopy observation and reverse transcription-polymerase chain reaction (RT-PCR) analysis.

Hematoxylin and eosin (H&E) staining and cluster of differentiation (CD)34-periodic acid-Schiff (PAS) dual staining

The tumor xenograft specimens were fixed in 10% neutral buffered formalin and paraffin-embedded. Paraffin-embedded specimens were cut into serial 6-µm sections to be placed on slides. The sections were rehydrated through graded alcohols into water. Endogenous peroxidase was blocked with 3% hydrogen peroxide in 50% methanol for 10 min at room temperature. Upon rehydration, the sections were washed with phosphate-buffered saline (PBS) for 15 min and then pre-treated with 0.01 mol/l citrate acid buffer (pH 6.0) for 20 min at 100°C in a microwave oven. After rinsing with PBS, slides were incubated with primary antibodies against CD34 (sc-74499, Santa Cruz Biotechnology, Inc., Dallas, TX, USA; 1:100 dilution) overnight. After washing in PBS for three times, the slides were incubated with peroxidase-conjugated donkey anti-rabbit antibody (P0448, Dako North America, Inc., Carpinteria, CA, USA; 1:100 dilution) for 30 min. The reactions were visualized with diaminobenzidine (EnVision; Dako North America, Inc.) and counterstained with hematoxylin (EnVision; Dako North America, Inc). The CD34-immunohistochemically stained sections were further stained with PAS, followed by counterstaining with hematoxylin. These double-stained sections were used for observing microvascular and VM structures. Quantification of VM was performed as follows: VM channels and endothelium-dependent vessels in the H&E-stained sections were counted under a microscope using ×400 magnification, while CD34-PAS dual staining sections were viewed at ×400 magnification. The channels defined as VM were lined by PAS-positive material, with red cells in the center of the channels, but were not lined by CD34-positive endothelial cells. The mean numbers of VM in 10 areas were calculated as the VM channel density for each section.

Transmission electron microscopy observation

Fresh tumor xenograft tissues (0.5-mm3) were fixed in cold 2.5% glutaraldehyde in 0.1 mol/l sodium cacodylate buffer and post-fixed in a solution of 1% osmium tetroxide, then dehydrated and embedded in a standard manner (33). The specimens were then embedded, sectioned and stained by routine means for analysis with a transmission electron microscope (34).

Immunohistochemical staining

The paraffin sections were deparaffinized and rehydrated according to the method described above. After rinsing with PBS, the slides were incubated overnight with primary antibodies against Ki-67 (mouse monoclonal; sc-23900, Santa Cruz Biotechnology, Inc.; 1:100 dilution), VEGF (sc-7269, mouse monoclonal; Santa Cruz Biotechnology, Inc., 1:50), factor VIII (goat polyclonal; sc-33584, Santa Cruz Biotechnology, Inc.; 1:100 dilution), β-HCG (sc-7822, mouse monoclonal; Santa Cruz Biotechnology, Inc.; 1:100 dilution), LHR (sc-293165, mouse monoclonal; Santa Cruz Biotechnology, Inc.; 1:100 dilution) and CD31 (rabbit polyclonal; sc-8306, Santa Cruz Biotechnology, Inc.; 1:100 dilution). After washing in PBS for three times, the slides were incubated with peroxidase-conjugated donkey anti-mouse or anti-rabbit antibody (P0447 and P0448, respectively, Dako North America, Inc.; both 1:100 dilution) for 30 min. Negative controls were prepared by replacing the primary antibody with Tris-buffered saline. The reactions were visualized by diaminobenzidine and counterstained with hematoxylin.

RNA isolation and RT-PCR

Total RNA was isolated from the tumor xenograft tissues using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.). First-strand cDNA was synthesized from 20 µl total RNA using oligo(dT)18 primers and reverse transcriptase (Promega Corporation, Madison, WI, USA). RT-PCR was conducted using PCR Master Mix (Promega Corporation) with an initial denaturing step at 94°C for 5 min, followed by 20 cycles at 94°C for 45 sec, 58°C for 45 sec and 72°C for 45 sec, and a further extension at 72°C for 10 min. Glyceraldehyde 3-phosphate dehydrogenase was used as an internal control. The sequences of the primers are indicated in Table I.
Table I.

Sequences of the primers used in reverse transcription-polymerase chain reaction.

Gene nameAccession no.Sequence (5′-3′)
CGB5NM_033043.1Forward: CTACTGCCCCACCATGACC
Reverse: ATGGACTCGAAGCGCACATC
CD31NM_000442.4Forward: ATTGCAGTGGTTATCATCGGAGTG
Reverse: CTCGTTGTTGGAGTTCAGAAGTGG
Factor VIIINM_000132.3Forward: ATCGAGGGTCTCGGGGATGCG
Reverse: TGCGAAGAGTGCTGCGAATGCT
LHRNM_000610.3Forward: TGGCTGCTGTAAACGTCGGG
Reverse: GGAGAGCTGTACCTTGACAGTG
GAPDHNM_001256799.1Forward: AAGGTGAAGGTCGGAGTC
Reverse: GAAGATGGTGATGGGATTTC

CGB5, chorionic gonadotropin, beta polypeptide 5; CD, cluster of differentiation; LHR, luteinizing hormone receptor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Detection of secreted β-HCG by enzyme-linked immunosorbent assay (ELISA)

The concentrations of β-HCG released in the supernatants of the cell cultures were measured by specific human β-HCG ELISA, according to the manufacturer's protocol (BD Pharmingen, San Diego, CA, USA). Briefly, cells in 100 µl medium were seeded at 5×103 cells/well onto 96-well plates, and transfected with different reagents, as described earlier. At the appropriate time, 100 µl supernatants were harvested for ELISA.

Statistical analysis

All experiments were repeated ≥3 times. All numerical data were presented as the mean ± standard deviation. Data were analyzed using the two-tailed t test. P<0.05 was considered to indicate a statistically significant difference.

Results

CGB5 promotes tumor xenografts formation in vivo

To clarify if CGB5 affected VM formation and tumor development in vivo, the CGB5-expression vector and the siRNA vector targeting CGB5 were transfected into OVCAR-3 cells. Stable expression cell lines were obtained, and the expression of CGB5 at the messenger RNA (mRNA) level was effectively upregulated and downregulated, respectively, in OVCAR-3 cells, as detected by RT-PCR (Fig. 1A and B). Secreted β-HCG was measured in the supernatant of OVCAR-3 cells (Fig. 1C). Xenografts were established using these cells, which were resuspended at a density of 1×107 cells/ml, and 200 µl of this cell suspension was injected subcutaneously into nude mice. BeWo cells with high expression of β-HCG were used as a positive control (Fig. 1D). The tumors appeared gradually in the subcutaneous area of the right armpit of the mice following inoculation. After 2–6 weeks, tumors had grown to an average size of 1–2 cm3. The tumor formation rates of the nude mouse xenografts were 100.0% (6/6) for CGB5-overexpressing OVCAR-3 and BeWo cells, 83.3% (5/6) for normal or control vector-transfected OVCAR-3 cells and 33.3% (2/6) for CGB5-knockdown OVCAR-3 cells. The rates of tumor growth were also different, with tumors derived from BeWo and CGB5-overexpressing OVCAR-3 injected cells growing faster than tumors derived from CGB5-knockdown OVCAR-3 cells (Fig. 1E). In addition, the cell proliferation marker Ki-67 was detected by immunohistochemical staining, thus supporting such phenomenon (Fig. 1F). These data indicated that CGB5 may promote cell proliferation and tumor growth in ovarian cancer.
Figure 1.

Effect of CGB5 on tumor xenografts formation in vivo. (A) Lentivirus vector expressing CGB5 and small interfering RNA vector were infected in OVCAR-3 cells. EGFP expression demonstrated that the above vectors were stably infected in these cells. Control, pLenti6/entre-EGFP-infected cells; CGB5, CGB5-overexpressing cells; and CGB5 RNA interference, CGB5-knockdown cells. The BeWo cell line, which secrets high levels of β-HCG, was used as a positive control. Magnification, ×40. (B) Reverse transcription-polymerase chain reaction was used to determine the messenger RNA levels of CGB5 in the stably transfected cells. (C) The supernatant of these stably transfected cells was collected, and the β-HCG levels were detected by enzyme-linked immunosorbent assay. *P<0.05 vs. normal cells. (D) Cells were injected subcutaneously into the nude mice, and the tumors appeared gradually in the subcutaneous area of the right armpit of the mice at 2–6 weeks post-inoculation. (E) The speed of tumor growth was measured at 1, 2, 4 and 6 weeks after injection. (F) The cell proliferation marker Ki-67 was detected by immunohistochemical analysis. Magnification, ×400. CGB5, chorionic gonadotropin, beta polypeptide 5; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; EGFP, enhanced green fluorescent protein; RNAi, RNA interference; HCG, human chorionic gonadotropin.

The effect of CGB5 on VM formation in tumor xenografts

H&E staining and CD34-PAS dual staining were used to observe the morphology characteristic of VM in tumor xenografts. Based on H&E staining, spaces filled with red blood cells, which were completely surrounded by cancer cells, were observed (Fig. 2A a-e). Furthermore, staining of the endothelial cell marker CD34 was used to identify the endothelium in cancer tissue sections, while PAS staining was used to determine the basement membrane of tumor blood vessels (Fig. 2A f-j). The channel consisted of tumor cells that were positive for PAS and negative for CD34. Following statical analysis in 10 fields, the average numbers of blood supply patterns in tumors were defined as the number of VM in one section. Compared with the normal cells group, VM channels in xenografts were significantly increased in CGB5-overexpressing OVCAR-3 cells and in the BeWo cell group, while they were significantly reduced in the CGB5-knockdown OVCAR-3 cells group (Fig. 2B). There were cavities in the central structure of tumor nests, as clearly analyzed by transmission electron microscopy. Single, double, or multiple red blood cells-containing cavities structures could be observed in the choriocarcinoma specimens, according to their cell morphology. The number of cavities was much higher in CGB5-overexpressing tumor nests than in normal ovarian cancer specimens (Fig. 2C). These results indicated that HCG may promote the process of VM formation in ovarian cancer.
Figure 2.

Effect of CGB5 on VM formation by H&E and CD34-PAS staining. (A) After tumor growth to 1–2 cm3, the tumors were collected and cut into serial 6-µm sections. (a-e) H&E staining was used to detect VM formation. (f-j) PAS staining was used to identify matrix-associated vascular channels, while CD34 staining was used to identify the endothelium in the cancer tissue sections. PAS-positive and CD34-negative channels were considered as VM. (B) VM quantification was performed as follows: (a) VM channels and endothelium-dependent vessels in the H&E-stained sections were counted using ×400 magnification, and (b) CD34-PAS dual staining sections were viewed at ×400 magnification. *P<0.05 vs. normal cells. (C) Transmission electron microscopy examination. CGB5, chorionic gonadotropin, beta polypeptide 5; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RNAi, RNA interference; HCG, human chorionic gonadotropin; VM, vasculogenic mimicry; H&E, hematoxylin and eosin; PAS, periodic acid-Schiff.

CGB5 promotes vascular marker expression in tumor xenografts

To further confirm VM formation in the tumor xenografts, the vascular markers CD31, VEGF and factor VIII were detected. The mRNA levels of CD31, VEGF and factor VIII were increased in the CGB5-overexpressing cell group, whereas they were decreased in the CGB5-knockdown cell group (Fig. 3A). The results of immunohistochemical staining of CD31, VEGF and factor VIII exhibited the same tendency as the mRNA results (Fig. 3B). Compared with normal cells, the expression of vascular markers was higher in CGB5-overexpressing OVCAR-3 and BeWo cells. By contrast, the expression of these vascular markers was weak and focal in the CGB5-knockdown OVCAR-3 cell group (Fig. 3C).
Figure 3.

Expression of vascular markers in tumor xenografts. (A) Reverse transcription-polymerase chain reaction was used to determine the messenger RNA levels of the vascular markers CD31, VEGF and factor VIII in tumor tissues. (B) Statistical analysis of CD31, VEGF and factor VIII expression. *P<0.05 vs. normal cells. (C) Immunohistochemical analysis was used to detect CD31, VEGF and factor VIII expression. Magnification, ×400. CGB5, chorionic gonadotropin, beta polypeptide 5; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; VEGF, vascular endothelial growth factor; RNAi, RNA interference.

Change in LHR expression in tumor xenografts

Previous studies indicated that CGB5 may promote VM and tumor formation in vitro (31). However, the effect of CGB5 in the pathway mediated by LHR binding remains unknown. In the present study, the mRNA expression levels of LHR changed following the same tendency than CGB5 (Fig. 4A). Furthermore, immunochemistry demonstrated that LHR expression was increased in the CGB5-overexpressing OVCAR-3 cell group, while it was downregulated in the CGB5-knockdown OVCAR-3 cell group (Fig. 4B and C). These data indicated that CGB5 promotes VM formation in ovarian carcinoma via activation of LHR signal transduction.
Figure 4.

Expression of LHR in tumor xenografts. (A) Messenger RNA levels of CGB5 and LHR in tumor tissues were determined by reverse transcription-polymerase chain reaction. (B) Statistical analysis of CGB5 and LHR expression. *P<0.05 vs. normal cells. (C) Immunohistochemistry was used to detect CGB5 and LHR expression. CGB5, chorionic gonadotropin, beta polypeptide 5; HCG, human chorionic gonadotropin; LHR, luteinizing hormone receptor.

Discussion

HCG, which is primarily produced by the placenta, was considered to be a proangiogenic factor in recent reports (35). In the present study, CGB5 (the fifth subunit of β-HCG, which was identified as the key part of HCG) was used to investigate the role of HCG in VM formation. The current study identified that CGB5 may increase tumor growth, VM formation and LHR expression. These data indicated that, in ovarian carcinoma, CGB5 was the promoter of VM formation and tumor growth via the activation of LHR signal transduction. HCG, a heterodimeric glycoprotein hormone, is composed of a single α-subunit and a target-specific β-subunit, which is encoded by a multigene cluster composed of six homologous sequences (β1, β2, β3, β5, β7 and β8) (24,36,37); however, only the heterodimers containing β5, β3 or β8 are transcriptionally active (37,38). Since the expression of the β5-subunit is the highest of all subunits (37), the present study selected CGB5 as the potential target gene in VM formation. It has been reported that HCG can increase uterine arterial blood flow and stimulate angiogenesis in the ovary by stimulating vascular endothelial cell proliferation and VEGF expression (21–22). HCG can also prevent luteolysis by maintaining luteal blood flow (31). In early pregnancy, HCG expression is associated with endometrial angiostimulation, since HCG increases blood supply and alters the uterine vasculature via vasodilatation, thus increasing the permeability, development and maturation of newly formed blood vessels (25). It has been reported that HCG exerts its effect possibly by interacting with its LHR receptor (39). The present study identified that CGB5 overexpression promoted tumor growth and formation, which was accompanied by an increase in LHR expression. VM describes the unique ability of highly aggressive tumor cells to mimic the presence and function of endothelial cells, thus forming matrix-rich networks de novo, which could convey blood plasma and red blood cells (6–8). Based on H&E staining, channels which PAS-positive material and red cells in the center of the channels but CD34-negative endothelial cells may be identified as VM in vivo. The present study suggested that CGB5 may promote OVCAR-3 cells tumor growth and VM formation in tumor xenografts. It has been reported that certain ovarian cancer cells may differentiate into endothelial-like cells. To further identify the formation of VM, vascular markers, including CD31, factor VIII and VEGF, were also detected in OVCAR-3 cells in vivo. The expression of CD31, factor VIII and VEGF followed the same tendency as the levels of CGB5 in these cells. In conclusion, ovarian cancer is a silent killer, and the present results provide clearly in vivo evidence that HCG is important in the formation of VM. Therefore, it is possible to speculate that the use of anti-HCG therapeutic targeting may provide a novel opportunity to circumvent tumors that express HCG, such as ovarian cancer and choriocarcinoma.
  39 in total

1.  Identification of the transcriptionally active genes of the chorionic gonadotropin beta gene cluster in vivo.

Authors:  M Bo; I Boime
Journal:  J Biol Chem       Date:  1992-02-15       Impact factor: 5.157

Review 2.  Vasculogenic mimicry: current status and future prospects.

Authors:  Shiwu Zhang; Danfang Zhang; Baocun Sun
Journal:  Cancer Lett       Date:  2007-02-15       Impact factor: 8.679

3.  Angiogenic activity of human chorionic gonadotropin through LH receptor activation on endothelial and epithelial cells of the endometrium.

Authors:  Sarah Berndt; Sophie Perrier d'Hauterive; Silvia Blacher; Christel Péqueux; Sophie Lorquet; Carine Munaut; Martine Applanat; Marie Astrid Hervé; Noël Lamandé; Pierre Corvol; Frédéric van den Brûle; Françis Frankenne; Matti Poutanen; Ilpo Huhtaniemi; Vincent Geenen; Agnès Noël; Jean-Michel Foidart
Journal:  FASEB J       Date:  2006-10-25       Impact factor: 5.191

4.  Angiogenesis in the human corpus luteum: simulated early pregnancy by HCG treatment is associated with both angiogenesis and vessel stabilization.

Authors:  C Wulff; S E Dickson; W C Duncan; H M Fraser
Journal:  Hum Reprod       Date:  2001-12       Impact factor: 6.918

5.  Transfection of antisense chorionic gonadotropin beta gene into choriocarcinoma cells suppresses the cell proliferation and induces apoptosis.

Authors:  Anna Lissa Hamada; Koji Nakabayashi; Asomi Sato; Kenji Kiyoshi; Yukou Takamatsu; Jovelle B Laoag-Fernandez; Noriyuki Ohara; Takeshi Maruo
Journal:  J Clin Endocrinol Metab       Date:  2005-05-10       Impact factor: 5.958

6.  Role of hCG in vasculogenic mimicry in OVCAR-3 ovarian cancer cell line.

Authors:  Min Su; Weiwei Wei; Xiangxiang Xu; Xiaoying Wang; Caoyi Chen; Li Su; Yuquan Zhang
Journal:  Int J Gynecol Cancer       Date:  2011-11       Impact factor: 3.437

7.  Melanoma vasculogenic mimicry is strongly related to reactive oxygen species level.

Authors:  Amalia A Vartanian; Olga S Burova; Eugeniya V Stepanova; Anatoly Yu Baryshnikov; Mikhail R Lichinitser
Journal:  Melanoma Res       Date:  2007-12       Impact factor: 3.599

8.  Phosphoinositide 3-kinase regulates membrane Type 1-matrix metalloproteinase (MMP) and MMP-2 activity during melanoma cell vasculogenic mimicry.

Authors:  Angela R Hess; Elisabeth A Seftor; Richard E B Seftor; Mary J C Hendrix
Journal:  Cancer Res       Date:  2003-08-15       Impact factor: 12.701

9.  Expression of functional human chorionic gonadotropin/human luteinizing hormone receptor gene in human uterine arteries.

Authors:  P Toth; X Li; C V Rao; S R Lincoln; J S Sanfilippo; J A Spinnato; M A Yussman
Journal:  J Clin Endocrinol Metab       Date:  1994-07       Impact factor: 5.958

10.  Assessment of metal contaminants in non-small cell lung cancer by EDX microanalysis.

Authors:  M Scimeca; A Orlandi; I Terrenato; S Bischetti; E Bonanno
Journal:  Eur J Histochem       Date:  2014-09-12       Impact factor: 3.188

View more
  9 in total

1.  Development of a Novel Immune-Related Gene Signature to Predict Prognosis and Immunotherapeutic Efficiency in Gastric Cancer.

Authors:  Dongliang Liu; Yuanmin Xu; Yu Fang; Kongwang Hu
Journal:  Front Genet       Date:  2022-05-27       Impact factor: 4.772

2.  Human chorionic gonadotropin β regulates epithelial-mesenchymal transition and metastasis in human ovarian cancer.

Authors:  Na Liu; Shu-Min Peng; Guang-Xi Zhan; Jing Yu; Wei-Min Wu; Hao Gao; Xiao-Feng Li; Xiao-Qing Guo
Journal:  Oncol Rep       Date:  2017-07-14       Impact factor: 3.906

Review 3.  Angiogenesis and vasculogenic mimicry as therapeutic targets in ovarian cancer.

Authors:  Dansaem Lim; Yeojin Do; Byung Su Kwon; Woochul Chang; Myeong-Sok Lee; Jongmin Kim; Jin Gu Cho
Journal:  BMB Rep       Date:  2020-06       Impact factor: 4.778

Review 4.  Mechanisms of Vasculogenic Mimicry in Ovarian Cancer.

Authors:  Lízbeth Ayala-Domínguez; Leslie Olmedo-Nieva; J Omar Muñoz-Bello; Adriana Contreras-Paredes; Joaquín Manzo-Merino; Imelda Martínez-Ramírez; Marcela Lizano
Journal:  Front Oncol       Date:  2019-09-27       Impact factor: 6.244

5.  Galectin-1 Promotes Vasculogenic Mimicry in Gastric Cancer by Upregulating EMT Signaling.

Authors:  Xiaolan You; Qinghong Liu; Jian Wu; Yuanjie Wang; Jiawen Dai; Dehu Chen; Yan Zhou; Yanjun Lian
Journal:  J Cancer       Date:  2019-10-17       Impact factor: 4.207

Review 6.  The clinical characteristics and treatment of ovarian malignant mesoderm mixed tumor: a systematic review.

Authors:  Xin Wang; Shiyuan Wang; Shujuan Yao; Wei Shi; Ke Ma
Journal:  J Ovarian Res       Date:  2022-09-16       Impact factor: 5.506

7.  Novel Prognostic Biomarkers in Gastric Cancer: CGB5, MKNK2, and PAPPA2.

Authors:  Min Qin; Zhihai Liang; Heping Qin; Yifang Huo; Qing Wu; Huiying Yang; Guodu Tang
Journal:  Front Oncol       Date:  2021-06-15       Impact factor: 6.244

8.  CGB5 expression is independently associated with poor overall survival and recurrence-free survival in patients with advanced gastric cancer.

Authors:  Yuxin Yang; Yonghong Shi; Yanjuan Hou; Ying Lu; Jinliang Yang
Journal:  Cancer Med       Date:  2018-02-23       Impact factor: 4.452

9.  Ovarian high-grade serous carcinoma with elevated β-human chorionic gonadotropin: A case report.

Authors:  Yi Zhong; Xing Chen; Yan Huang; Yi Jiang; Ting Chen; Xianglin Nie; Wenjun Cheng
Journal:  Medicine (Baltimore)       Date:  2021-12-23       Impact factor: 1.817

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.