Literature DB >> 27280008

Microarray-based long oligonucleotides probe designed for Brucella Spp. detection and identification of antibiotic susceptibility pattern.

Zahra Khazaei1, Ali Najafi2, Vahhab Piranfar3, Reza Mirnejad4.   

Abstract

Brucella spp. is a common zoonotic infection referred to as Brucellosis, and it is a serious public health problem around the world. There are currently six classical species (pathogenic species in both animals and humans) within the genus Brucella. The ability and practicality facilitated by a microarray experiment help us to recognize Brucella spp. and its antibiotic resistant gene. Rapid phenotypic determination of antibiotic resistance is not possible by disk diffusion methods. Thus, evaluating antibiotics pattern and Brucella detection appear necessary technique by molecular methods in brucellosis. So, the aim of this study was to design a microarray long oligonucleotides probe and primer for the complete diagnosis of Brucella spp. and obtaining genetic profiles for antibiotic resistance in bacteria at the same time. In this study, we designed 16 antibiotic-resistant gene solid-phase primers with similar melting temperatures of 60 °C and 16 long oligonucleotide probes. These primers and probes can identify tetracycline-, chloramphenicol-, and aminoglycoside-resistant genes, respectively. The design of microarray probes is a versatile process that be done in a wide range of selections. Since the long oligo microarray probes are the best choices for specific diagnosis and definite treatment, this group of probes was designed in the present survey.

Entities:  

Keywords:  Brucella; Microarray; antibiotic susceptibility; detection

Year:  2016        PMID: 27280008      PMCID: PMC4886574          DOI: 10.19082/2296

Source DB:  PubMed          Journal:  Electron Physician        ISSN: 2008-5842


1. Introduction

Brucella spp. is a common zoonotic infection referred to as Brucellosis. Non-motile, non-spore-forming, gram-negative coccobacilli bacteria are a serious public health problem around the world, especially in developing countries (1, 2). Brucellosis is an endemic disease in the Middle East, the Mediterranean countries, and East Asia (1, 3). Annually, 10,000 people are infected with this disease in Turkey (2). The World Health Organization (WHO) has reported about that every year, 500,000 new cases of brucellosis were diagnosed in the above regions (4, 5). This inflicts irreparable economic damage on the health systems of these countries. Due to the implementation of health programs, the prevalence of brucellosis has decreased sharply in many developed countries (6, 7). However, brucellosis is an endemic disease in Southeast European countries, such as Croatia and Macedonia (8). There are currently six classical species (pathogenic species of both animals and human) within the genus Brucella, namely, Brucella abortus (preferred hosts are cattle and buffalos), Brucella melitensis (goats, sheep, and camels), Brucella ovis (sheep), Brucella canis (dogs), Brucella suis (swine, horses, cattle, wild hares, wild boars), and Brucella neotomae (desert wood rats) (9). Brucella suis and Brucella neotomae are endemic to Southeast Europe. This study designed primers and probes for all six classical species. Following the recommendations of the WHO published in 1989, the gold standard for the treatment of brucellosis is combinatorial treatment, i.e., doxycycline-Rifampin are used for six weeks, or doxycycline is taken for six weeks together with streptomycin for 2–3 weeks (10). These drugs have serious side effects on patients (11–13). Moreover, some studies have shown that recurrence rates of 5–10% occur due to inappropriate treatment (14, 15). So, these factors, such as the high rate of recurrence, resistance to rifampin (because tuberculosis is endemic in some parts of countries), and toxic side effects (damage to the middle ear, nephrotoxicity resulting from the use of streptomycin), have led to trying new treatment options for brucellosis. Fluoroquinolones and macrolides, gentamicin, ciprofloxacin, cotrimexazole, tetracycline, tigecycline, and erythromycin are being used as new anti-microbial agents (16, 17). A new report has shown resistance to all of these antibiotics. So, the best anti-microbial pattern recommended for the treatment of human brucellosis has become important. Recently, microarray hybridization of pre-amplified deoxyribonucleic acid sequences to arrayed species-specific oligonucleotides has been used as a fast technique for the detection and identification of bacterium (18). Microarrays are powerful techniques for the rapid and parallel detection of microorganisms’ genomes in deferential samples, such as blood. PCR amplification products (PCR results) could be analyzed in comparison by mistreatment high-density oligonucleotide microarrays. Powerful analytical devices having hundreds or thousands of probes connected to solid support (19). This ability and practicality facilitate the recognition of Brucella antibiotic resistance genes, because gold standard detection (Brucella culture) need long time (1–2 weeks) (20). Therefore, rapid phenotypic determination of antibiotic susceptibility pattern is not possible by disk diffusion methods (21). Thus, evaluating antibiotics’ patterns and Brucella detection appear to be necessary techniques by molecular methods in brucellosis. So, the aims of this study were to design long oligo microarray probes for the complete diagnosis of Brucella spp. and to obtain genetic profiles for antibiotic resistance in bacteria at the same time.

2. Material and Methods

This study designed one pair Primer for detecting all 6 classical species. Complete genome sequence of six Brucella spp. studied via the national center for biotechnology information (NCBI) Genome database (http://www.ncbi.nlm.nih.gov/genome) and the RefSeq complete genome regarding the six strains were detected throughout the related files of GeneMarkS, version 2.5M. Then, for each RefSeq, a complete genome was retrieved from NCBI Nucleotide database (http://www.ncbi.nlm.nih.gov/nuccore) to study the sequence length and total genes involved within a complete genome. The data are shown in Table 1. We applied complete genome sequence of six Brucella spp. as inclusion/exclusion criteria to identify and design primers and microarray-based long oligonucleotides probes.
Table 1

Six reported identified classical Brucella strain genomes via NCBI Genome database

Brucella strainsComplete genome/RefSeq accessio no.Size (Mb)Total genes
Brucella abortus 2308NC_007618.12.122,085
Brucella melitensis ATCC 23457NC_012441.12.132,056
Brucella ovisNC_009505.12.112,063
Brucella neotomae 5K33NZ_ACEH00000000.13.33,129
Brucella canis ATCC 23365NC_010103.12.112,018
Brucella suis ATCC 23445NC_010169.11.921,844
The best server to show clear similarities among different Brucella spp. is the GViewer Server (22). Furthermore, NCBI guarantees appropriate support for GenBank data and BLAST tools. Last, the PanSeq server is used for appropriate result of genomic unique regions. Therefore, the primers and probes were designed based on AleleID 7.83 (Premier Biosoft, USA) for the detection of Brucella species antibiotics resistance gene. This study designed antibiotics resistance gene solid-phase primers with similar melting temperatures of 60 °C in Table 2. We designed a long oligonucleotide probe, as described in Table 3. To design the probe, lengths of 40–53 bp were selected, and the other defaults were in accordance with the software choice. The final probe was extracted for further analyses. The specificity of Primer and microarray probes had been approved by The Basic Local Alignment Search Tool (Blast, NCBI, USA). For Chloramphenicol antibiotics resistance gene, catB+ reported as Chloramphenicol Resistance gene. The relation between increased drug resistance to chloramphenicol and genes was unknown. But Shaw et al. published a study in Nature and showed the catB+ gene as a chloramphenicol-resistant gene (23). Several tetracycline-resistant determinants currently are used in molecular biology. The most encountered are the tet family genes (24, 25), i.e., tet(A), tet(B), tet(C), tet(S), tet(P), tet(O), tet(L), tet(M), and tet(W). Some genes have a key role to resist to tobramycin and amikacin (Tob. Amk), such as aac(6′)-Ib (26, 27). In addition, aac(3)-Ia and aac(6′)-Ib-cr4 genes represent gentamicin and kanamycin, respectively (28, 29). Moreover, ant(3″)-Ia was introduced as a spectinomycin-resistant gene (30). The gene sequence studied via the NCBI Genome database (http://www.ncbi.nlm.nih.gov/genome) was used to design the primers and probes. The provided microarray probes were rechecked by NCBI BLAST tool software and the physical-chemical and structural characteristics, such as ΔG, Tm, ΔH, and hairpins of designing microarray probes, were tested via the online tool of oligoanalyzer 3.1 (). Other default parameters were performed in this study, including target type: DNA, oligo Conc: 0.25 μM, Na+ Concentration: 50 Mm, Nucleotide type: DNA, Sequence type: linear, Temperature: 25 °C, Max foldings: 25, Suboptimality: 50%, Start position: 0 and Stop position: 0. Finally, the accurate and standard long oligonocleotides probes were selected for use in designing a diagnostic DNA microarray chip.
Table 2

Primer oligonucleotides sequence for detection Brucella spp. and antibiotics resistance gene. (Sorted by amplification target length)

TargetPrimersLength
Brucella spp.5′GCGTTGGAGGCGACATTGACA3′5′AGGCTGGCGAGGCGGATG3′286
Tetracycline Resistance Genes
tet(W)5′ACGGCTGCTGGACGCTCTT3′5′ATGGTGTGGCTGGCTGCTTTG3′219
tet(L)5′CCACCTGCGAGTACAAACTGGG3′5′ATCGCTGGACCGACTCCTTCTC3′335
tet(P)5′GCTCCCTCTGCTGCAAACAACT3′5′TCCCAACGGAAGCGGTGATACA3′340
tet(S)5′CCCTGTCAGTACGCCAGCAGAT3′5′TTGGACGACGTGGTTGGAAAGC3′350
tet(B)5′ATCGGGTCCCTGGTAGCAATGG3′5′AGTCCTCCGCAAAGGGTTCCAA3′371
tet(A)5′TCGTCGCCGCCCTGATGG3′5′GCCGCATAGATCGCCGTGAAG3′451
tet(C)5′CGCAGTCAGGCACCGTGTATG3′5′CGCCGCCGCAAGGAATGG3′519
tet(O)5′TTCTGGGCTTCTGTCGGGTTGT3′5′CTATTCGGGCGGCGGGGTT3′557
tet(M)5′CGAGGTCCGTCTGAACTTTGCG3′5′GCGGCACTTCGATGTGAATGGT3′583
Chloramphenicol Resistance Gene
catB5′AGCCTCTCAGCGAACAGGTCAA3′5′AGTCCCACCACGCCATTTCCA3′507
Aminoglycoside Resistance Genes
Aac5′TGGAGCACTGGCGCGGATT3′5′GAAAACCACGGGCGAACTGTCA3′200
aac(6′)-Ib5′AGAAGAAGCACGCCCGACACT3′5′GTTCCCAAGCCTTTGCCCAGTT3′237
aac(3)-Ia5′GAGTTCGGAGACGTAGCCACCT3′5′ATAGAGAGCCACTGCGGGATCG3′324
aac(6′)-Ib-cr45′CAACAGCACCGATTCCGTCACA3′5′GTTCCCAAGCCTTTGCCCAGTT3′339
ant(3″)-Ia5′TCAGAGGTAGTTGGCGTCATCG3′5′GCGGCGAGTTCCATAGCGTTA3′490
Table 3

Microarray DNA probe oligonucleotides for detection Brucella spp. and antibiotics resistance genes with same annealing temperature

TargetProbeLength
Brucella spp.5′GTTCTGCTTGTACTGGATGGAATAGACATTGTCGTAGCCACCTTCTT3′47
Tetracycline Resistance Genes
tet(A)5′CCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACG3′40
tet(B)5′CGATCATTGGATTTGTTGGACACTCTTTCTTTCCTATTCTCATTCTAGCCCG3′52
tet(C)5′CACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATG3′51
tet(S)5′AGTAGCGGAGCAATTAAAGAGTTAGGAAGTGTAGATAGCGGTACAACGAA3′50
tet(P)5′ATAACAGTGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAAC3′49
tet(O)5′AACCAGGGAGCGTAGATAAAGGCACAACAAGGACAGATACAATGAAT3′47
tet(L)5′CGGCTACATTGGTGGGATACTTGTTGATAGAAGAGGTCCTTTATACGTGTTAA3′53
tet(M)5′ATAACAGTGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAAC3′49
tet(W)5′TGAAATTGTTATCCTTCCCAGCGACAGCGTGAGGTTAAACGATGTATTA3′49
Chloramphenicol Resistance Gene
catB5′GATACCGTGATTGGAAATGATGTGTGGATTGGTTCAGAAGCGATGATTT3′49
Aminoglycoside Resistance Genes
aac(3)-Ia5′CAAGCAGATTACGGTGACGATCCCGCAGTGGCTCTCTATACAAAGTT3′47
aac(6′)-Ib5′TGAGTATTCAACATTTCCAAACAAAGTTAGGCATCACAAAGTACAGCATCGT3′52
aac5′CAATTTCACAGAAAGTTCACCTGGCGTTAGGATTTGAGGAAACAGAGC3′48
ant(3″)-Ia5′TCATACTTGAAGCTAGGCAGGCTTATCTTGGACAAGAAGATCGCTTG3′47
aac(6′)-Ib-cr45′TGGAAATACTGACAAGTTAGGCATCACAAAGTACAGCATCGTGACCA3′47

3. Results and discussion

This article designed 16 primer oligonucleotides sequence with the same temperature program for use DNA microarray detection (Table 2). Therefore, we designed 16 long oligonucleotides probes for DNA microarray methods (Table 3). There has been extensive scientific research that has shown a wide range of zoonotic infections, which are caused by different strains of Brucella (31–34). The identification of these bacteria can be very critical in the medical society (35). Because of some antibiotic-resistant genes, the prevalence of Brucellosis is increasing, and, as a result, it is necessary to develop a rapid identification technique that can replace culture and biochemical tests. In this study, by using suitable primers and the microarray method, some resistant antibiotics were identified among Brucella spp. in a short time. It was observed that some species that carried the tet family gene showed resistance to tetracycline although the majority of spp. had the tet+ gene, which means that there was a high level of tectracycline resistance in this period. In fact, this kind of resistance causes bacteria to acquire new genes, which are responsible to code a protein that protects bacterial ribosomes from the action of tetracyclines. However, resistance to aminoglycoside was detected by probes that were designed based on acc(3), acc(6), and ant genes. These aminoglycoside resistance genes existing in the most of Brucella spp. represent High Level of Aminoglycoside Resistance (HLAR). Regarding the mechanism of chloramphenicol resistance, there is its enzymatic inactivation by acetylation mainly via acetyltransferases or, in some cases, by chloramphenicol phosphotransferases. In the present study, Brucella neotomae 5K33 included the highest number of genes (3129 genes) and nucleotide sequences (3.3 Mb) in Table 1, was selected as standard sample for designing long oligonocleotides microarray probes. So, an accurate, rapid, sensitive, and specific diagnostic tool results a definite treatment that may lead to the reduction of unnecessary costs for public health around the world. One of the most efficient molecular diagnostic technology is the DNA microarray, which makes a reliable diagnosis regarding microbial agents of various infectious diseases at the same time (1–5). DNA microarray technology includes several stages, the most important of which is designing probes. Regarding this stage, scientists can use a wide range of databases, tools, and servers for microarray probes. This technology is a valuable method to use the obtained information for AlleleID tool to retrieve invaluable raw data in the form of designing microarray probes. By comparing the genome sequence of six Brucella species, our study could not find the specific unique areas for long probe designing. More analysis showed that Brucella spp. had elements that can move between genomes. So, the microarray technique could not differentiate between Brucella spp. Designing microarray probes is a versatile process that can be done in a wide range of selections. Since, the long oligo microarray probes are the best choices for specific diagnosis and definite treatment, this group of probes was designed in the present survey. Moreover, probes can be designed in two forms, i.e., general and specific. In the past, microbial resistance was a complicated issue in hospitals and health centers throughout the world, but the microarray diagnostic method can be a solution in this matter, because today’s microarray probes are designed for normal virulence or multi-drug resistance genes (3641).
  37 in total

1.  Multiplex PCR for detection of aminoglycoside resistance genes in enterococci.

Authors:  Sergei B Vakulenko; Susan M Donabedian; Anatoliy M Voskresenskiy; Marcus J Zervos; Stephen A Lerner; Joseph W Chow
Journal:  Antimicrob Agents Chemother       Date:  2003-04       Impact factor: 5.191

2.  Microarray-based identification of bacteria in clinical samples by solid-phase PCR amplification of 23S ribosomal DNA sequences.

Authors:  Georg Mitterer; Martin Huber; Ernst Leidinger; Claudia Kirisits; Werner Lubitz; Manfred W Mueller; Wolfgang M Schmidt
Journal:  J Clin Microbiol       Date:  2004-03       Impact factor: 5.948

Review 3.  Current concepts in laboratory testing to guide antimicrobial therapy.

Authors:  Stephen G Jenkins; Audrey N Schuetz
Journal:  Mayo Clin Proc       Date:  2012-03       Impact factor: 7.616

4.  Molecular epidemiology of aminoglycosides resistance on Klebsiella pneumonia in a hospital in China.

Authors:  Caiqian Liang; Bangrong Xing; Xiaoyan Yang; Yongmei Fu; Yaqun Feng; Yongbiao Zhang
Journal:  Int J Clin Exp Med       Date:  2015-01-15

5.  Primary structure of a chloramphenicol acetyltransferase specified by R plasmids.

Authors:  W V Shaw; L C Packman; B D Burleigh; A Dell; H R Morris; B S Hartley
Journal:  Nature       Date:  1979 Dec 20-27       Impact factor: 49.962

6.  Cloning, molecular analysis and epitopics prediction of a new chaperone GroEL Brucella melitensis antigen.

Authors:  Mohammad Hadi Sekhavati; Reza Majidzadeh Heravi; Mojtaba Tahmoorespur; Soheil Yousefi; Tooba Abbassi-Daloii; Rahebe Akbari
Journal:  Iran J Basic Med Sci       Date:  2015-05       Impact factor: 2.699

Review 7.  Nucleic Acid-based approaches for detection of viral hepatitis.

Authors:  Payam Behzadi; Reza Ranjbar; Seyed Moayed Alavian
Journal:  Jundishapur J Microbiol       Date:  2014-12-10       Impact factor: 0.747

8.  The Antibacterial Activity of Selected Labiatae (Lamiaceae) Essential Oils against Brucella melitensis.

Authors:  Ayman Al-Mariri; Mazen Safi
Journal:  Iran J Med Sci       Date:  2013-03

9.  Perspectives for the treatment of brucellosis in the 21st century: the Ioannina recommendations.

Authors:  Javier Ariza; Mile Bosilkovski; Antonio Cascio; Juan D Colmenero; Michael J Corbel; Matthew E Falagas; Ziad A Memish; Mohammad Reza Hasanjani Roushan; Ethan Rubinstein; Nikolaos V Sipsas; Javier Solera; Edward J Young; Georgios Pappas
Journal:  PLoS Med       Date:  2007-12       Impact factor: 11.069

10.  Cervical Lymph Nodes as a Selective Niche for Brucella during Oral Infections.

Authors:  Kristine von Bargen; Aurélie Gagnaire; Vilma Arce-Gorvel; Béatrice de Bovis; Fannie Baudimont; Lionel Chasson; Mile Bosilkovski; Alexia Papadopoulos; Anna Martirosyan; Sandrine Henri; Jean-Louis Mège; Bernard Malissen; Jean-Pierre Gorvel
Journal:  PLoS One       Date:  2015-04-28       Impact factor: 3.240

View more
  3 in total

1.  Respiratory Tularemia: Francisella Tularensis and Microarray Probe Designing.

Authors:  Reza Ranjbar; Payam Behzadi; Caterina Mammina
Journal:  Open Microbiol J       Date:  2016-11-30

2.  Antibacterial effects of microbial synthesized silver-copper nanoalloys on Escherichia coli, Burkholderia cepacia, Listeria monocytogenes and Brucella abortus.

Authors:  Sheida Mohammadi; Nima Hosseini Jazani; Mehri Kouhkan; Leila Ashrafi Babaganjeh
Journal:  Iran J Microbiol       Date:  2018-06

3.  Identification, Genotyping and Antimicrobial Susceptibility Testing of Brucella spp. Isolated from Livestock in Egypt.

Authors:  Aman Ullah Khan; Waleed S Shell; Falk Melzer; Ashraf E Sayour; Eman Shawkat Ramadan; Mandy C Elschner; Amira A Moawad; Uwe Roesler; Heinrich Neubauer; Hosny El-Adawy
Journal:  Microorganisms       Date:  2019-11-22
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.