Literature DB >> 27303654

Expression, purification and immunochemical characterization of recombinant OMP28 protein of Brucella species.

Y Manat1, A V Shustov2, E Evtehova1, S Z Eskendirova1.   

Abstract

Brucellosis is the lion's share of infectious disease of animals and it has a particular socio-economic importance for the Republic of Kazakhstan. Sixty percent of epizootic outbreaks of brucellosis identified in the Commonwealth of Independent States (CIS) originated from Kazakhstan in recent years. Definitive diagnosis of brucellosis remains a difficult task. Precisely for this reason, we evaluated a purified recombinant out membrane protein 28 (rOMP28) of Brucella species (Brucella spp.) produced in Escherichia coli (E. coli) as a diagnostic antigen in an Indirect ELISA (I-ELISA) for bovine brucellosis. The gene encoding OMP28 was synthesized using a two-round PCR procedure. In order to produce the rOMP28, the de novo synthesized DNA was cloned into the expression vector pET-22b(+). Then, the rOMP28 was expressed in E. coli system and characterized in the present study. We further estimated the diagnostic potential of purified rOMP28 of Brucella spp. for screening bovine sera. To determine if rOMP28 has a valuable benefit for use in the serodiagnosis of bovine brucellosis, rOMP28-based I-ELISA was performed. Brucella spp. positive (n=62) and Brucella spp. negative (n=28) samples from tube agglutination test (TAT) were positive (n=59) and negative (n=27) by I-ELISA, respectively. These findings show that the rOMP28 of Brucella spp. could be a good candidate for improving serological diagnostic methods for bovine brucellosis.

Entities:  

Keywords:  Brucella spp; Brucellosis; I-ELISA; Western blot; rOMP28

Year:  2016        PMID: 27303654      PMCID: PMC4886644          DOI: 10.4314/ovj.v6i2.1

Source DB:  PubMed          Journal:  Open Vet J        ISSN: 2218-6050


Introduction

Brucellosis caused by Gram-negative, facultative, intracellular bacteria belonging to the genus Brucella. It is an emerging zoonosis, and an economically important infection of humans and animals with a worldwide distribution. Owing to its heterogeneous and poorly specific clinical symptomatology, the diagnosis of brucellosis always requires laboratory confirmation, either by isolation of the pathogen or by demonstration of specific antibodies. The slow growth of Brucella in culture may delay diagnosis for more than seven days. Furthermore, handling of these microorganisms poses a high risk to laboratory personnel, since Brucella spp. are class III pathogens (Christopher et al., 2010; Poester et al., 2010; Smirnova et al., 2013). The conventional serological tests, of which the most frequently used are the Rose Bengal test (RBT), the tube agglutination test (TAT) and the complement fixation test (CFT), principally measure antibodies against the immunodominant smooth lipopolysaccharide (S-LPS) of the bacterial cell membrane. The traditional serological test for diagnosing brucellosis in cattle in Kazakhstan is TAT. However, agglutination tests sometimes give false-positive results due to cross-reactions with other microorganisms. In addition, serological tests based on anti-LPS antibodies give false positives because of cross-reactivity with other Gram-negative bacteria such as Yersinia enterocolitica O:9, Salmonella spp. and Escherichia coli (Christopher et al., 2010; Smirnova et al., 2013). Outer membrane proteins (OMPs) of Brucella spp. have been the focus of vaccine development and the diagnosis of brucellosis (Cloeckaert et al., 2001; Gupta et al., 2010; Ko et al., 2012). OMP28 is considered as one of the outer membrane proteins of Brucella (Cha et al., 2012) and has been identified as an important diagnostic antigen in brucellosis (Seco-Mediavilla et al., 2003; Poester et al., 2010). OMP28 is highly conserved among B. abortus, B. suis, B. ovis, B. canis, B. neotomae and B. melitensis. Recombinant OMP28 was sensitive and specific for diagnosis of Brucella infection in animals by indirect enzyme-linked immunosorbent assay (I-ELISA) (Kumar et al., 2008; Gupta et al., 2010; Thavaselvam et al., 2010; Liu et al., 2011; Dong-Bao et al., 2012; Lim et al., 2012; Qiu et al., 2012; Azizpour et al., 2013; Kim et al., 2013; Xin et al., 2013).

Materials and Methods

Reagents and equipment

All primers were synthesized by Invitrogen corporation (Invitrogen, USA). A Bio-Rad T100™ Thermal Cycler was used for PCR. E.coli laboratory strain BL21 (DE3) was obtained from Novagen. HisTrap FF crude was sourced from GE Healthcare life sciences. Bovine serum samples [positive (62) and negative (28) well known serum samples of bovine infected with Brucella spp.] were obtained from the RSE “Republican Veterinary Laboratory,” the Ministry of Agriculture of RK. All chemicals used in this study were of analytical grade and purchased from Sigma (Str. Louis, MO).

De novo synthesis of OMP28 gene

The gene encoding the OMP28 was synthesized in a constructive PCR using long oligonucleotides as primers. First, amino acid sequences of the OMP28 protein of Brucella spp. were downloaded from Genbank and compared in a multiple alignment. The in silico designed sequence for the OMP28 is shown in Fig. 1. This gene was codon-optimized for expression in E.coli. The vector NTI suite was used for reverse translation coupled with codon-optimization for heterologous species (E.coli K12).
Fig. 1

The nucleotide sequence of OMP28 used for the internal (OMP1-OMP20) and flanking (OMP_Fau and OMP_EcoR) primers. The DNA sequences used for primer design are shown by arrows.

The nucleotide sequence of OMP28 used for the internal (OMP1-OMP20) and flanking (OMP_Fau and OMP_EcoR) primers. The DNA sequences used for primer design are shown by arrows. The DNAWorks v3.2.2 was used to calculate sequences of primers for the de novo synthesis of DNA fragments. The primers used for the de novo gene synthesis are listed in Table 1. These primers were designed for use in PCR with annealing temperature of 62°C in presence of 50 mmol/L Na+ and 2 mmol/L Mg2+. In the constructive PCR procedure, these primers were divided into two groups and designated as “internal” or “flanking” primers. Each of the internal primers was 100% homologous to the corresponding region in the sequence to be synthesized. Internal primers were interleaved in the sense-antisense-sense-antisense manner. The whole set of internal primers covered the entire length of the DNA fragment to be synthesized except for the very 5’- and 3’-terminal linkers. The terminal linkers with restriction sites for subsequent cloning were included in the flanking primers.
Table 1

Primers for synthesis of OMP28 gene.

NameSequence (5’-3’)Internal or flanking
OMP1CCACCATATGGCCATGGGGATGAATACAAGGGCATCTAACTTTTTAGCCInternal
OMP2AAAAGGCCCCAACAAGCATAATAGTCGAGAAGGAAGCGGCTAAAAAGTTAGATGCCCTTGInternal
OMP3ATGCTTGTTGGGGCCTTTTCTCTGCCGGCGTTCGCACAAGAGAACCAGATGACTACCCAGInternal
OMP4GGTCATCATTCCTTCGCCCGTGACGGCGATTCTCGCCGGCTGGGTAGTCATCTGGTTCTCInternal
OMP5GGGCGAAGGAATGATGACCGCAAGTCCAGATATGGCAATCCTGAACCTGTCCGTGCTACGInternal
OMP6TCATTGTTTGCAGTCATTGCTTCGCGTGCCGTCTTTGCCTGGCGTAGCACGGACAGGTTCInternal
OMP7AGCAATGACTGCAAACAATGAGGCAATGACCAAAGTGTTGGACGCAATGAAAAAAGCAGGInternal
OMP8AATGTTAATCCCTCCTGTTTGTAGATCTCTGTCTTCAATGCCTGCTTTTTTCATTGCGTCInternal
OMP9CTACAAACAGGAGGGATTAACATTCAACCAATATATGTCTATCCGGATGATAAAAACAACInternal
OMP 10CTGACGCTGTAACCAGTTATGGTTGGTTCTTTCAGGTTGTTTTTATCATCCGGATAGACAInternal
OMP 11CCATAACTGGTTACAGCGTCAGTACAAGCTTAACAGTTCGGGTTCGTGAGCTTGCCAATGInternal
OMP 12GTTAACGCCTAATGTGACGCTTTCATCAAGAATTTTGCCCACATTGGCAAGCTCACGAACInternal
OMP 13GCGTCACATTAGGCGTTAACCAGGGTGGTGATCTGAACCTGGTGAATGATAATCCATCGGInternal
OMP 14GTTGGCCACCGCACGTTTACGTGCCTCATTGATGACTGCCGATGGATTATCATTCACCAGInternal
OMP 15CGTGCGGTGGCCAACGCAATCGCAAAAGCGAAGACGCTGGCTGATGCCGCAGGCGTAGGTInternal
OMP 16CATTGGTGGGCGACTCAGTTCCGAAATTTCAACCACACGGCCGAGACCTACGCCTGCGGCInternal
OMP 17CTGAGTCGCCCACCAATGCCCATGCCCATTGCACGTGGACAATTTAGAACTATGGTCGCAInternal
OMP 18CACCCGCCGCGATAGGCACCGAGTTATCGGGGGCTGCTGCGACCATAGTTCTAAATTGTCInternal
OMP 19CCTATCGCGGCGGGTGAAAATTCATATAACGTCTCTGTAAATGTTGTCTTTGAAATCAAAInternal
OMP 20CCACGAATTCTCGAGTTATTTGATTTCAAAGACAACATTTACAGAInternal
OMP_FauCCACCATATGGCCATGGGGATGAATACflanking
OMP_EcoRCCACGAATTCTCGAGTTATTTGATTTCflanking
Primers for synthesis of OMP28 gene. The de novo synthesis of OMP28 gene was performed as a two-round PCR. Phusion HotStart DNA polymerase (Thermo Scientific) was used to avoid PCR errors. The mixture of 20 internal primers (each at 0.4 pmol/L final concentration) was subjected to the first round of PCR. The external template was not added to reactions in the first round. A total 30 cycles were carried out as following: denaturation at 95°C for 1 min, annealing at 60°C for 1 min and extension at 72°C for 1 min. The PCR products of the first round were diluted 1:10 with water and 1 μL of the first round PCR product was used in the second round of PCR amplification. For the second round of PCR, a pair of flanking primers (each at 2 pmol/L final concentration) was used. The product of the second round PCR was expected to be 787 bp in length. The PCR products were subjected to electrophoresis in 1% agarose gels, cloned into pGEM-T using the pGEM-T Easy Cloning kit (Promega) and sequenced. Double strand automated sequencing was performed for confirmation of the identity of the cloned fragment to the designed sequence of the gene.

Protein expression and purification

E.coli BL21(DE3) were transformed with the plasmid pET-22b(+) carrying the gene of OMP28 and grown on solid LB/ampicillin (100 μg/mL) plates at 37°C overnight. A single colony was selected to grow a 5mL starter culture overnight at 37°C. The starter culture was inoculated into 500mL LB/ampicillin (100 μg/mL) and incubated at 37°C with shaking until the OD600 reached 0.6. Expression of recombinant OMP28 was induced by addition of IPTG to a final concentration of 0.5 mmol/L and expression was continued for 12 h at 25°C. Finally cells were harvested and collected by centrifugation (at 6000xg for 10 min at 4°C) and washed twice with distilled water (20 mL). In order to ascertain the localization of the expressed recombinant protein, cells were resuspended in 20 mL lysis buffer (20% sucrose; 20mM HEPES pH 7.5; 5mM EDTA; 0.1% Triton X-100), [10mL lysis buffer per gram wet weight cells], followed by the addition of 2mL lysozyme (final concentration is 1mg/mL), 20 µl DNase (final concentration is 0.01mg/mL)and 200 µl RNase (final concentration is 0.1mg/mL). IPTG was added to a final concentration of 0.2 mM and further incubated at room temperature for 1 hr. The bacterial cell suspension was then sonicated for 10 min with a pulse interval of 5 s (OMNI-Ruptor 4000) in an ice-water bath. The lysate was centrifuged at 6000xg for 30 min at 4°C, supernatant discarded and the pellet was resuspended in 5mL of lysis buffer, then sonicated for 7 min with a pulse interval of 5 s. The sonicated extract was centrifuged at 6000xg for 10 min at 4°C. In this way, inclusion bodies were obtained, followed by resuspention of the inclusion body with buffer A (20mM Na3PO4 pH 7,4; 500mM NaCl; 20mM imidazole, 8 M urea), sonicated 50 % level 4-5, one pulse, incubated for 1 hr at room temperature, then centrifuged at 8000xg for 30 min, carefully collected the supernatant (discarded the pellet). The supernatant and inclusion bodies, with appropriate controls and molecular mass markers, were analyzed by 12% SDS-PAGE, as described by Laemmli (1970). After confirmation of the solubility, purification of the rOMP28 from inclusion bodies was carried out using a HisTrap FF crude with a native purification protocol as specified by the manufacturer: removed the snap-off end at the column outlet, then washed the column with 5 column volumes of distilled water (5mL). Equilibrated the column with 5 column volumes of binding buffer (buffer A containing 8M urea), then applied pretreated sample using a syringe and collected in a separate tube as Flowthrough, followed by washing with buffer A (5mL). Column and buffers (buffer A, buffer B) were then connected to the GE Healthcare chromatography system and equilibration started. The purified protein was checked by 12% SDS-PAGE followed by Coomassie blue staining, and protein concentration was estimated by the Bradford method.

Immunoreactivity of rOMP28 Brucella proteins to bovine sera using Western blot and indirect ELISA

The presence of specific antibodies against rOMP28 in bovine sera was demonstrated by Western blot and indirect ELISA. Briefly, purified rOMP28 preparations were run in 12% SDS-PAGE gels and transferred onto nitrocellulose membranes. The membranes were then blocked with 1% bovine serum for 2 h at 37°C and washed five times with PBS (0.01 mol/L, pH 7.2) containing 0.05% Tween 20 (PBST). Membranes were then incubated with serum samples for 10 h at 4°C (serum: PBST at 1:100). The membranes were washed with PBST and incubated with HRP-conjugated goat anti-bovine IgG antibody (1:5000 dilution) for 1 h at 37°C. Finally, the membranes were washed with PBST and the colors developed by adding 4-chloro-l-naphthol in the presence of hydrogen peroxide. Antibody responses were also measured in indirect ELISA against rOMP28 of Brucella spp. in bovine sera. Briefly, 96-well microtitre plate (Nunc-Maxisorp, Denmark) was coated overnight with 100 µl of purified rOMP28 antigen (2 µg/mL) in Phosphate-buffered saline (PBS, pH 7.4) at 4°C. Next day, plate was washed three times with PBS-T and blocked with bovine serum albumin (1%) in PBS-T for 1 h at 37°C. After 3 – 4 washings with PBS-T, the plate was incubated with positive sera at a 1/100 dilution, at 37°C for 2 h. After 3 – 4 washings of the plate, anti-bovine HRP conjugate (100 µl/well) was added (1/10000) and incubated at 37°C for 1 h. After incubation, the plate was washed 3 – 4 times and 100 µl of freshly prepared substrate solution (10 mg OPD/10mL substrate buffer with 100 µl of 3% H2O2) was added to each well and incubated for 10 - 15 min in the dark. The reaction was stopped by addition of 100 µl of H2SO4 (2M) per well. The absorbance was measured using ELISA reader (Bio-Rad) at 490 nm.

Results and Discussion

The outer membrane proteins (OMPs) of Brucella spp. were initially identified in the early 1980s and have been extensively characterized as potential immunogenic and protective antigens. However, research about the location of OMP28 has not been consistent so far. Lindler et al. (1996) found the OMP28 located in the outer membrane and bleb. Rossetti et al. (1996) localized this protein in the periplasm. Contrarily, Cloeckaert et al. (2001) considered this protein as a soluble protein by using certain monoclonal antibodies. Making a correct diagnosis of brucellosis in animals is not always possible due to the reduced efficiency of the bacteriological methods and serological reactions, therefore, these methods need to be further improved. One of the potential attempts to increase the sensitivity and specificity of serologic tests is by using the recombinant analogs of immunodominant proteins of pathogenic Brucella which have been extensively studied.

The de novo synthesis of OMP28 gene and purification of recombinant OMP28 antigen

Amino acid sequences of the OMP28 protein of Brucella spp. were downloaded from Genbank and compared in a multiple alignment. The gene encodes OMP28 of Brucella spp. was de novo synthesized. The de novo synthesis of OMP28 gene was performed as a two-round PCR. The product of the second round PCR showed a band of the expected length in (787 bp) (Fig. 2A). DNA sequencing results confirmed that the de novo synthesized OMP28 gene had the correct orientation to the designed sequence of the gene.
Fig. 2

(A) Agarose electrophoresis of second round PCR product (lane 1), M: DNA molecular weight marker. (B) SDS-PAGE analysis of Purified rOMP28; M: Protein marker; 1, 2, 3: rOMP28. The proteins were separated by 12% SDS-PAGE and stained with Coomassie brilliant blue.

(A) Agarose electrophoresis of second round PCR product (lane 1), M: DNA molecular weight marker. (B) SDS-PAGE analysis of Purified rOMP28; M: Protein marker; 1, 2, 3: rOMP28. The proteins were separated by 12% SDS-PAGE and stained with Coomassie brilliant blue. In order to overproduce the 28 kDa outer membrane protein (OMP28) of Brucella spp., the synthesized DNA was cloned into the expression vector, pET-22b(+) (Life Technology, USA). Expression of rOMP28 was achieved with E. coli BL21(DE3). The SDS-PAGE analysis of the cell lysate and various eluates showed the expression of the expected 28 kDa recombinant protein. Purification of the rOMP28 from inclusion bodies was carried out using a HisTrap FF crude with a native purification protocol as specified by the manufacturer. The different eluates were analysed by SDS-PAGE and the highly purified protein concentration was calculated and was estimated at 3.2 mg/mL (Fig. 2B and Fig. 3).
Fig. 3

SDS–PAGE analysis of rOMP28 in pET-22(b+) expression vector with modified buffers under denaturing conditions. 1: Uninduced clone (total); 2: Clear lysate of 2 h induction; 3: Lysate of 4 h induction; 4: Lysate of 6 h induction; 5: Lysate of overnight induction; 6: inclusion body without induction; 7: inclusion body after 2 h induction; 8: inclusion body after 4 h induction; 9: inclusion body induction overnight, M: protein molecular weight marker (Thermo scientific).

SDS–PAGE analysis of rOMP28 in pET-22(b+) expression vector with modified buffers under denaturing conditions. 1: Uninduced clone (total); 2: Clear lysate of 2 h induction; 3: Lysate of 4 h induction; 4: Lysate of 6 h induction; 5: Lysate of overnight induction; 6: inclusion body without induction; 7: inclusion body after 2 h induction; 8: inclusion body after 4 h induction; 9: inclusion body induction overnight, M: protein molecular weight marker (Thermo scientific).

Immunoreactivity of rOMP28 of Brucella spp.

The diagnostic potential of rOMP28 of Brucella spp. was further evaluated for screening positive (n=62) and negative (n=28) bovine serum samples (determined by TAT). The immunochemical reactivity of highly purified rOMP28 was studied in I-ELISA assay compared to a tube agglutination test (TAT). The cut off value for I-ELISA was determined at 0.096 which was double the average OD492 value of negative serum 0.042 ±0.003 at a 1:100 dilution. I-ELISA absorbance values of Brucella positive sera using rOMP28 had a strong positive reaction in comparison to the TAT value (Fig. 4). The immunoreactivity of rOMP28 based ELISA relative to the reference method (TAT) is shown in Table 2. Totally, 59 (95.1%) and 3 (4.9%) of the 62 TAT-positive sera were rOMP28 antigen based I-ELISA positive and negative, respectively. In addition, it also detected one of the TAT-negative samples as positive (3.6%) and the remaining 27 samples (96.4%) as negative.
Fig. 4

ELISA absorbance values of bovine sera using rOMP28 compared to a TAT. ELISA absorbance values of Brucella positive and negative sera were estimated using 2 µg/mL of rOMP28 antigen. The Brucella positive sera were composed of TAT; 50 (n=5), TAT; 100 (n=23), TAT; 200 (n=24) and TAT; 400 (n=7). Immunoassay plates were charged with sera at a dilution of 1:100.

Table 2

Diagnostic values of rOMP28 antigen based I-ELISA compared to a TAT.

Diagnostic values ELISATAT positive (n=62)TAT negative (n=28)Chi-Square distributionSensitivitySpecificity
ELISA positive59172.859:62·100%27:28·100%
ELISA negative327(P>0.999)=95,1%;=96,4%;
ELISA absorbance values of bovine sera using rOMP28 compared to a TAT. ELISA absorbance values of Brucella positive and negative sera were estimated using 2 µg/mL of rOMP28 antigen. The Brucella positive sera were composed of TAT; 50 (n=5), TAT; 100 (n=23), TAT; 200 (n=24) and TAT; 400 (n=7). Immunoassay plates were charged with sera at a dilution of 1:100. Diagnostic values of rOMP28 antigen based I-ELISA compared to a TAT. The potency of purified rOMP28 was studied in field sera for diagnosis of brucellosis using Western blot (Fig. 5). The immunoreactivity of the expressed protein was confirmed by Western blot. The protein band at 28kDa specifically reacted with bovine brucellosis sera. No reaction was observed with the negative serum samples.
Fig. 5

Analysis of the immunoreactivity of the recombinant protein by Western blot. The immunoreactivity of rOMP28 was elucidated with Brucella positive and negative bovine serum. Samples: 1-6 (positive for brucellosis); 7-8 (negative for brucellosis).

Analysis of the immunoreactivity of the recombinant protein by Western blot. The immunoreactivity of rOMP28 was elucidated with Brucella positive and negative bovine serum. Samples: 1-6 (positive for brucellosis); 7-8 (negative for brucellosis). In the present study, we selected the outer membrane protein (Omp28) of Brucella spp. as a candidate antigen to be further evaluated. The coding gene for Brucella spp. OMP28 was de novo synthesized, expressed in the E.coli system and used to develop rOMP28 I-ELISA in an attempt to increase the sensitivity and specificity for diagnosing bovine brucellosis. Our study has shown that I-ELISA, using rOMP28 protein, yielded high sensitivity and specificity for detection of Brucella antibodies in bovine sera, as shown in Table 2. Furthermore, these results contradict previously published data, which described this antigen as of no diagnostic value (Xin et al., 2013). However, data from other studies (Cloeckaert et al., 2001; Liu et al., 2011; Cha et al., 2012) showed that the OMP28-based I-ELISA had high sensitivity and specificity in the diagnosis of brucellosis in bovine sera, conforming to our results. In conclusion, the outer membrane protein OMP28 of Brucella spp. is identified as a major immunodominant antigen and a potential antigen for developing serological tests for bovine brucellosis.
  15 in total

1.  Cloning of a Brucella melitensis group 3 antigen gene encoding Omp28, a protein recognized by the humoral immune response during human brucellosis.

Authors:  L E Lindler; T L Hadfield; B D Tall; N J Snellings; F A Rubin; L L Van De Verg; D Hoover; R L Warren
Journal:  Infect Immun       Date:  1996-07       Impact factor: 3.441

2.  Expression, purification, and improved antigenic specificity of a truncated recombinant bp26 protein of Brucella melitensis M5-90: a potential antigen for differential serodiagnosis of brucellosis in sheep and goats.

Authors:  Wen-xing Liu; Sen Hu; Zu-jian Qiao; Wei-ye Chen; Lin-tao Liu; Fang-kun Wang; Rong-hong Hua; Zhi-gao Bu; Xiang-rui Li
Journal:  Biotechnol Appl Biochem       Date:  2011 Jan-Feb       Impact factor: 2.431

3.  Cleavage of structural proteins during the assembly of the head of bacteriophage T4.

Authors:  U K Laemmli
Journal:  Nature       Date:  1970-08-15       Impact factor: 49.962

4.  Immunogenic proteins of Brucella abortus to minimize cross reactions in brucellosis diagnosis.

Authors:  Kyung Yuk Ko; Jong-Wan Kim; Moon Her; Sung-Il Kang; Suk Chan Jung; Dong Hee Cho; Ji-Yeon Kim
Journal:  Vet Microbiol       Date:  2011-11-22       Impact factor: 3.293

5.  Use of recombinant BP26 protein in serological diagnosis of Brucella melitensis infection in sheep.

Authors:  A Cloeckaert; S Baucheron; N Vizcaino; M S Zygmunt
Journal:  Clin Diagn Lab Immunol       Date:  2001-07

6.  Epitope mapping of the Brucella melitensis BP26 immunogenic protein: usefulness for diagnosis of sheep brucellosis.

Authors:  Patricia Seco-Mediavilla; Jean-Michel Verger; Maggy Grayon; Axel Cloeckaert; Clara M Marín; Michel S Zygmunt; Luis Fernández-Lago; Nieves Vizcaíno
Journal:  Clin Diagn Lab Immunol       Date:  2003-07

7.  Cloning and expression of the immunoreactive Brucella melitensis 28 kDa outer-membrane protein (Omp28) encoding gene and evaluation of the potential of Omp28 for clinical diagnosis of brucellosis.

Authors:  Duraipandian Thavaselvam; Ashu Kumar; Sapana Tiwari; Manvi Mishra; Archana Prakash
Journal:  J Med Microbiol       Date:  2010-01-14       Impact factor: 2.472

8.  Expression and purification of the 26 kDa periplasmic protein of Brucella abortus: a reagent for the diagnosis of bovine brucellosis.

Authors:  Sanjay Kumar; Urmil Tuteja; Ashok Kumar; Harsh Vardhan Batra
Journal:  Biotechnol Appl Biochem       Date:  2008-03       Impact factor: 2.431

9.  Brucellosis: review on the recent trends in pathogenicity and laboratory diagnosis.

Authors:  Supriya Christopher; B L Umapathy; K L Ravikumar
Journal:  J Lab Physicians       Date:  2010-07

10.  Characterization of periplasmic protein BP26 epitopes of Brucella melitensis reacting with murine monoclonal and sheep antibodies.

Authors:  Jinlang Qiu; Wenjing Wang; Jingbo Wu; Hui Zhang; Yuanzhi Wang; Jun Qiao; Chuangfu Chen; Goege F Gao; Jean-Pierre Allain; Chengyao Li
Journal:  PLoS One       Date:  2012-03-23       Impact factor: 3.240

View more
  2 in total

1.  Use of recombinant Brucella outer membrane proteins 19, 25, and 31 for serodiagnosis of bovine brucellosis.

Authors:  Aitbay Bulashev; Orken Akibekov; Alfiya Syzdykova; Zhanbolat Suranshiyev; Bakytkali Ingirbay
Journal:  Vet World       Date:  2020-07-25

2.  A quantum dot fluorescent microsphere based immunochromatographic strip for detection of brucellosis.

Authors:  Yufang Kong; Huiyu Wang; Shaoqiang Wu; Jizhou Lv; Lin Mei; Huifang Zhou; Xiangmei Lin; Xueqing Han
Journal:  BMC Vet Res       Date:  2021-01-23       Impact factor: 2.741

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.