Literature DB >> 27308262

Prevalence of interleukin-28B single nucleotide polymorphism genotypes in patients with hepatitis C infection in Isfahan, Iran.

Mohammad Minakari1, Marjan Golshani1, Majid Yaran2, Behrooz Ataei3.   

Abstract

BACKGROUND: Hepatitis C infection is one of the most common causes of liver-related morbidity and mortality. Due to limited efficacy and side-effects of treatment, identification of the determinants of response to treatment is an important issue. Nowadays, genotyping of interleukin (IL)-28B is one of the strongest tests used for prediction of sustained virological response. The prevalence of IL28B genotypes varies across different ethnicities. This study presents data on IL28B single nucleotide polymorphism (SNP) (rs12979860) in a group of Iranian hepatitis C virus (HCV)-infected patients in Isfahan.
MATERIALS AND METHODS: One hundred patients already diagnosed for hepatitis C enrolled the study. Genomic DNA was extracted from whole blood samples. Specific primers were used to amplify IL28B gene (rs12979860). The rs129679860 SNP was genotyped by real-time polymerase chain reaction using TaqMan(®) probes.
RESULTS: The mean age of patients was 33.16 years (25-42 years). Ninety-nine subjects were male and 1 was female. The frequency of HCV genotypes was as follows: Genotype 3a: 53%, genotype 1a: 42%, genotype 1b: 2%, mixed genotype (1a + 3a): 1% and 2%: Nontypable. IL28B rs12979860 genotypes were TT in 17 patients (17%), CT in 41 patients (41%), and CC in the remaining 42 patients (42%).
CONCLUSION: The prevalence of C allele is much higher in our population study than in African American HCV patients (62.5% and 40% respectively), which can explain better response to treatment in our patients.

Entities:  

Keywords:  Genotype; Isfahan; hepatitis C; interleukin-28B

Year:  2016        PMID: 27308262      PMCID: PMC4908785          DOI: 10.4103/2277-9175.183138

Source DB:  PubMed          Journal:  Adv Biomed Res        ISSN: 2277-9175


INTRODUCTION

Hepatitis C infection is one of the most common causes of liver-related morbidity and mortality.[1] Many hepatitis C virus (HCV) infected individuals are living worldwide and 8,000–10,000 people die because of this infection, annually. It is a major cause of cirrhosis and hepatocellular carcinoma, too. It is estimated that the occurrence of end-stage liver disease caused by HCV reaches a peak around 2020.[23] In Iran, HCV infection has a prevalence of <1%. HCV genotype 1a is the most frequent genotype (about 45%), followed by genotype 3a (more prevalent in the northwest of the country) and 1b.[45] Only 40–60% of patients infected with HCV genotype 1 achieve sustained virological response (SVR) after treatment with pegylated interferon plus ribavirin, and many of them will not be cured.[6] Treatment is relatively expensive, and a large number of patients cannot afford it. Furthermore, treatment may cause many undesirable side-effects and some patients poorly tolerate the regimen because of these side-effects.[78] Hence, selection of patients who are more prone to respond to treatment is very important.[79] Many factors such as HCV genotype, HCV RNA levels, the dose and duration of therapy, body mass index, age, insulin resistance, gender, stage of fibrosis, and co-infection with other hepatitis viruses or HIV can predict SVR.[10] In 2009, Tanaka et al. found a single nucleotide polymorphism (SNP) (rs12979860) in the upstream of interleukin (IL)-28B gene which was associated strongly with difference in treatment response of HCV infection.[6] Since that time, many studies have been designed and they showed that genotyping of IL28B was one of the strongest tests for prediction of SVR and its predictive value is higher for HCV genotype 1.[11121314] It has been found that the prevalence of IL28B genotypes vary across different ethnicities. This paper presents data on IL28B SNP (rs12979860) in a group of Iranian HCV-infected patients in Isfahan. We hope that the results will be a cornerstone for future researches.

MATERIALS AND METHODS

This is a descriptive cross-sectional study. One hundred patients already diagnosed for hepatitis C who were referred to Isfahan Infectious Research Center enrolled the study. The project was explained for them, and after they confirmed and agreed with the written informed consent, 5cc of their whole blood were obtained. Genomic DNA was extracted from whole blood samples by means of the high pure DNA template genomic kit (Roche) according to manufacturer's protocol. The rs129679860 SNP was genotyped by real-time polymerase chain reaction (RQ model, Qinagen) using TAQMAN probe method on DNA isolated from whole blood samples. Primers and probes were adopted from the study of Tillmann et al.[12] with the following sequences: Forward primer GCCTGTCGTGTACTGAACCA, reverse primer GCGCGGAGTGCAATTCAAC, and the probes TGGTTCGCGCCTTC (VIC) and CTGGTTCACGCCTTC (FAM), respectively.

RESULTS

Samples from 100 patients with chronic HCV infection were obtained, and genotypes of IL28 were determined. The mean age of patients was 33.16 years (25–42 years). 99 subjects were male and 1 was female. The frequency of HCV genotypes were as follow: Genotype 3a 53%, genotype 1a 42%, genotype 1b 2%, mixed genotype 1a + 3a 1% and 2% nontypable. Interleukin-28B rs12979860 genotypes were TT in 17 patients (17%), CT in 41 patients (41%), and CC in the remaining 42 patients (42%).

DISCUSSION

Treatment of HCV infection is frequently complicated, and discontinuation of drugs due to serious adverse events is not uncommon. Prediction of response to treatment and evaluating the risks and benefits of such therapy would allow us to make more logical decisions about treating HCV-infected patients.[9] As noted before, IL28B genotype is one of the strongest tests for prediction of SVR. Patients with CC genotype have a higher SVR rate than those with CT or TT genotypes.[315] Furthermore, there is an association between CC genotype and spontaneous clearance of hepatitis C infection. These patients less frequently progress to chronic hepatitis C.[12] We found that in hepatitis C infected patients in Isfahan, 42% of them had CC genotype, 41% had CT genotype and the remainder 17% had TT genotype. Our findings were similar to the results of Khajavi et al. who studied on HCV patients in Mazandaran province and found that the frequency of IL28B genotypes were as follow: 41.4% C/C genotype, 41.6% C/T genotype and 17.3% T/T genotype.[16] In 2011, Mahboobi et al. performed a study on patients with hepatitis C in Tehran and report that among HCV-infected patients, 52.9% have C/C, 39.7% have C/T and 7.3% have T/T genotypes.[17] Indeed, TT genotype has a higher frequency in Isfahan than in Tehran (17% vs. 7.3%). As mentioned previously, the frequency of IL28B gene alleles vary among different ethnicities, which can cause different treatment response rates. Previous studies showed that treatment response is higher among Iranian patients with hepatitis C infection. In African Americans, rs12979860 genotypes were TT in 37%, CT in 48%, and CC in 16% of patients. Comparison of the above data with our findings reveals that the frequency of C allele is much higher in our patients than in African American patients which can explain the higher treatment response rate among our patients.

Financial support and sponsorship

This project was funded by Isfahan University of Medical Sciences (project number 290258).

Conflicts of interest

There are no conflicts of interest.
  14 in total

1.  EASL Clinical Practice Guidelines: management of hepatitis C virus infection.

Authors: 
Journal:  J Hepatol       Date:  2011-03-01       Impact factor: 25.083

2.  Association of a single nucleotide polymorphism near the interleukin-28B gene with response to hepatitis C therapy in HIV/hepatitis C virus-coinfected patients.

Authors:  Norma I Rallón; Susanna Naggie; José M Benito; José Medrano; Clara Restrepo; David Goldstein; Kevin V Shianna; Eugenia Vispo; Alex Thompson; John McHutchison; Vincent Soriano
Journal:  AIDS       Date:  2010-05-15       Impact factor: 4.177

3.  IL28B SNP genotyping among Iranian HCV-infected patients: A preliminary report.

Authors:  Nastaran Mahboobi; Bita Behnava; Seyed Moayed Alavian
Journal:  Hepat Mon       Date:  2011-05       Impact factor: 0.660

Review 4.  The IL-28 genotype: how it will affect the care of patients with hepatitis C virus infection.

Authors:  Brian L Pearlman
Journal:  Curr Gastroenterol Rep       Date:  2011-02

5.  IL-28B rs12979860 C/T allele distribution in patients with liver cirrhosis: role in the course of chronic viral hepatitis and the development of HCC.

Authors:  Carlo Fabris; Edmondo Falleti; Annarosa Cussigh; Davide Bitetto; Elisabetta Fontanini; Sara Bignulin; Sara Cmet; Ezio Fornasiere; Elisa Fumolo; Stefano Fangazio; Andrea Cerutti; Rosalba Minisini; Mario Pirisi; Pierluigi Toniutto
Journal:  J Hepatol       Date:  2010-09-19       Impact factor: 25.083

6.  A polymorphism near IL28B is associated with spontaneous clearance of acute hepatitis C virus and jaundice.

Authors:  Hans L Tillmann; Alex J Thompson; Keyur Patel; Manfred Wiese; Hannelore Tenckhoff; Hans D Nischalke; Yuliya Lokhnygina; Ulrike Kullig; Uwe Göbel; Emanuela Capka; Johannes Wiegand; Ingolf Schiefke; Wolfgang Güthoff; Kurt Grüngreiff; Ingrid König; Ulrich Spengler; Jeanette McCarthy; Kevin V Shianna; David B Goldstein; John G McHutchison; Jörg Timm; Jacob Nattermann
Journal:  Gastroenterology       Date:  2010-07-14       Impact factor: 22.682

7.  Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: a genome-wide association study.

Authors:  Andri Rauch; Zoltán Kutalik; Patrick Descombes; Tao Cai; Julia Di Iulio; Tobias Mueller; Murielle Bochud; Manuel Battegay; Enos Bernasconi; Jan Borovicka; Sara Colombo; Andreas Cerny; Jean-François Dufour; Hansjakob Furrer; Huldrych F Günthard; Markus Heim; Bernard Hirschel; Raffaele Malinverni; Darius Moradpour; Beat Müllhaupt; Andrea Witteck; Jacques S Beckmann; Thomas Berg; Sven Bergmann; Francesco Negro; Amalio Telenti; Pierre-Yves Bochud
Journal:  Gastroenterology       Date:  2010-01-11       Impact factor: 22.682

8.  Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C.

Authors:  Yasuhito Tanaka; Nao Nishida; Masaya Sugiyama; Masayuki Kurosaki; Kentaro Matsuura; Naoya Sakamoto; Mina Nakagawa; Masaaki Korenaga; Keisuke Hino; Shuhei Hige; Yoshito Ito; Eiji Mita; Eiji Tanaka; Satoshi Mochida; Yoshikazu Murawaki; Masao Honda; Akito Sakai; Yoichi Hiasa; Shuhei Nishiguchi; Asako Koike; Isao Sakaida; Masatoshi Imamura; Kiyoaki Ito; Koji Yano; Naohiko Masaki; Fuminaka Sugauchi; Namiki Izumi; Katsushi Tokunaga; Masashi Mizokami
Journal:  Nat Genet       Date:  2009-09-13       Impact factor: 38.330

9.  IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy.

Authors:  Vijayaprakash Suppiah; Max Moldovan; Golo Ahlenstiel; Thomas Berg; Martin Weltman; Maria Lorena Abate; Margaret Bassendine; Ulrich Spengler; Gregory J Dore; Elizabeth Powell; Stephen Riordan; David Sheridan; Antonina Smedile; Vincenzo Fragomeli; Tobias Müller; Melanie Bahlo; Graeme J Stewart; David R Booth; Jacob George
Journal:  Nat Genet       Date:  2009-09-13       Impact factor: 38.330

10.  Genetic variation in IL28B and spontaneous clearance of hepatitis C virus.

Authors:  David L Thomas; Chloe L Thio; Maureen P Martin; Ying Qi; Dongliang Ge; Colm O'Huigin; Judith Kidd; Kenneth Kidd; Salim I Khakoo; Graeme Alexander; James J Goedert; Gregory D Kirk; Sharyne M Donfield; Hugo R Rosen; Leslie H Tobler; Michael P Busch; John G McHutchison; David B Goldstein; Mary Carrington
Journal:  Nature       Date:  2009-10-08       Impact factor: 49.962

View more
  1 in total

1.  IL28B gene polymorphism rs12979860, but not rs8099917, contributes to the occurrence of chronic HCV infection in Uruguayan patients.

Authors:  Natalia Echeverría; Daniela Chiodi; Pablo López; Adriana Sanchez Ciceron; Jenniffer Angulo; Marcelo López-Lastra; Paola Silvera; Adrian Canavesi; Carla Bianchi; Valentina Colistro; Juan Cristina; Nelia Hernandez; Pilar Moreno
Journal:  Virol J       Date:  2018-03-02       Impact factor: 4.099

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.