| Literature DB >> 27313510 |
Sabrina Reinehr1, Jacqueline Reinhard2, Marcel Gandej1, Sandra Kuehn1, Rozina Noristani1, Andreas Faissner2, H Burkhard Dick1, Stephanie C Joachim1.
Abstract
Glaucoma is a multifactorial disease and especially mechanisms occurring independently from an elevated intraocular pressure (IOP) are still unknown. Likely, the immune system contributes to the glaucoma pathogenesis. Previously, IgG antibody depositions and retinal ganglion cell (RGC) loss were found in an IOP-independent autoimmune glaucoma model. Therefore, we investigated the possible participation of the complement system in this model. Here, rats were immunized with bovine optic nerve homogenate antigen (ONA), while controls (Co) received sodium chloride (n = 5-6/group). After 14 days, RGC density was quantified on flatmounts. No changes in the number of RGCs could be observed at this point in time. Longitudinal optic nerve sections were stained against the myelin basic protein (MBP). We could note few signs of degeneration processes. In order to detect distinct complement components, retinas and optic nerves were labeled with complement markers at 3, 7, 14, and 28 days and analyzed. Significantly more C3 and MAC depositions were found in retinas and optic nerves of the ONA group. These were already present at day 7, before RGC loss and demyelination occurred. Additionally, an upregulation of C3 protein was noted via Western Blot at this time. After 14 days, quantitative real-time PCR revealed significantly more C3 mRNA in the ONA retinas. An upregulation of the lectin pathway-associated mannose-serine-protease-2 (MASP2) was observed in the retinas as well as in the optic nerves of the ONA group after 7 days. Significantly more MASP2 in retinas could also be observed via Western Blot analyses at this point in time. No effect was noted in regard to C1q. Therefore, we assume that the immunization led to an activation of the complement system via the lectin pathway in retinas and optic nerves at an early stage in this glaucoma model. This activation seems to be an early response, which then triggers degeneration. These findings can help to develop novel therapy strategies for glaucoma patients.Entities:
Keywords: C3; MAC; MASP2; complement system; glaucoma; lectin pathway; optic nerve; retinal ganglion cells
Year: 2016 PMID: 27313510 PMCID: PMC4887475 DOI: 10.3389/fncel.2016.00140
Source DB: PubMed Journal: Front Cell Neurosci ISSN: 1662-5102 Impact factor: 5.505
Primary and secondary antibodies applied for immunohistochemistry of retinal and optic nerve tissue.
| Primary antibodies | Secondary antibodies | ||||||
|---|---|---|---|---|---|---|---|
| Antibody | Company | Tissue | Dilution | Antibody | Company | Tissue | Dilution |
| Brn-3a | Santa Cruz | Retina | 1:100 | Donkey anti-goat Alexa Fluor 488 | Dianova | Retina | 1:1000 |
| C1q | Quidel | Retina | 1:2500 | Donkey anti-goat IgG Cy3 | Abcam | Retina | 1:750 |
| C3 | Cedarlane | Retina | 1:500 | Goat anti-rabbit IgG Cy 3 | Linaris | Retina | 1:500 |
| Optic nerve | 1:500 | Optic nerve | 1:500 | ||||
| C5b-9 (MAC) | Biozol | Retina | 1:100 | Donkey anti-mouse Dy Light 488 | Dianova | Retina | 1:250 |
| Optic nerve | 1:100 | Goat anti-mouse Alexa Flour 488 | Invitrogen | Optic nerve | 1:500 | ||
| MASP2 | Biozol | Retina | 1:400 | Donkey anti-rabbit Alexa Fluor 555 | Invitrogen | Retina | 1:400 |
| Optic nerve | 1:100 | Optic nerve | 1:700 | ||||
| MBP | Millipore | Optic nerve | 1:100 | Goat anti-mouse Alexa Flour 488 | Invitrogen | Optic nerve | 1:500 |
Sequences of oligonucleotide pairs.
| Gene | Forward (F) and reverse (R) oligonucleotides | GenBank accession number | Amplicon size |
|---|---|---|---|
| β | cccgcgagtacaaccttct | NM_031144.3 | 72 bp |
| cgggtctcaaaggagagagag | NM_001008515.1 | 88 bp | |
| gcactccagggataaaagga | NM_019262.1 | 75 bp | |
| tcgaaatccctcccaagtc | NM_016994.2 | 60 bp | |
| tctcaggccaaagagagacc | XM001079130.4 | 73 bp | |
| tgctggaccaaacacaaatg | M19553.1 | 88 bp | |
| gctggaagatacactacacaagca | NM_172043.1 | 76 bp |
(A,B) Histological detection of complement factors in the retina.
| (A) | ||||||
|---|---|---|---|---|---|---|
| Co | 12.44 ± 1.39 | 18.38 ± 2.67 | 15.64 ± 1.81 | |||
| ONA | 13.02 ± 1.92 | 0.81 | 27.25 ± 2.64 | 14.80 ± 1.75 | 0.75 | |
| Co | 6.66 ± 0.85 | 7.31 ± 1.81 | 13.49 ± 3.09 | |||
| ONA | 6.11 ± 1.76 | 0.78 | 15.94 ± 2.98 | 15.15 ± 0.92 | 0.62 | |
| Co | 0.29 ± 0.19 | 12.28 ± 2.65 | 9.20 ± 0.93 | |||
| ONA | 0.80 ± 0.46 | 0.33 | 12.61 ± 3.59 | 0.94 | 7.02 ± 1.65 | 0.28 |
| Co | 1.29 ± 0.45 | 6.03 ± 1.75 | 7.91 ± 2.08 | |||
| ONA | 1.49 ± 0.66 | 0.81 | 13.49 ± 2.64 | 4.63 ± 1.17 | 0.21 | |
| Co | 23.25 ± 2.33 | |||||
| ONA | 31.06 ± 1.40 | |||||
| Co | 7.89 ± 0.56 | |||||
| ONA | 18.72 ± 1.34 | |||||
Histological detection of complement components in the optic nerve.
| Optic nerve | 3 days | 7 days | 14 days | |||
|---|---|---|---|---|---|---|
| Co | 4.26 ± 0.18 | 4.18 ± 0.29 | 3.13 ± 0.16 | |||
| ONA | 4.30 ± 0.11 | 0.98 | 5.49 ± 0.25 | 3.27 ± 0.15 | 0.79 | |
| Co | 0.08 ± 0.04 | 0.29 ± 0.08 | 0.35 ± 0.13 | |||
| ONA | 0.13 ± 0.05 | 0.78 | 1.78 ± 0.31 | 0.36 ± 0.15 | 0.99 | |
| Co | 6.11 ± 1.56 | 4.32 ± 0.43 | 2.63 ± 0.70 | |||
| ONA | 8.30 ± 1.11 | 0.38 | 7.26 ± 0.46 | 2.28 ± 0.49 | 0.91 |
Analyses of complement components via quantitative real-time PCR.
| 3 days | 7 days | 14 days | |
|---|---|---|---|
| β | 1.09 | 1.09 | 1.31 |
| 0.92 | 0.92 | 0.76 | |
| 1.19 (0.48–3.35) | 0.91 (0.58–1.22) | 0.71 (0.58–0.90) | |
| 0.61 | 0.73 | 0.07 | |
| 1.03 (0.33–2.71) | 0.70 (0.49–1.06) | 0.8 (0.50–1.51) | |
| 0.84 | 0.22 | 0.59 | |
| 0.55 (0.24–1.09) | 0.61 (0.46–0.99) | 1.94 (1.58–2.34) | |
| 0.16 | 0.25 | ||
| 0.73 (0.39–1.42) | 1.66 (1.37–2.12) | 0.81 (0.67–0.98) | |
| 0.29 | 0.08 | 0.18 | |
| 1.03 (0.65–1.63) | 0.57 (0.28–0.89) | 1.61 (1.04–1.31) | |
| 0.92 | 0.17 | 0.09 |