Literature DB >> 27347050

Antiosteoporotic effect of icariin in ovariectomized rats is mediated via the Wnt/β-catenin pathway.

Guangming Chen1, Chaopeng Wang1, Jiefang Wang1, Sujuan Yin1, Han Gao1, L U Xiang1, Hengrui Liu1, Yinquan Xiong1, Panpan Wang2, Xiaofeng Zhu2, L I Yang1, Ronghua Zhang1.   

Abstract

<span class="Chemical">Icariin (<span class="Chemical">ICA), the main active flavonoid glucoside isolated from Herba Epimedii, has been shown to prevent postmenopausal bone loss in vitro. However, the mechanisms by which ICA prevents bone loss in vivo remain poorly understood. In the present study, the effect of ICA in an ovariectomized (OVX) rat model of osteoporosis was evaluated. Sprague-Dawley rats were divided into sham-operated and OVX groups. The OVX rats were randomly divided into five groups: OVX group (water only), Fosamax (positive) group (5.04 mg/kg, weekly, administered orally), and OVX-ICA groups (125, 250 or 500 mg/kg, daily, administered orally) and treated for 12 weeks. The 125, 250 and 500 mg/kg doses of ICA were designated as low (L-ICA), medium (M-ICA) and high (H-ICA), respectively. Compared with the sham-operated group, the OVX rats had significantly decreased bone mineral density (BMD), reduced serum osteoprotegerin (OPG) and increased serum bone gla protein (BGP) concentrations. ICA significantly increased BMD, biomechanical strength, trabecular bone number and trabecular bone thickness, and reduced lumbar trabecular bone separation. Treatment with ICA also completely normalized the expression of osteoblast markers by increasing serum concentrations of OPG and BGP. Enhanced mineralization was demonstrated by increased expression of differentiation markers. Although further in vivo studies are required to investigate the efficacy of ICA in improving bone mass, this study demonstrates that ICA has strong osteogenic activity, inducing osteogenic differentiation and inhibiting resorption by osteoclasts. It also demonstrates an antiosteoporotic effect for ICA on the basis of BMD, biochemical markers, biomechanical tests and histopathological parameters. Compared with L-ICA and H-ICA, M-ICA was more effective and caused no liver or kidney damage.

Entities:  

Keywords:  Herba Epimedii; icariin; in vivo; mechanism; osteoporosis

Year:  2016        PMID: 27347050      PMCID: PMC4906828          DOI: 10.3892/etm.2016.3333

Source DB:  PubMed          Journal:  Exp Ther Med        ISSN: 1792-0981            Impact factor:   2.447


Introduction

<span class="Disease">Osteoporosis is a disease characterized by low bone mass and deterio<span class="Species">ration of bone structure that causes bone fragility and increases the risk of fracture (1). Osteoporosis has become a major health problem that is expected to worsen with aging populations worldwide; the incidence is also rising in Asian countries. The results of a randomized controlled trial in healthy postmenopausal women, conducted by the Women's Health Initiative, has reported that the health risks of hormone replacement therapy exceed the benefits (2). Isoflavonoids are increasing considered as a promising preventive treatment for osteoporosis in a clinical setting (3). Of all the natural alternatives currently undergoing investigation, Chinese medicines have received considerable attention. Herba Epimedii (HEP), one of the foremost Chinese anti-osteoporosis formulas (4), is an important traditional Chinese herbal medicine used widely as a tonic, aphrodisiac and antirheumatic in China and Korea. Icariin (ICA; C33H40O15; molecular weight, 676.67 g/mol) is a flavonoid found in HEP and is considered to be the major bioactive component (5). Experiments in rats have indicated that ICA prevents bone loss and reduction in femoral strength induced by ovariectomy (OVX) (6,7). As yet, the molecular mechanism of action of <span class="Chemical">ICA in the prevention of <span class="Disease">osteoporosis has not been investigated in vivo. As a step towards addressing this, the present study aimed to evaluate the effects of ICA in preventing osteoporosis and ameliorating bone loss in rats subjected to OVX. The study also attempted to elucidate the molecular mechanism of action of ICA in OVX model rats. In particular, the β-catenin pathway, including low-density lipoprotein receptor-related protein 6 (Lrp6), glycogen synthase kinase-3β (GSK-3β) and runt-related transcription factor 2 (Runx2) was investigated.

Materials and methods

Animals and diets

A total of 84 specific-pathogen-free female <span class="Species">Sprague-Dawley rats, 3 months of age, were purchased (Animal Center of Guangdong Province, Guangzhou, China) and acclimated to laboratory conditions for 2 weeks prior to the study. The animals were housed in an air-conditioned room at constant temperature (23±2°C) and humidity (45–50%), with 12 h/12 h light-dark illumination cycles. The animals were fed in the Laboratory Animal Management Center of Jinan University Medical College (Guangzhou, China). At the beginning of the study, the animals were 3 months of age with an average weight of 250±20 g. The present study was approved by the Animal Ethics Committee of Jinan University (Guangzhou, China).

Chemicals

<span class="Chemical">ICA (EPE-120215; purity, 98%) was purchased from Changsha Nutramax Inc. (Changsha, China). Reagent kits for the measure<span class="Species">ment of serum osteoprotegerin (OPG) and bone Gla protein (BGP) were purchased from Cloud-Clone Corp., (Houston, TX, USA). Reagent kits for the measurement of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were purchased from Sekisui Medical Co., Ltd. (Tokyo, Japan). Reagent kits for the measurement of blood urea nitrogen (BUN) and creatinine (Cr) were obtained from Mike Biotechnology Co., Ltd. (Sichuan, China).

Ovariectomy and administration of ICA

The <span class="Species">rats were randomly divided into two groups: The sham-ope<span class="Species">rated group (n=14) and the OVX group (n=70). Surgery was performed under intraperitoneal pentobarbital sodium (0.15 ml/100 g) anesthesia. Bilateral ovariectomies were performed from the midline with an abdominal skin incision ~1.5 cm long. The sham-operated rats were subjected to surgery exposing the ovaries, but these were not removed. After 3 months, the bone mineral density (BMD) of the lumbar vertebrae and femurs of all rats was determined using dual-energy X-ray absorptiometry (DEXA; Lunar iDXA; GE Healthcare Bio-Sciences, Pittsburgh, PA, USA)) to evaluate whether the model had been successfully established. Once it had been determined that the model was a success, the <span class="Chemical">OVX model <span class="Species">rats were randomly divided into five groups, each comprising 14 animals: OVX group, treated with 0.2 ml/100 g double distilled water, daily, administered orally; positive group treated with 5.04 mg/kg Fosamax (alendronate sodium; Merck Sharp & Dohme, Kenilworth, NJ, USA) weekly, administered orally; and three OVX-ICA groups, treated with 125, 250 or 500 mg/kg ICA, daily, administered orally. The treatments were administered for 12 weeks. The 125, 250 and 500 mg/kg doses of ICA were designated as low (L-ICA), medium (M-ICA) and high (H-ICA), respectively. After 12 weeks of treat<span class="Species">ment, blood samples were withdrawn from <span class="Species">rats in all groups using the abdominal aorta method to assess biochemical parameters. The animals were then sacrificed using pentobarbital sodium, and the femurs, tibias and lumbar vertebrae were dissected and stored in a freezer at −80°C.

Measurement of BMD

<span class="Disease">BMD (g/cm2) is log-normally distributed for all individuals at the femoral neck but normally distributed at the trochanter in <span class="Species">men and postmenopausal women (8); therefore, the assessment of BMD can be used to evaluate osteoporosis in the clinic. Following 12 weeks of treatment, the BMD (g/cm2) was assessed using DEXA in the small animal scan mode with the rats under intraperitoneal pentobarbital sodium (0.15 ml/100 g) anesthesia. The BMD of the fourth and fifth lumbar vertebrae and the femur was measured in all rats.

Biomechanical parameters

The freshly isolated right femur and the fifth lumbar <span class="Disease">vertebra were assessed using the three-point bending test and the compression test (9). Measure<span class="Species">ments were carried out using a precision biological materials testing system (MTS MINI 858; MTS Systems Corp., Eden Prairie, MN, USA) and the readings were recorded in Newtons.

Assessment of bone microstructure using micro-computed tomography (CT)

In recent years, high resolution mi<span class="Chemical">cro-CT has become feasible for in vitro or in vivo evaluation of bone architecture. In comparison with other imaging techniques, micro-CT is more effective for detecting early bone changes that allow fracture prediction and assessment of potential antiosteoporotic agents (10). The freshly isolated fourth lumbar vertebrae were assessed using micro-CT (µCT 80; Scanco Medical AG, Brüttisellen, Switzerland). The fourth lumbar vertebrae were placed in the micro-CT scanning device and scanned images were obtained from different sections of the same specimen. Each plane was 20 µm. Morphometric parameters, including trabecular thickness (Tb.Th, µm), trabecular number (Tb.N, 1/mm) and trabecular separation (Tb.Sp, µm) were measured using MedProject 4.1 software and bone tissue was reconstructed through 3D images.

Serum parameters

ALT, <span class="Gene">AST, BUN and <span class="Chemical">Cr were measured using an automatic analyzer (Ciba-Corning 550; Ciba Corning Diagnostics, East Walpole, MA, USA) with the appropriate diagnostic reagent kit. Levels of OPG and BGP were determined using an enzyme-linked immunosorbent assay reagent kit (Cloud-Clone Corp.).

Histopathology of femur bone

Femur samples were dehyd<span class="Species">rated through a graded <span class="Chemical">ethanol series, defatted with chloroform and subsequently hydrated and decalcified for 1–2 weeks in formic acid. Following this, the decalcified tissues were dehydrated using increasing concentrations of ethanol, embedded in paraffin and cut into 4-mm-thick sections along the femoral axis in the sagittal plane. Serial sections were mounted on slides and dried overnight prior to staining with hematoxylin and eosin (H&E) to observe pathological changes in rats from each group. Images of the distracted zones were captured under ×40 magnification using a light microscope (CFX41; Olympus Corp., Tokyo, Japan).

RNA isolation, cDNA synthesis and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

Femur samples were ground in liquid <span class="Chemical">nitrogen using a mortar and pestle to avoid RNA degradation. Extraction of total RNA was performed using <span class="Chemical">TRIzol according to the manufacturer's protocol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The purified RNA sample was incubated with QuantiNova gDNA Removal Mix (Qiagen GmbH, Hilden, Germany) at 45°C for 2 min. Following genomic DNA removal, 1 µg RNA was reverse transcribed to cDNA using a QuantiNova reverse transcription kit (Qiagen GmbH). The total reaction volume of 20 µl contained 15 µl RNA, 1 µl QuantiNova Reverse Transcription Enzyme and 4 µl QuantiNova Reverse Transcription Mix. Following a 3 min primer annealing step at 25°C, the reaction was performed at 45°C for 10 min and subsequently inactivated at 85°C. qPCR analysis was performed using a LightCycler 480 instrument (Roche Diagnostics GmbH, Mannheim, Germany) with a total reaction volume of 50 µl comprising 25 µl SYBR green PCR master mix (Takara Bio, Inc., Otsu, Japan), 5 µl cDNA, 2 µl each primer and 16 µl RNAase-free water. The qPCR analysis was performed with an initial incubation temperature of 95.0°C for 5 min, followed by a two-step cycling protocol, with a denaturation step at 95°C for 5 sec and a combined annealing/extension step at 60°C for 30 sec, carried out for 40 cycles. Melting curve analysis was performed to determine the product specificity. The respective primer sequences are shown in Table I. As a control gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) exhibits stable and rich expression, therefore it was chosen to assess the performance of the machine via the melting and amplification curves. Expression levels were normalized against GAPDH according to the 2−∆∆Cq method (11).
Table I.

Primer sequences used in the reverse transcription-quantitative polymerase chain reaction assay.

GeneForward sequence (5′ to 3′)Reverse sequence (5′ to 3′)
β-cateninACTCTAGTGCAGCTTCTGGGTTCTGCTCGGTAATGTCCTCCCTGTCA
GSK-3βACACCTGCCCTCTTCAACTTTACCATTGGTCTGTCCACGGTCTCCA
Lrp6GGAAGCCTAAGATTGACAGAGCGGTTGAGTCCGAGCATATTTGAAG
Runx2AGCGGACGAGGCAACAGTTTCCTAAATCACTGAGGCGGTCAG
GAPDHCAACGGGAAACCCATCACCAACGCCAGTAGACTCCACGACAT

GSK-3β, glycogen synthase kinase-3β; Lrp6, low-density lipoprotein receptor-related protein 6; Runx2, runt-related transcription factor 2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Western blot analysis

A cell lysis method was used to extract total protein from the <span class="Species">rat femoral heads and the <span class="Chemical">bicinchoninic acid method was used to measure the total protein concentration in each group. Samples were run on a 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel and transfered onto nitrocellulose membranes. Then, immunoblotting was assayed using rabbit anti-β-catenin (1:2,000; 9562) and GAPDH (1:1,000; 2118; both Cell Signaling Technology, Inc., Danvers, MA, USA) polyclonal antibodies at 4°C for 12 h. Blots were visualized using horseradish peroxidase (HRP)-conjugated anti-rabbit secondary antibody (1:2,000; 7074S; Cell Signaling Technology, Inc.) at room temperature for 1 h, with ECL Western Blotting Substrate (EMD Millipore, Billerica, MA, USA) as the substrate of HRP. Bands were detected and analyzed using ImageJ software (version 1.48; National Institutes of Health, Bethesda, MA, USA)

Statistical analysis

Statist<span class="Chemical">ical analyses were performed using SPSS software (version 19.0: IBM SPSS, Armonk, NY, USA). Data are presented as mean value ± standard deviation (SD). The effects of ICA in OVX rats were analyzed by one-way analysis of variance followed by Dunnett's test (post hoc analysis). Differences between two groups were analyzed using the independent t-test or Mann-Whitney test (two-tailed), as appropriate. P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of OVX and ICA on BMD

The <span class="Disease">BMD of <span class="Chemical">OVX rats was significantly lower than that of sham-operated rats (P<0.05). Following 12 weeks of treatment, the BMD of the OVX model rats treated with ICA was significantly higher than that of OVX rats (Table II). Compared with the OVX group, the BMD of the lumbar vertebrae, right femur and left femur significantly increased (P<0.01) in the positive group; whereas the BMD of the right and left femurs significantly increased (P<0.01 and P<0.05, respectively) in the L-ICA group. In the M-ICA group, the lumbar vertebrae, right femur and left femur BMD significantly increased (P<0.01); and, in the H-ICA group, the BMD of the right and left femurs significantly increased (P<0.01 and P<0.05, respectively). The BMD of the OVX model rats treated with ICA were significantly increased, as compared with the OVX rats. The M-ICA was most effective in comparison with the positive group (Table II).
Table II.

Effects of OVX and ICA on BMD 12 weeks after surgery (g/cm2).

A, Effect of OVX on BMD

GroupLumbar vertebraeRight femurLeft femur
Sham0.285±0.0090.340±0.0200.310±0.013
OVX0.212±0.006[a]0.262±0.006[a]0.247±005[a]

B, Effect of ICA on BMD in OVX rats

GroupLumbar vertebraeRight femurLeft femurWhole body

Sham0.266±0.0260.274±0.0340.255±0.0300.184±0.003
OVX0.196±0.009[b]0.185±0.010[b]0.194±0.010[b]0.174±0.007[a]
Positive0.261±0.024[c]0.263±0.038[c]0.260±0.045[c]0.176±0.005[a]
L-ICA0.226±0.0370.257±0.020[c]0.249±0.030[d]0.173±0.006[a]
M-ICA0.240±0.029[c]0.254±0.017[c]0.285±0.029[c]0.174±0.006[a]
H-ICA0.218±0.027[a]0.243±0.016[c]0.251±0.044[d]0.171±0.007[a]

As shown in A, the BMD of the fourth and fifth lumbar vertebrae was reduced by 25.6% following OVX. As shown in B, administration of M-ICA to OVX rats for 12 weeks significantly restored BMD.

P<0.05

P<0.01 vs. sham

P<0.01

P<0.05 vs. OVX. OVX, ovariectomy; ICA, icariin; BMD, bone mineral density; Sham, sham-operated; Positive, treated with alendronate sodium; L-ICA, low dose ICA (125 mg/kg/day); M-ICA, medium dose ICA (250 mg/kg/day); H-ICA, high dose ICA (500 mg/kg/day).

Biomechanical tests

The bone strengths of the femurs and vertebrae, which were assessed by the three-point bending test and the compression test, respectively, decreased significantly in the OVX group compared with the sham-operated group (P<0.01). Following the administration of ICA to the OVX model rats, the biomechanical strength increased significantly and was comparable to that of the sham-operated group (Fig. 1). Following 12 weeks of treatment, as compared with the OVX group, vertebral and femoral strength significantly increased (P<0.05) in the positive group, vertebral strength increased significantly (P<0.01) in the L-ICA group, and femoral and vertebral strength increased significantly (P<0.05 and P<0.01, respectively) in the M-ICA group. M-ICA was most effective in comparison with the positive group.
Figure 1.

Three-point bending and compression tests to assess bone strength of the femur and vertebra. **P<0.01 vs. sham-operated; ▲P<0.05, ▲▲P<0.01 vs. OVX. OVX, ovariectomy; ICA, icariin; Sham, sham-operated; Positive, treated with alendronate sodium; L-ICA, low dose ICA (125 mg/kg/day); M-ICA, medium dose ICA (250 mg/kg/day); H-ICA, high dose ICA (500 mg/kg/day).

Effect of OVX and ICA on OPG and BGP serum biochemical indicators

<span class="Gene">OPG levels in sham-ope<span class="Species">rated and OVX rats were 0.752±0.121 and 0.541±0.034 ng/ml, respectively. OPG levels were significantly increased (P<0.05) to 1.28±0.244 ng/ml following treatment with M-ICA (Fig. 2). BGP levels in the sham-operated group were 4,328±0.476 ng/ml. As compared with the sham-operated group, BGP levels were significantly increased (P<0.05) to 5,983±0.645 ng/ml in the OVX group; however, they were significantly decreased (P<0.05) to 1.713±0.202 ng/ml in the positive group. As compared with the OVX group, BGP levels in the positive, L-ICA, M-ICA and H-ICA groups were significantly decreased (P<0.05) to 1.713±0.202, 4.436±0.477, 4.055±0.273 and 3.939±0.269 ng/ml, respectively (Fig. 3).
Figure 2.

OPG levels in the six groups. As compared with the sham-operated group, expression of OPG was decreased in the OVX group and OPG levels were significantly increased in the positive and M-ICA groups. *P<0.05 vs. sham-operated; ▲P<0.05 vs. OVX. OPG, osteoprotegerin; OVX, ovariectomy; ICA, icariin; Sham, sham-operated; Positive, treated with alendronate sodium; L-ICA, low dose ICA (125 mg/kg/day); M-ICA, medium dose ICA (250 mg/kg/day); H-ICA, high dose ICA (500 mg/kg/day).

Figure 3.

BGP levels in the six groups. Compared with the sham-operated group, BGP levels in the OVX group increased significantly (P<0.05). Compared with OVX group, levels of BGP in the positive group (P<0.01), and the L-ICA, M-ICA and H-ICA groups were significantly reduced (P<0.05). *P<0.05 vs. sham-operated; ▲P<0.05 and ▲▲P<0.01 vs. OVX. BGP, bone Gla protein; OVX, ovariectomy; ICA, icariin; Sham, sham-operated; Positive, treated with alendronate sodium; L-ICA, low dose ICA (125 mg/kg/day); M-ICA, medium dose ICA (250 mg/kg/day); H-ICA, high dose ICA (500 mg/kg/day).

Effects of OVX and ICA on liver and kidney function

Following 12 weeks of treat<span class="Species">ment, BUN and ALT were significantly increased (P<0.05), as compared with the sham-operated group. As compared with the OVX group, M-ICA successfully restored BUN and ALT to normal levels (P<0.05), whereas H-ICA significantly increased Cr (P<0.05). Liver and kidney function index tests demonstrated the M-ICA group exhibited reduced liver and kidney damage, as compared with the OVX group (Table III).
Table III.

Effect of ICA on liver and kidney function in OVX rats after 12 weeks.

GroupBUNCrALTAST
Sham4.84±0.6935.20±8.6451.00±12.98[a]81.75±18.25
OVX6.64±1.85[b]32.00±13.7487.80±11.90[b]121.40±71.90
Positive6.84±1.1935.78±6.5353.00±9.68[a]101.±7.49
L-ICA5.40±1.0436.00±4.7668.80±31.59104.40±41.4
M-ICA5.19±0.73[a]37.17±3.3741.86±13.20[a]75.71±8.28
H-ICA6.05±0.68[b]41.14±5.70[a]59.59±29.9763.66±29.08[a]

Compared with the untreated OVX group, administration of M-ICA for 12 weeks restored BUN and ALT to normal levels (both P<0.05). Liver and kidney function index tests show that liver and kidney damage were lower in the M-ICA group than in the sham group. Levels of BUN in the H-ICA group were significantly increased compared with those in the sham-operated group.

P<0.05 vs. OVX

P<0.05 vs. sham. OVX, ovariectomy; ICA, icariin; BUN, blood urea nitrogen; Cr, creatinine; ALT, alanine aminotransferase; AST, aspartate aminotransferase; Sham, sham-operated; Positive, treated with alendronate sodium; L-ICA, low dose ICA (125 mg/kg/day); M-ICA, medium dose ICA (250 mg/kg/day); H-ICA, high dose ICA (500 mg/kg/day).

Morphometric measurements

Morpholog<span class="Chemical">ical observations were quantitated by the histomorphometric analysis of longitudinal cross-sections collected 2 cm away from the proximal vertebra using micro-CT. Marked bone loss was observed in the OVX rats compared with the sham-operated group (Fig. 4A). This bone loss was accompanied by a significant reduction in Tb.Th and Tb.N together with a significant increase in Tb.Sp (P<0.01). Treatment with M-ICA normalized Tb.Th, Tb.N and Tb.Sp compared with the OVX group. Compared with the sham-operated group, in the positive group and the H ICA group, Tb.Th was significantly reduced (P<0.01) but Tb.Sp was significantly increased (P<0.05). In the L-ICA group, Tb.N decreased (P<0.05). In the L-ICA group, Tb.N decreased (P<0.05). Compared with the sham-operated group, the bone trabecula was looser in the OVX group. Following 12 weeks of treatment, as compared with the OVX group, the bone trabecula was more dense in the positive group and ICA groups, suggesting that ICA may recover bone trabecula to varying levels. M-ICA was most effective in comparison with the positive group (Fig. 4B).
Figure 4.

Morphometric analysis. (A) Tb.N and Tb.Th decreased significantly in the OVX group compared with the sham group (P<0.01). Compared with the OVX group, the M-ICA group had significantly increased Tb.N and Tb.Th (P<0.05), while Tb.Sp decreased significantly (P<0.05), whereas in the L-ICA group, Tb.Th increased significantly and Tb.Sp decreased significantly (P<0.05). *P<0.05, **P<0.01 vs. sham-operated; ▲P<0.05 vs. OVX. (B) Micro-computed tomography analysis for the (a) sham, (b) OVX, (c) positive, (d) L-ICA, (e) M-ICA and (f) H-ICA groups. In comparison with the sham group, the bone trabecula is loose, fractured and exhibits loss in the OVX group. Following oral administration of ICA, the number of bone trabecula was clearly increased and the bone trabecula was more densely concatenated than that in the OVX group. Tb.N, trabecular number; Tb.Th, trabecular thickness; Tb.Sp, trabecular separation; OVX, ovariectomy; ICA, icariin; Sham, sham-operated; Positive, treated with alendronate sodium; L-ICA, low dose ICA (125 mg/kg/day); M-ICA, medium dose ICA (250 mg/kg/day); H-ICA, high dose ICA (500 mg/kg/day).

Histopathology of femural bone

Histopatholog<span class="Chemical">ical changes in the femur were examined at the end of the 12-week study period. Representative histolog<span class="Chemical">ical sections of femur tissue were stained with H&E. Tissue from the sham-operated group revealed normal compactness of the diaphysis and a competent trabecular meshwork (Fig. 5A). Tissue from the OVX group showed sparse, uniform thinning of the trabeculae, resulting in widened inter-trabecular spaces (Fig. 5B). In the positive group, the trabecular was significantly recovered (Fig. 5C). Tissues from the OVX-ICA groups exhibited significant restoration of structure, with mineralization. Uniform trabeculae with dense matrices and shaft sizes were also observed (Fig. 5D–F). Histomorphological parameters were within normal limits and complete restoration of the trabecular meshwork was observed. Bone from the M-ICA group (Fig. 5E) was essentially the same as normal bone.
Figure 5.

Histopathology of femurs from the six groups. (A) Sham, (B) OVX (C) positive, (D) L-ICA, (E) M-ICA and (F) H-ICA groups. Hematoxylin and eosin staining (magnification, ×40). OVX, ovariectomy; ICA, icariin; Sham, sham-operated; Positive, treated with alendronate sodium; L-ICA, low dose ICA (125 mg/kg/day); M-ICA, medium dose ICA (250 mg/kg/day); H-ICA, high dose ICA (500 mg/kg/day)..ask for letters to be removed.

Effect of ICA on expression of β-catenin, GSK-3β and Runx2 and Lrp6 mRNA

The expression levels of β-catenin, <span class="Gene">Runx2 and <span class="Gene">Lrp6 mRNA were reduced in the OVX animals compared with their respective levels in the sham-operated group (P<0.05; Fig. 6). Levels of β-catenin, Runx2 and Lrp6 mRNA in the M-ICA group were significantly increased in comparison with those in the OVX group (P<0.05). The levels of GSK-3β were significantly increased in the OVX group compared with those in the sham-operated group (P<0.05). Furthermore, treatment with M-ICA significantly reduced the expression of GSK-3β compared with that in the OVX group (P<0.05).
Figure 6.

mRNA expression levels determined by reverse transcription-quantitative polymerase chain reaction. Expression levels of (A) Lrp6, (B) GSK-3β, (C) β-catenin and (D) Runx2 mRNA. *P<0.05 vs. sham; ▲P<0.05 vs. OVX. Lrp6, low-density lipoprotein receptor-related protein 6; GSK-3β, glycogen synthase kinase-3β; Runx2, runt-related transcription factor 2; OVX, ovariectomy; ICA, icariin; Sham, sham-operated; Positive, treated with alendronate sodium; L-ICA, low dose ICA (125 mg/kg/day); M-ICA, medium dose ICA (250 mg/kg/day); H-ICA, high dose ICA (500 mg/kg/day).

Effect of ICA on expression levels of β-catenin protein in OVX rats

As shown in Fig. 7, following bilateral removal of the <span class="Disease">ovaries, expression of β-catenin was significantly decreased (P<0.05). Treatment with M-ICA led to significantly increased levels of β-catenin compared with those in OVX rats (P<0.05).
Figure 7.

Western blotting results for β-catenin. *P<0.05 vs. sham; ▲P<0.05 vs. OVX. GAPDH, glyceraldehyde 3-phosphate; OVX, ovariectomy; M-ICA, medium dose icariin (250 mg/kg/day).

Discussion

There has been much interest in the potential of phytoestrogen <span class="Chemical">flavonoids as an alternative therapy for improving bone formation and for preventing or treating <span class="Disease">osteoporosis. ICA, a prenylated flavonol glycoside isolated from HEP, has been shown to prevent osteoporosis in late postmenopausal women (12) and has also been shown to have a strong estrogen-like activity (13). The main index for evaluating the effect of treat<span class="Species">ments on postmenopausal osteoporosis (POP) is the increase in BMD. Estrogen deficiency, in both OVX rats and in postmenopausal women, can lead to a reduction in BMD (14,15). In the present study, treatment with ICA significantly improved BMD and effectively prevented the loss of bone mass caused by the OVX-induced lack of estrogen. The bone changes observed in the <span class="Chemical">OVX <span class="Species">rats, most notably a decline in BMD, are similar to those in postmenopausal osteoporotic women. ICA treatment significantly increased BMD in the OVX rats and can effectively prevent bone loss and be effective in the treatment of osteoporosis in the present study. Biomechan<span class="Chemical">ical testing showed that less force was needed to <span class="Disease">fracture the femur and vertebrae in OVX rats compared with sham-operated animals. Administration of ICA greatly improved the biomechanical properties, as demonstrated by the increased fracture force required to break the femur and vertebrae in OVX rats. Bone strength is associated with BMD, architecture, connectivity and mineralization (16). The results of the present study are consistent with those of this earlier study, in which ovariectomy resulted in reduced BMD as well as decreased biomechanical strength. In the <span class="Chemical">OVX <span class="Species">rats, the bone tissue pathology and the morphology of bone microstructure changed markedly. Bone microstructure is an important factor affecting the quality of bone. Both bone microstructure and bone mass together determined bone strength. In OVX rats, the trabecular bone was clearly reduced in thickess and length, with a fine rod- or button-shaped morphology. Parts of the trabecular bone were destroyed, or even disappeared, and there were significant lesions in the secondary spongy bone area. The number of trabecular surface absorption pouches increased noticeably and there was a visible osteoclast (OC) reaction. Treatment with ICA reduced trabecular bone lesions, particularly in the secondary spongy areas, and reduced the number of bone resorption pouches and OCs. ICA can effectively improve BMD, increase trabecular bone numbers and thickness, and reduce their degree of separation. The present study shows that an imbalance in the physiolog<span class="Chemical">ical processes of bone turnover, with loss of equilibrium between the activity of osteobl<span class="Gene">asts (OBs) and OC, contributes to the development of osteoporosis. Therapy at a molecular level should mainly aim to correct the imbalance between bone resorption and bone formation and thus protect skeletal integrity and reduce the risk of fractures. A previous study found that ICA strongly enhanced the differentiation and mineralization of OB in vitro (17), but the antiosteoporotic mechanism of ICA in vivo was not investigated. The present study indicates that ICA has the ability to correct the imbalance between bone resorption and bone formation in vivo. Changes in serum biochem<span class="Chemical">ical ind<span class="Chemical">icators reflect the balance of bone metabolism in the body. These changes can be used to evaluate bone conversion, and to objectively measure bone resorption and bone formation. OPG and BGP are widely accepted as phenotypic markers of bone formation (18). OPG is a key cytokine secreted by OB that plays an important role in bone remodeling (19,20). A negative correlation has been observed between OPG and BMD (21). BGP is regarded as a marker of bone turnover and serum levels of BGP have been shown to increase with increasing age (22). OPG produced by OB plays an essential role in the formation, differentiation and bone-resorbing activity of OC (23). It has been shown in the present study that OVX rats have reduced OPG activity compared with sham-operated animals. Administration of ICA to OVX rats upregulated OPG activity and downregulated BGP activity. In addition, the M-ICA dose did not cause liver or kidney damage. <span class="Chemical">ICA has been reported to enhance <span class="Disease">fracture healing (24), and treatment of OVX rats with ICA has been shown to ameliorate POP (6,25,26). The main cause of osteoporosis is an imbalance between bone resorption and bone formation; healthy bones are required to maintain a dynamic balance between OB and OC for appropriate bone remodeling (27). The <span class="Gene">Wnt receptors <span class="Gene">Lrp5/6 and Frizzled, when activated, promote phosphorylation of GSK-3β and block phosphorylation of β-catenin. Thus, the degradation of β-catenin is reduced and an increase in cytoplasmic and nuclear levels of β-catenin promotes pairing with the TCF/LEF family of transcription factors and activates the Wnt/β-catenin signaling pathway (28,29). Using RT-qPCR, the present study found that expression levels of Lrp6, β-catenin and Runx2 mRNA decreased significantly in OVX rats, while the expression of GSK-3β mRNA increased significantly. Western blot analysis of the tibia showed that β-catenin expression also decreased significantly in OVX rats at the protein level. Treatment with ICA significantly increased the expression of Lrp6, β-catenin and Runx2 mRNA and decreased the expression of GSK-3β mRNA. Upregulation of Lrp6 receptor should promote GSK-3β mRNA phosphorylation and increase the stability of intracellular β-catenin. Aggregation of β-catenin and transfer to the nucleus will activate the Wnt/β-catenin signaling pathway. This then activates the target gene, Runx2, which promotes OB proliferation and differentiation and inhibits OC differentiation (30–32). An ideal antiostoporotic agent should restore the balance between bone resorption and bone reconstruction, enhance bone strength and BMD, increase Th.N and reduce bone loss. The present in vivo study demonstrated that ICA effectively increased the BMD of the fourth and fifth vertebrae of the lumbar spine and femur in OVX rats. In addition, lumbar spinal Tb.N and Tb.Th were increased and Tb.Sp was reduced by ICA treatment. Bone strength was enhanced and bone loss was reduced. ICA was thus indicated to be an effective treatment for POP, that did not cause liver and kidney damage when used at an effective dosage. The action of ICA as an antiosteoporotic agent in OVX rats has been shown to involve upregulation of the expression of Lrp6 receptor mRNA and downregulation of GSK-3β mRNA. This promotes GSK-3β mRNA phosphorylation and increases the stability of intracellular β-catenin. The β-catenin aggregates and is transferred to the nucleus, where it activates the Wnt/β-catenin signaling pathway. The downstream target gene, Runx2, is then activated, promoting OB proliferation and differentiation and inhibiting OC differentiation and bone resorption. This restores the balance between bone resorption and bone reconstruction, enhances bone strength and BMD, increases Th.N and reduces bone loss, all of which contribute to the treatment of osteoporosis.
  29 in total

1.  Bone strength: the bottom line.

Authors:  T A Einhorn
Journal:  Calcif Tissue Int       Date:  1992-11       Impact factor: 4.333

Review 2.  Pharmacological effects and pharmacokinetic properties of icariin, the major bioactive component in Herba Epimedii.

Authors:  Chenrui Li; Qiang Li; Qibing Mei; Tingli Lu
Journal:  Life Sci       Date:  2015-01-26       Impact factor: 5.037

Review 3.  The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption.

Authors:  L C Hofbauer; S Khosla; C R Dunstan; D L Lacey; W J Boyle; B L Riggs
Journal:  J Bone Miner Res       Date:  2000-01       Impact factor: 6.741

4.  Osteoprotegerin: a novel secreted protein involved in the regulation of bone density.

Authors:  W S Simonet; D L Lacey; C R Dunstan; M Kelley; M S Chang; R Lüthy; H Q Nguyen; S Wooden; L Bennett; T Boone; G Shimamoto; M DeRose; R Elliott; A Colombero; H L Tan; G Trail; J Sullivan; E Davy; N Bucay; L Renshaw-Gegg; T M Hughes; D Hill; W Pattison; P Campbell; S Sander; G Van; J Tarpley; P Derby; R Lee; W J Boyle
Journal:  Cell       Date:  1997-04-18       Impact factor: 41.582

5.  Development and Interlaboratory Validation of a Simple Screening Method for Genetically Modified Maize Using a ΔΔC(q)-Based Multiplex Real-Time PCR Assay.

Authors:  Akio Noguchi; Kosuke Nakamura; Kozue Sakata; Nozomi Sato-Fukuda; Takumi Ishigaki; Junichi Mano; Reona Takabatake; Kazumi Kitta; Reiko Teshima; Kazunari Kondo; Tomoko Nishimaki-Mogami
Journal:  Anal Chem       Date:  2016-03-31       Impact factor: 6.986

6.  Glycogen synthase kinase-3α/β inhibition promotes in vivo amplification of endogenous mesenchymal progenitors with osteogenic and adipogenic potential and their differentiation to the osteogenic lineage.

Authors:  Alessandra Gambardella; Chandan K Nagaraju; Patrick J O'Shea; Sindhu T Mohanty; Lucksy Kottam; James Pilling; Michael Sullivan; Mounira Djerbi; Witte Koopmann; Peter I Croucher; Ilaria Bellantuono
Journal:  J Bone Miner Res       Date:  2011-04       Impact factor: 6.741

Review 7.  Bone resorption by osteoclasts.

Authors:  S L Teitelbaum
Journal:  Science       Date:  2000-09-01       Impact factor: 47.728

8.  Icariin is more potent than genistein in promoting osteoblast differentiation and mineralization in vitro.

Authors:  Hui-Ping Ma; Lei-Guo Ming; Bao-Feng Ge; Yuan-Kun Zhai; Peng Song; Cory J Xian; Ke-Ming Chen
Journal:  J Cell Biochem       Date:  2011-03       Impact factor: 4.429

9.  Icariin protects against bone loss induced by oestrogen deficiency and activates oestrogen receptor-dependent osteoblastic functions in UMR 106 cells.

Authors:  Sao-Keng Mok; Wen-Fang Chen; Wan-Ping Lai; Ping-Chung Leung; Xin-Luan Wang; Xin-Sheng Yao; Man-Sau Wong
Journal:  Br J Pharmacol       Date:  2010-01-27       Impact factor: 8.739

10.  Lrp5 functions in bone to regulate bone mass.

Authors:  Yajun Cui; Paul J Niziolek; Bryan T MacDonald; Cassandra R Zylstra; Natalia Alenina; Daniel R Robinson; Zhendong Zhong; Susann Matthes; Christina M Jacobsen; Ronald A Conlon; Robert Brommage; Qingyun Liu; Faika Mseeh; David R Powell; Qi M Yang; Brian Zambrowicz; Han Gerrits; Jan A Gossen; Xi He; Michael Bader; Bart O Williams; Matthew L Warman; Alexander G Robling
Journal:  Nat Med       Date:  2011-05-22       Impact factor: 53.440

View more
  19 in total

Review 1.  Mechanical stimuli-mediated modulation of bone cell function-implications for bone remodeling and angiogenesis.

Authors:  Wenqing Liang; Xudong Wu; Yongqiang Dong; Xuerong Chen; Ping Zhou; Fangming Xu
Journal:  Cell Tissue Res       Date:  2021-10-19       Impact factor: 5.249

2.  Integration of summary data from GWAS and eQTL studies identified novel causal BMD genes with functional predictions.

Authors:  Xiang-He Meng; Xiang-Ding Chen; Jonathan Greenbaum; Qin Zeng; Sheng-Lan You; Hong-Mei Xiao; Li-Jun Tan; Hong-Wen Deng
Journal:  Bone       Date:  2018-05-12       Impact factor: 4.398

3.  Icariin prevents bone loss by inhibiting bone resorption and stabilizing bone biological apatite in a hindlimb suspension rodent model.

Authors:  Jin-Peng He; Xiu Feng; Ju-Fang Wang; Wen-Gui Shi; He Li; Sergei Danilchenko; Aleksei Kalinkevich; Mykhailo Zhovner
Journal:  Acta Pharmacol Sin       Date:  2018-06-11       Impact factor: 6.150

Review 4.  Prevention and Treatment of Osteoporosis Using Chinese Medicinal Plants: Special Emphasis on Mechanisms of Immune Modulation.

Authors:  Hongyan Zhao; Ning Zhao; Peng Zheng; Xiaohong Xu; Meijie Liu; Dan Luo; Huihui Xu; Dahong Ju
Journal:  J Immunol Res       Date:  2018-02-20       Impact factor: 4.818

5.  Secretome analysis of rat osteoblasts during icariin treatment induced osteogenesis.

Authors:  Weiqing Qian; Yan Su; Yajie Zhang; Nianwei Yao; Nin Gu; Xu Zhang; Hong Yin
Journal:  Mol Med Rep       Date:  2018-03-09       Impact factor: 2.952

6.  Icariin Alleviates Glucocorticoid-Induced Osteoporosis through EphB4/Ephrin-B2 Axis.

Authors:  Mi Huang; Ying Wang; Rui Peng
Journal:  Evid Based Complement Alternat Med       Date:  2020-05-17       Impact factor: 2.629

7.  Icariin promotes the migration of bone marrow stromal cells via the SDF-1α/HIF-1α/CXCR4 pathway.

Authors:  Haiyan Zhu; Xuxia Wang; Yuanyuan Han; Wenjuan Zhang; Wei Xin; Xiaotao Zheng; Jun Zhang
Journal:  Drug Des Devel Ther       Date:  2018-11-22       Impact factor: 4.162

Review 8.  Fructus Ligustri Lucidi in Osteoporosis: A Review of its Pharmacology, Phytochemistry, Pharmacokinetics and Safety.

Authors:  Beibei Chen; Lili Wang; Lin Li; Ruyuan Zhu; Haixia Liu; Chenyue Liu; Rufeng Ma; Qiangqiang Jia; Dandan Zhao; Jianzhao Niu; Min Fu; Sihua Gao; Dongwei Zhang
Journal:  Molecules       Date:  2017-09-05       Impact factor: 4.411

9.  PLGA scaffold carrying icariin to inhibit the progression of osteoarthritis in rabbits.

Authors:  Chang Fu Zhao; Zhen Hua Li; Shao Jun Li; Jian An Li; Ting Ting Hou; Yang Wang
Journal:  R Soc Open Sci       Date:  2019-04-10       Impact factor: 2.963

10.  Inhibitory effect of icariin on osteosarcoma cell proliferation via the Wnt/β-catenin signaling pathway.

Authors:  Yuxin Ren; Fuqiang Zhu; Zhendong Liu
Journal:  Oncol Lett       Date:  2018-05-29       Impact factor: 2.967

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.