Novel Borrelia species detected in echidna ticks, Bothriocroton concolor, in Australia.

BACKGROUND: To date, little has been documented about microorganisms harboured within Australian native ticks or their pathogenic potential. Recently, a Borrelia sp. related to the Relapsing Fever (RF) group was identified in a single tick removed from a wild echidna (Tachyglossus aculeatus). The present study investigated the presence of Borrelia in 97 Bothriocroton concolor ticks parasitizing echidnas in Queensland, New South Wales, and Victoria, Australia, using nested PCR with Borrelia-specific primers targeting the 16S rRNA (16S) and flaB genes.
RESULTS: Borrelia-specific PCR assays confirmed the presence of a novel Borrelia sp. related to the RF and reptile-associated (REP) spirochaetes in 38 (39 %) B. concolor ticks. This novel Borrelia sp. was identified in 41 % of the B. concolor ticks in Queensland and New South Wales, but not in any ticks from Victoria. The resulting flaB sequences (407 bp) were 88 and 86 % similar to the flaB sequences from Borrelia turcica and Borrelia hermsii, respectively. Of the ticks confirmed as Borrelia-positive following the flaB assay, 28 were positive with the 16S assay. Phylogenetic analysis of the 16S sequences (1097 bp) suggests that these sequences belong to a novel Borrelia sp., which forms a unique monophyletic clade that is similar to, but distinct from, RF Borrelia spp. and REP-associated Borrelia spp.
CONCLUSIONS: We conclude that the novel Borrelia sp. identified in this study does not belong to the Borrelia burgdorferi (sensu lato) complex, and that the phylogenetic analysis of the partial 16S gene sequences suggests it forms a unique monophyletic cluster in the genus Borrelia, potentially forming a fourth major group in this genus associated with monotremes in Australia. However, a thorough molecular characterisation will be required to confirm the phylogenetic position of this unique Borrelia sp. The zoonotic potential and pathogenic consequences of this novel Borrelia sp. are unknown at the current time.

Background

Ticks (Acari: Ixodida) transmit the greatest diversity of zoonotic pathogens, including bacteria, protozoa and viruses, of any arthropod and are of major concern to the health and wellbeing of humans, wildlife, livestock and companion animals [1]. Globally, ticks are associated with the transmission of many bacterial pathogens; those of most concern belong predominantly to the genera Anaplasma [2], Borrelia [3], Ehrlichia [4], Francisella [5] and Rickettsia [6]. In Australia, enzootic ticks that parasitise humans and companion animals also serve as hosts for zoonotic pathogens [7].

In Australia, 70 native and introduced tick species have been described, comprising 56 hard ticks (family Ixodidae: genera Amblyomma, Bothriocroton (formerly Aponomma), Haemaphysalis, Ixodes, and Rhipicephalus,) and 14 soft ticks (family Argasidae: genera Argas and Ornithodoros) [8]. Only a few of these ticks are known to transmit pathogens associated with human tick-borne diseases (TBD); currently there are three zoonotic TBDs recognised in Australia associated with native tick species. For example, Rickettsia australis and Rickettsia honei, the causative agents of Queensland tick typhus and Flinders Island Spotted Fever, respectively, are associated with Ixodes holocyclus (Australian paralysis tick), Bothriocroton hydrosauri (reptile tick), and Ixodes tasmani (marsupial tick) [9-12]. In addition, Coxiella burnetii, the causative agent of Q fever, has been detected in Haemaphysalis humerosa, the bandicoot tick [13, 14], and Amblyomma triguttatum, the ornate kangaroo tick [15]. These ticks are thought to play a role in the life-cycle of C. burnetii and this pathogen has been detected in a number of wild animals [16, 17]. Although wildlife are often suggested to be reservoirs for such pathogens in Australia and abroad [16, 18], the importance of wildlife ticks in the ecology of these pathogens is often overlooked or neglected.

Spirochaetes in the genus Borrelia are transmitted by arthropods and are classified traditionally into two groups: Lyme Borreliosis (LB) Borrelia burgdorferi (sensu lato) (s.l.), transmitted by several species of ixodid ticks, and Relapsing Fever (RF) Borrelia, transmitted primarily by argasid ticks (tick-borne RF, TBRF) [19], a few species by ixodid ticks [20-23], and also by lice [24]. The LB group is the most significant from a human health perspective [25]. The LB group consists of 18 species, of which the principal LB-causing agents include Borrelia afzelii, Borrelia burgdorferi (sensu stricto) (s.s.), and Borrelia garinii, which are transmitted by the ticks Ixodes pacificus and Ixodes scapularis in the United States, Ixodes ricinus in Europe, and Ixodes persulcatus in Europe and Asia [25].

The TBRF Borrelia group is conventionally divided geographically into ‘Old World’ RF organisms such as Borrelia crocidurae, Borrelia duttonii and Borrelia hispanica; and ‘New World’ RF species such as Borrelia hermsii, Borrelia parkeri and Borrelia turicatae [26, 27]. Although RF Borrelia are predominantly associated with soft ticks, well-known examples of hard ticks-associated TBRF Borrelia include: Borrelia miyamotoi, isolated from I. persulcatus and I. ricinus in Europe and Asia [28-30] and I. scapularis and I. pacificus in north-eastern and western United States, respectively [31, 32]; Borrelia lonestari in Amblyomma americanum [33]; ‘Candidatus Borrelia texasensis’ in Dermacentor variabilis in the southern states of North America [34]; and Borrelia theileri in Rhipicephalus (Boophilus) microplus [21]. While also recorded in Europe, Asia and North America [35-37], TBRF is a common bacterial infection in several regions in Africa resulting in febrile illness and spirochaetaemia [38-40].

In 2003, a novel Borrelia sp. was isolated from a hard tick, Hyalomma aegyptium, removed from a tortoise in Istanbul, Turkey [41]. This species was later named Borrelia turcica [41, 42] and is genetically distinct from the LB and RF spirochaetes. Further studies have since supported a third major Borrelia group classification, designated the reptile-associated (REP) Borrelia sp. group [43].

In Australia, three borreliae have been reported: B. theileri, the causative agent of bovine spirochaetosis worldwide, transmitted by the cattle tick, R. (Boophilus) australis [44, 45]; Borrelia anserina associated with poultry and transmitted by the soft tick, Argas persicus [7, 46, 47]; and Borrelia queenslandica from long-haired rats, Rattus villosissimus, in north-west Queensland, which at the time could not be detected within the proposed tick vector, Ornithodoros gurneyi [48]. Spirochaetes have also been observed within blood films of bandicoots, cattle, kangaroo and rodents [49] and in I. holocyclus and Haemaphysalis spp. ticks, collected from companion animals and livestock [50].

Echidnas, also known as spiny anteaters, are egg-laying mammals classified under the order Monotremata and belonging in the family Tachyglossidae [51]. The short-beaked echidna (T. aculeatus) is found in Australia and New Guinea, and is comprised of five subspecies (ssp.): T. a. acanthion, T. a. aculeatus, T. a. multiaculeatus, and T. a. setosus, can be found exclusively in Australia, while T. a. lawesii is found in New Guinea [51]. In a recent molecular survey of bacteria associated with native Australian human-biting ticks, a novel Borrelia sp. related to the RF group was identified in a single I. holocyclus tick removed from an echidna host [52]. This finding prompted the current investigation to further assess the occurrence and phylogenetic position of Borrelia sp. in ticks collected from echidnas in three regions of Australia and to provide greater insight into its distribution in Australia.

Methods

Tick sample collection and identification

A total of 97 ticks were collected from 22 echidnas (T. aculeatus ssp.) by veterinarians at the Australian Zoo Wildlife Hospital in Beerwah, Queensland (n = 81), wildlife carers at the Wild Days Wildlife shelter in Narre Warren, Victoria (n = 4), and through public submission from Wagga Wagga, western New South Wales (n = 12). Ticks were preserved in 70 % ethanol immediately after removal and sent to Murdoch University for species identification and molecular analyses. Twenty-six male and 71 female B. concolor ticks were identified based on morphological assessment according to the standard keys for identifying Australian ticks [53].

DNA extraction

Prior to DNA extraction, ticks were surface-sterilised with 10 % sodium hypochlorite and washed with sterile and DNA-free water, and 70 % ethanol. The extractions were carried out as described by Gofton et al. [52]. Negative controls were treated in an identical manner. Borrelia afzelii and B. burgdorferi (s.s.) DNA previously extracted from questing nymphal I. ricinus ticks (LN1, LN6, LN7 and LN9) from Leipzig, Germany [52], were used as positive controls in all PCR assays. DNA from one Borrelia sp.-infected female I. holocyclus tick (NL230) described in Gofton et al. [52], collected from an echidna host in New South Wales was also reanalysed in the present study.

Borrelia-specific PCR and sequencing

To determine the presence of Borrelia sp. within the 97 B. concolor ticks, and one I. holocyclus tick, DNA extractions were subjected to two Borrelia genus-specific PCR assays. Borrelia-specific nested-PCR assays were conducted targeting the 16S rRNA (16S) and flaB genes (Table 1). Each 25 μl PCR reaction contained 1× PerfectTaq buffer, 2.5 mM MgCl2, 1 mM dNTPs, 400 nM of each primer, 1.25 U PerfectTaq polymerase, and 2 μl undiluted DNA. Both the primary and nested Borrelia 16S PCR assays were performed with the following thermal conditions: initial denaturation at 95 °C for 5 min, 35 cycles of denaturation at 95 °C for 30 s, annealing at 51 °C for 40 s, and extension at 72 °C for 2 min, and a final extension at 72 °C for 5 min. The flaB PCR assays were performed with an initial denaturation at 95 °C for 5 min, 35 cycles of denaturation at 95 °C for 30 s, annealing at 52 °C (primary) or 55 °C (nested) for 30 s, and extension at 72 °C for 30 s, and a final extension at 72 °C for 5 min. No-template controls and positive controls were included in all PCR assays.

Table 1

Primers used for Borrelia-specific 16S rRNA and flaB genes amplification in this study, including primer sequences, annealing temperature and expected product size

Gene	Primer	Sequence (5' – 3')	Annealing temperature	Expected product size (bp)	Reference
16S	External
	Bor-16 F	TGCGTCTTAAGCATGCAAGT
	Bor-1360R	GTACAAGGCCCGAGAACGTA	51 °C	1,344	This study
	Internal
	Bor-27 F	CATGCAAGTCAAACGGAATG
	Bor-1232R	ACTGTTTCGCTTCGCTTTGT	51 °C	1,205	This study
flaB	External
	FlaB280F	GCAGTTCARTCAGGTAACGG
	FlaRL	GCAATCATAGCCATTGCAGATTGT	52 °C	645	[33, 66]
	Internal
	flaB_737F	GCATCAACTGTRGTTGTAACATTAACAGG
	FlaLL	ACATATTCAGATGCAGACAGAGGT	55 °C	407	[33, 66]

Amplified PCR products were electrophoresed through 1–2 % agarose gels, stained with GelRed (Biotium), and visualised under UV light. Amplicons of expected sizes were excised from the gel and purified with the Wizard® SV Gel and PCR Clean-Up System (Promega Madison, WI, USA,), according to the manufacturer’s recommendations. Purified PCR products were sequenced with both forward and reverse nested PCR primers using BigDye v3.1 terminator on an ABI 373096 Capillary Sequencer (Life Technologies, USA).

Sequence analysis

Trimmed 16S sequences (1097 bp) generated in this study, together with sequences from other Borrelia spp. retrieved from GenBank, were aligned using MAFFT v7.017 [54], and the alignment was refined using MUSCLE [55]. Spirochaeta americana ASpG1 strain (AF373921) [56] was used as an outgroup. Following multiple sequence alignments, MEGA version 6 [57] was used to determine the most suitable nucleotide substitution model based on the Bayesian Information Criterion (BIC). General time reversible (GTR) model was selected and the Borrelia 16S phylogenetic tree was generated using FastTree 2 [58], with 20 rate categories of site and resampling 1000 times. 16S sequences generated in this study were deposited in GenBank under accessions KU954112 to KU954115, and flaB sequences were deposited in GenBank under the accession KX192143 to KX192150.

Results

Molecular and phylogenetic analyses

A partial fragment (407 bp) of the Borrelia flaB gene was successfully amplified in three male and 35 female B. concolor ticks (38/97, 39 %) and also in the single I. holocyclus tick from the previous study [52] (Table 2). All ticks (n = 4) from Victoria were negative for Borrelia spp. Bothriocroton concolor ticks that were Borrelia-positive originated from Queensland and New South Wales (38/93, 41 %) (Additional file 1: Table S1). BLAST analysis showed that, with 100 % query coverage, these flaB equences shared 87.4–88.6 % similarity with flaB sequences from B. turcica (GenBank: AB109245; AB109244; AB109241) [41, 42], and with 85.5–86.4 % similarity with B. hermsii (GenBank: AY597795; AY597798) [59]. BLAST analysis of the positive samples isolated from I. ricinus ticks revealed 100 % identity with the LB spirochaetes, with samples LN1, LN7 and LN9 identical to B. afzelii at the flaB locus (GenBank: GU826786) [60]; and LN6 identical to B. burgdorferi (GenBank: DQ016620; AF386506; AB035618) [61, 62].

Table 2

Summary of the sex and life stages of the tick specimens used in this study, including the positive controls Ixodes holocyclus and I. ricinus. The geographical regions where the ticks were collected either from a host or vegetation were recorded and the number of ticks positive for Borrelia genes is presented in terms of percentage

Ticks	Region	Host/questing	n	Gene (% of positive samples)
				16S	flaB
B. concolor
M	QLD	Echidna	12	0	16.6
	NSW	Echidna	10	10	10
	VIC	Echidna	4	0	0
F	QLD	Echidna	69	36.2	50.7
	NSW	Echidna	2	100	100
I. holocyclus
F	NSW	Echidna	1	100	100
I. ricinus
N	Leipzig, Germany	Questing	4	100	100

Abbreviations: M male adult, F female adult, N nymph, QLD Queensland, NSW New South Wales, VIC Victoria

The Borrelia-specific 16S PCR assay was positive for one male and 27 female B. concolor ticks (28/97; 29 %), all of which were also positive at the flaB locus (Table 2). Three distinct Borrelia 16S sequences were produced from B. concolor ticks, which differed by only a single nucleotide polymorphism (SNP) (99.9 % similarity) between the isolates. Alignment with the Borrelia sequence isolated from an I. holocyclus tick, from the previous study [52], revealed that the sequences shared > 99 % identity, with one verified SNP. The three unique Borrelia 16S sequences from B. concolor ticks were putatively designated Borrelia sp. Aus A, Borrelia sp. Aus B, and Borrelia sp. Aus C, which occurred in 22, five, and one sample, respectively. The Borrelia 16S sequence from the I. holocyclus tick was putatively designated Borrelia sp. NL230.

Phylogenetic analysis indicates that Borrelia 16S sequences from this study form a unique monophyletic clade, with high confidence, and that is most similar to, but distinct from the RF and REP Borrelia groups (Fig. 1). Borrelia 16S sequences from these echidna ticks were most dissimilar to the LB group (96.1–96.7 % similarity); and most similar (98.6–98.7 %) to both Borrelia sp. tAG66M and B. hermsii DAH (Additional file 2: Table S2). Borrelia 16S sequences generated from nymphal I. ricinus ticks clustered within the B. burgdorferi (s.l.) group, with high (99.9–100 %) similarity to B. burgdorferi and B. afzelii (Fig. 1).

Fig. 1

Molecular phylogenetic analysis of 1097 bp fragment of 16S rRNA of the Borrelia sp. amplified in B. concolor ticks from echidnas. Phylogenetic distances were inferred using FastTree 2 [57], and specimens were compared with the B. burgdorferi (sensu lato) complex, the TBRF group, and the REP-associated spirochaetes. “*” represents Borrelia sequences from B. concolor ticks; “**” indicates Borrelia sequence from Ixodes holocyclus tick; and “***” represents positive controls from I. ricinus nymphs

Discussion

This study presents the first molecular characterisation in Australia of a novel Borrelia sp. identified in B. concolor (this study) and in a single I. holocyclus tick [52], with a close relationship to the RF and REP-associated Borrelia groups. The current investigation aimed to provide further evidence for Borrelia in echidna ticks, if any, and to validate the previous findings [52] with an increased sample size and by targeting the highly conserved Borrelia housekeeping genes (e.g. flaB and 16S rRNA).

The reduced sensitivity of detecting Borrelia with the 16S PCR assay, compared to the flaB PCR assay, may be explained by the reduced PCR efficiency that is typically observed when amplifying longer gene fragments. For this reason, PCR assays targeting short gene fragments, such as the flaB assay used in the present study, are recommended for sensitive detection of Borrelia spp. However, short gene fragments are often inadequate to produce meaningful phylogenetic reconstructions, and therefore must be complimented by assays that amplify longer gene sequences, albeit with less sensitivity, such as the 16S assay in the present study.

Recently, REP-associated Borrelia spp. isolated from reptile ticks, H. aegyptium, were shown to form a monophyletic clade [42], while sharing a common ancestor with the RF and LB Borrelia groups, supporting the notion of a third Borrelia group [43]. Likewise, the Borrelia sp. identified in this study also forms a unique monophyletic clade, and may form a fourth major phylogenetic Borrelia group. However, further analyses of other Borrelia housekeeping genes, such as gyrB, groEL, glpQ genes, and 23S-16S intergenic spacer region [43], and morphological characterisation are necessary for a complete description of this novel Borrelia sp.

The current investigation has provided new records of a Borrelia sp. found in a native Australian hard tick, B. concolor [44, 45, 52]. Currently, the degree of similarity and differences between the Borrelia sp. characterised in the present study and B. queenslandica, identified in long-haired rats, R. villosissimus [48], is unknown as molecular data does not exist for this species.

All ticks removed from echidna hosts for the present study were B. concolor, a known specialist tick species usually restricted to parasitising echidnas (family Tachyglossidae) [53, 63]; however, kangaroos (Macropus fuliginosus fuliginosus) were recently recorded as a new host of B. concolor on Kangaroo Island, South Australia [64]. Bothriocroton concolor has a relatively wide distribution including both coastal and sub-coastal regions of Queensland and New South Wales, as well as inland New South Wales; whereas the distribution of I. holocyclus (the host of the first isolate reported by Gofton et al. [52]) is mainly restricted to coastal regions of the eastern Australia [53]. It has been reported that echidnas can also host other tick species such as Amblyomma australiense, Amblyomma echidnae, Amblyomma moyi, Amblyomma papuanum, Bothriocroton tachyglossi, Bothriocroton undatum, Haemaphysalis humerosa and I. tasmani [53]. Therefore, different tick species that feed on the same host may become infected through blood meals, if the echidna serves as a bacteraemic vertebrate reservoir for this bacterium.

Generally, many tick-borne microorganisms circulate within unique sylvatic cycles in an ecosystem, and wildlife and their ticks play important roles as reservoirs and bridging vectors, respectively [65]. In Australia, wildlife and their ticks have long been considered as reservoirs for a number of tick-borne pathogens [10, 16]. In the case of the vector of Borrelia in Australia, the soft tick, O. gurneyi from long-haired rats, was proposed as a vector of B. queenslandica, however, transmission attempts were unsuccessful [48]. Here in the present study, a novel bacterium harboured within B. concolor was identified in two tick genera, suggesting that echidnas may be a potential reservoir of this bacterium. However, whether these ticks are able to acquire this bacterium from infected echidna hosts remains to be confirmed through the analysis of echidna blood samples, and until further studies are completed, the vertebrate reservoir of this spirochaete remains to be determined. Likewise, the role of B. concolor and I. holocyclus ticks as potential bridging vectors of this novel Borrelia sp. remains to be assessed via transmission studies. Despite this, the potential and importance of wildlife and their ticks acting as reservoir and vector in maintaining the persistence of this bacterium in the environment cannot be disregarded. The pathogenic consequences (if any) and potential infectivity of this Borrelia sp. to animals and humans are unknown at the present time.

Conclusions

The current study has identified a novel Borrelia sp. harboured within echidna ticks. Phylogenetic analysis of the partial 16S sequences showed that this Borrelia forms a unique monophyletic clade that is closely related to the RF and REP Borrelia groups and is most dissimilar to the LB group. Moreover, this study highlights the significance of studying Australian wildlife ticks. The presence of a novel Borrelia sp. in Australia is of significant public health importance and warrants further investigations to better understand the biology, ecology, pathogenicity (if any), and infectivity of this organism to humans, domestic animals, and wildlife.

Abbreviations

16S, 16S rRNA; BIC, bayesian information criterion; GTR, general time reversible; LB, Lyme Borreliosis; NSW, New South Wales; QLD, Queensland; REP, reptile-associated; RF, relapsing fever; s.l., sensu lato; s.s., sensu stricto; SNP, single nucleotide polymorphism; TBD, tick-borne disease; TBRF, tick-borne relapsing fever; VIC, Victoria