Literature DB >> 27331115

Data in support of qPCR primer design and verification in a Pink1 -/- rat model of Parkinson disease.

Cynthia A Kelm-Nelson1, Sharon A Stevenson2, Michelle R Ciucci3.   

Abstract

Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1].

Entities:  

Year:  2016        PMID: 27331115      PMCID: PMC4909782          DOI: 10.1016/j.dib.2016.05.056

Source DB:  PubMed          Journal:  Data Brief        ISSN: 2352-3409


Specifications table

Value of the data

Data presented here allows for experimental replication. Data can be used as a benchmark for other researchers using rat brain tissue. Primers can then be manufactured and used in alternative models of Parkinson disease and then compared to this data set.

Data

Table 1 describes the rat (Rattus norvegicus) primer information including gene name, gene abbreviation, GenBank® accession numbers, experimental primer sequences, melt temperature and product length (base pairs) for each gene (Pink1, Asyn, Th, D1, D2, Atp13a2, Gba, Cflar, Gabrb2, Gad1, Gad2) as well as reference genes (Gapdh, βactin).
Table 1

Rattus norvegicus primer information.

GeneGene abbreviationAccession numberDirectionSequencesT (°C)Product (bp)
Gapdh glyceraldehyde-3-phosphate dehydrogenaseGapdhNM_017008.4ForwardGGATACTGAGAGCAAGAGAGA59106
ReverseTTATGGGGTCTGGGATGGAA















Actb actin, betaβactinNM_031144.3ForwardTGTGGATTGGTGGCTCTATC59149
ReverseAGAAAGGGTGTAAAACGCAG















Pink1 PTEN induced putative kinase 1Pink1Primers created from Dave et al. [2]ForwardCATGGCTTTGGATGGAGAGT58n/a
ReverseTGGGAGTTTGCTCTTCAAGG















Snca synuclein, alpha (non-A4 component of amyloid precursor)AsynNM_019169.2ForwardTCAGCCCAGAGCCTTTCAC58165
ReverseAGCCACAACTCCCTCCTTG















Th tyrosine hydroxylaseThNM_012740.3ForwardCTTTGACCCAGACACAGCA59123
ReverseTGGATACGAGAGGCATAGTTC















Drd1 dopamine receptor D1D1NM_012546.2ForwardGCTGGCTCCCTTTCTTCATC60111
ReverseCACCCAAACCACACAAACAC















Drd2 dopamine receptor D2D2NM_012547.1ForwardTCCTTGACCTTCCTCTTGGG60188
ReverseCCTGACACTGATGTTGCCTG















Atp13a2 ATPase type 13A2Atp13a2NM_001173432.1ForwardCTTCTCTCTGTCTGGCTTCC6095
ReverseTCCTCAGTCCGTTGGTGTAG















Gba glucosidase, beta, acidGbaNM_001127639.1ForwardGAGCAGAGTGTTCGGTTAGG60115
ReverseGATTCAGGGCAAGGTTCCAG















Cflar CASP8 and FADD-like apoptosis regulatorCflarNM_001033864.2ForwardGTGCTGCTGATGGAGATTGG60107
ReverseCTCTTGTCCTTGGCTACCTTG















Gabrb2 gamma-aminobutyric acid (GABA) A receptor, beta 2Gabrb2NM_012957.2ForwardGGTGCTTTGTCTTTGTCTTTATGG61130
ReverseCGCATCTTCTCGTTGTTGG















Gad1 glutamate decarboxylase 1Gad1NM_017007.1ForwardGACACTTGAACAGTAGAGACCC61116
ReverseTGTAGGACGCAGGTTGGTAG















Gad2 glutamate decarboxylase 2Gad2NM_012563.1ForwardCCAGGCTCATCGCATTCAC61190
ReverseGCACTCACCAGGAAAGGAAC
Table 2 describes the results of Sanger sequencing of qPCR reaction product for each amplification product from the University of Wisconsin Biotechnology Center. Confirmed results presented are FASTA sequences confirmed through NCBI Nucleotide BLAST software.
Table 2

Results of Sanger sequencing of qPCR reaction product.

GeneFASTA (Aligned Sequence)
GapdhATCCCAACTCGGCCCCCAACACTGAGCATCTCCCTCACAATTTCCATCCCAGACCCCCATAA
βactinAGATGTGGATCAGCAAGCAGGAGTACGATGAGTCCGGCCCCTCCATCGTGCACCGCAAATGCTTCTAGGCGGACTGTTAC
PINK1CTCTTCTCATTTTTCCCGACCAC
AsynGGGGAAAACAGGAGGAATCAGAGTTCTGCGGAAGCCTAGAGAGCCGTGTGGAGCAAAGATACATCTTTAGCCATGGATGT
ThCCAGCCTGTGTACTTTGTGTCCGAGAGCTTCAATGACGCCAAGGACAAGCTCAGG
D1GGCTCCCTTTCTTCATCTCGAACTGTATGGTGCCCTTCTGTGGCTCTGAGGAGACCCAGCCAT
D2TTCCTTGACCTTCCTCTTGGGCACAGAAACTAGCTCAGTGGTCGAGCACACCCTGATCGCTGG
Atp13a2CGGTGTCTAAGGGGGCACCCTTCCGCCAGCCGCTCTACACCAACGGACTGAGGAA
GbaGCAACTGTTACCACGTCAATTCCATG
CflarCTGATGGAGATTGGGGAGAATTTGAATCAATCTGATGTATCCTCCTTAATTT
Gabrb2TCTTCTTTGGGAGAGGACCCCAGCGCCAAAAGAAAGCAGCTGAGAAAGCTGCTAATGCCAACAACGAGAAGATGCG
Gad1GCATCTTCCACGCCTTCGCCTGCAACCTCCTCGAACGCGGGAGCGGATCCTAATACTACCAACCTGCGTCCTACAA
Gad2GCCTTGGGGATCGGAACAGACAGCGTGATTCTGATTAAATGTGATGAGAGAGGGAAAATGATCCCATCTGACCTTGAAAG

Experimental design, materials and methods

Netprimer (PREMIER Biosoft, Palo Alto, CA, USA) was used to examine secondary structure of all primers designed through NCBI Primer Blast to avoid primer products (Table 1). The Pink1 gene primer was used based on a previous publication [2]. Non-template controls were run with each primer pair to check for formation of primer-dimers and non-specific amplification products. Specificity for each primer pair was confirmed using melt curve analysis; all primer runs yielded single peak melt curves indicating amplification of single gene products. Furthermore, the qPCR reaction product for each gene was sequenced using Sanger sequencing with both forward and reverse primers at the University of Wisconsin Biotechnology Center (Table 2). FASTA sequences were entered into the NCBI Nucleotide BLAST software to confirm that sequences matched intended targets.
Subject areaBiology
More specific subject areaNeurobiology of disease
Type of dataTables
How data was acquiredNational Center for Biotechnology Information (NCBI) Primer Blast was used to design primers and Sanger sequencing was used for primer confirmation.
Data formatRaw
Experimental factorsNetprimer® (PREMIER Biosoft, Palo Alto, CA, USA) was used to examine secondary structure of all primers designed through NCBI Primer Blast to avoid primer products. Non-template controls were run with each primer pair to check for formation of primer-dimers and non-specific amplification products.
Experimental featuresSpecificity for each primer pair was confirmed using melt curve analysis; all primer runs yielded single peak melt curves indicating amplification of single gene products. Furthermore, the qPCR reaction product for each gene was sequenced using Sanger sequencing with both forward and reverse primers at the University of Wisconsin Biotechnology Center to confirm that sequences match intended targets.
Data source locationMadison, Wisconsin, USA
Data accessibilityData are within this article
  2 in total

1.  Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease.

Authors:  Cynthia A Kelm-Nelson; Sharon A Stevenson; Michelle R Ciucci
Journal:  Neurosci Lett       Date:  2016-04-04       Impact factor: 3.046

2.  Phenotypic characterization of recessive gene knockout rat models of Parkinson's disease.

Authors:  Kuldip D Dave; Shehan De Silva; Niketa P Sheth; Sylvie Ramboz; Melissa J Beck; Changyu Quang; Robert C Switzer; Syed O Ahmad; Susan M Sunkin; Dan Walker; Xiaoxia Cui; Daniel A Fisher; Aaron M McCoy; Kevin Gamber; Xiaodong Ding; Matthew S Goldberg; Stanley A Benkovic; Meredith Haupt; Marco A S Baptista; Brian K Fiske; Todd B Sherer; Mark A Frasier
Journal:  Neurobiol Dis       Date:  2014-06-24       Impact factor: 5.996

  2 in total
  2 in total

1.  Quantitative Analysis of Catecholamines in the Pink1 -/- Rat Model of Early-onset Parkinson's Disease.

Authors:  Cynthia A Kelm-Nelson; Michael A Trevino; Michelle R Ciucci
Journal:  Neuroscience       Date:  2018-02-27       Impact factor: 3.590

Review 2.  Animal Models for Dysphagia Studies: What Have We Learnt So Far.

Authors:  Rebecca Z German; A W Crompton; Francois D H Gould; Allan J Thexton
Journal:  Dysphagia       Date:  2017-01-28       Impact factor: 3.438

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.