Literature DB >> 27278526

High-resolution melting analysis for molecular detection of multidrug resistance tuberculosis in Peruvian isolates.

Marco Galarza1, Manuel Fasabi1, Kelly S Levano1, Edith Castillo2, Nadia Barreda2, Mitzi Rodriguez2, Heinner Guio3.   

Abstract

BACKGROUND: The emergence of multidrug-resistant strains is a major health problem especially for countries with high TB incidence such as Peru. In this study, we evaluated High Resolution Melting (HRM) assay in Peruvian isolates for the detection of mutations within rpoB, katG genes and promoter region inhA to determine isoniazid and rifampicin resistance in Mycobacterium tuberculosis (Mtb).
METHODS: DNA samples extracted from a total of 167 clinical isolates of Mtb, 89 drug-sensitive and 78 multidrug-resistant, were blindly analyzed by HRM analysis and verified by DNA sequencing.
RESULTS: The HRM analysis generated patterns that were specific to distinguish between sensitive and resistance isolates. The sensitivity and specificity of the HRM assays in comparison with drug susceptibility testing (DST) for detection of rifampicin resistance were 98.7 % and 97.5 %, and for isoniazid resistance were 98.7 % and 100 %.
CONCLUSION: This study suggests that HRM Analysis could help with rapid diagnosis of MDR-TB cases in Peru.

Entities:  

Keywords:  High Resolution Melting Analysis; Multi-drug resistance tuberculosis; Tuberculosis

Mesh:

Substances:

Year:  2016        PMID: 27278526      PMCID: PMC4899911          DOI: 10.1186/s12879-016-1615-y

Source DB:  PubMed          Journal:  BMC Infect Dis        ISSN: 1471-2334            Impact factor:   3.090


Background

In countries with high TB burden such as Peru, the emergence of multidrug-resistant strains is a major health problem. In 2013, Peru registered 27 504 new TB cases (21 916 pulmonary and 5588 extrapulmonary), from which a 3.9 % (850) were multidrug-resistant tuberculosis (MDR-TB) [1]. MDR-TB is defined as resistance to rifampicin and isoniazid, two of the first-line anti-TB drugs [1]. According to the WHO TB report, research should focus on the development of simple and rapid diagnostic methods that can be used at first level health facilities to diagnose and thus prevent the increase of MDR-TB cases [2]. The conventional phenotypic drug susceptibility testing (DST) method, Agar Proportion Method (APM) continues to be the gold standard for Mtb DST. The problem with the current conventional DST methods available is that they are generally carried out after a culture is isolated from a clinical sample detecting Mtb’s growth in the presence of anti-TB drugs by absolute concentration, resistance ratio or portion methods on solid medium having a turnaround time of about 2–4 weeks. Therefore, more rapid TB DST methods that can use clinical samples directly are needed to give a prompt diagnosis. Some non-commercially available direct methods such as MODS (microscopic observation drug susceptibility) assay have been developed. However, the MODS assay, which can process a large number of sputum samples with results in 7–9 days, is too laborious and time consuming due to the need of daily plate readings [3]. There has been an increased effort to develop new simple and rapid diagnostic molecular methods for MDR-TB taking advantage of mutations that render resistance [4]. For rifampicin, resistance is observed with the presence of localized mutations in the 81 bp region of the rpoB gene [5]. Also, mutations in the rpoA and rpoC regions have been recently reported in resistant strains and would be important in future diagnostic methods [6, 7]. Resistance to isoniazid is observed mostly with the presence of mutations in katG. Other important mutations also occur in ahpC, kasA, ndh genes and the promoter region of inhA [8-11]. The current molecular methods can detect resistance-associated mutations within 1–2 days using clinical samples. One of the commercially available molecular methods is Xpert MTB/RIF (Cepheid), a real-time PCR assay that detects rifampicin resistance in sputum samples. There are also two commercially available DNA macroarray assays (reverse hibridization-based line probe assays), INNO-LiPA rif (Innogenetics), which detect mutations on rpoB gene, and MTBDRplus (Hain Lifesciences), which simultaneously detects rifampicin (rpoB gene) and isonizid (katG and inhA region) resistance [12, 13]. These assays are able to reduce the time for MDR-TB diagnosis. In our quest to develop another molecular method that can be helpful for diagnosing MDR-TB and be implemented in Peru, we evaluated the HRM assay. Some of the advantages of HRM analysis include short processing time, simple procedure and low cost compared to current methods used in Peru [14]. HRM is based on the analysis of fluorescence curves produced by DNA intercalating dye during strand dissociation events in the melting phase following real-time PCR. It allows the detection of genetic mutations or variance in nucleic acid sequences [15]. The use of this methodology include identification of SNPs, genotyping, gene scanning, sequence matching and nucleic acids methylation [16]. In this study, we evaluated the detection of mutations in rpoB, katG genes and the inhA promoter region by HRM analysis using Peruvian culture isolates with known phenotypic susceptibility profiles of MDR-TB.

Methods

Sample collection

DNA samples extracted from a total of 167 Mtb isolates were used for this study. Convenience sampling was applied. The isolates were provided by the Laboratory Reference of Mycobacteria from DIRESA Callao, province with one of the highest number of TB cases in PERU. 89 isolates had sensitive phenotype (susceptible to both rifampicin and isoniazid) and 78 isolates had multidrug-resistant phenotype (resistant to both rifampicin and isoniazid), as determined by MODS. MODS assay was performed as described previously [17, 18] using critical concentrations of 0.4 μg/mL for isoniazid and 1.0 μg/mL for rifampicin. All but 14 isolates that had a resistant phenotype were verified by APM in the Reference Laboratory of Mycobacteria at the Instituto Nacional de Salud. Briefly, APM was performed in accordance with WHO guidelines [19] on Middlebrooks 7H10 agar containing 0.2 μg.ml and 1 μg/ml for INH or 1 μg/ml for RIF. The MODS and APM results were concordant in all samples analyzed. 64 % of the resistant samples had high level INH resistance and 11.5 % had low-level INH resistance. 17.9 % of the resistant samples had no APM results available (some due to their inability to grow on agar. For those, a molecular testing method was done). All the isolates that had the high level INH resistance and only one had both katG and inhA mutations, had katG mutations, and all the isolates that had low level INH resistance had inhA mutations. All other processes and experimental methodologies were performed in the Biotechnology and Molecular Biology Laboratory at the Instituto Nacional de Salud (INS), Chorrillos. This project was approved by the INS‘s Research and Ethical Committees (OI-017-13) and has the participants’ consent to publish these data.

Extraction of DNA

Bacteria, grown on Lowenstein Jensen solid medium, were resuspended in molecular biology grade water and sonicated using S2 ultrasonicator (Covaris Inc, USA). The bacterial solution was then treated with lysozyme overnight. Finally, the DNA was extracted using the PureLink™ Genomic DNA kit (ThermoFisher Scientific, USA) according to manufacturer’s procedure.

High resolution melting analysis

HRM assays were performed using Type I HRM PCR kit (Qiagen). All samples were tested in duplicates. The primers used for these experiments were previously reported [20] (Table 1). For confirmation of Mtb, the IS6110 primers were used. Each reaction included: 1X HRM master mix (containing HotStarTaq Plus DNA polymerase, HRM PCR buffer with EvaGreen dye, Q-solution and dNTPs), 0.7uM of each primer, 2 ul (1 ng/ul) of Mtb DNA, and RNase-Free water. All assays were run on the Rotor-Gene Q real time PCR instrument (Qiagen, USA) using the following cycling parameters: initial denaturation at 95 °C for 10 min, 45 cycles of 94 °C for 30 s and 60 °C for 40 s. For HRM analysis, a second hold was set at 60 °C for 1 min to allow reannealing of the amplified DNA. The melt analysis was performed from 80–94 °C with 0.1 °C increments every 2 s. The reference strain H37Rv, susceptible to RIF and INH, was included in each run as a wild-type positive control and nuclease free water was used as a negative control. The biologists who performed the HRM analysis were blinded to the phenotype and genotype resistance data.
Table 1

Sequences of the primers used HRM analysis

PrimerTargetSequenceFragment size (bp)HRM temperature range (°C)
IS6110-FTCCGGCCGGTGGTCG
IS6110 103
IS6110-R CGGCGCTTGTGGGTCAA
rpoB-FCGCGATCAAGGAGTTCTTC
rpoB 118
rpoB-RTGACAGACCGCCGGGCCC80–95
katG-FGCTGAGCCAATTCATGGACC
katG 235
katG-RTGACAGACCGCCGGGCCC
inhA-FGCGGTCACACTTTCGGTAA
Promoter inhA 180
inhA-RGGTGTTCGTCCATACGACCT

F forward primer; R reverse primer

Sequences of the primers used HRM analysis F forward primer; R reverse primer The HRM data were analyzed with the Rotor-Gene Q software. The melting curves generated represented by different color lines and shapes easily differentiate between sensitive and resistant isolates.

DNA sequencing

Sequencing analysis was used to confirm resistance in all phenotypically resistant strains using the primers listed on Table 2, which have been previously reported (16). Sequencing was performed using 3500 Genetic Analyzer (Applied Biosystems, USA), and subsequent alignment was done using Geneious 5.4.4 program.
Table 2

Sequence of primers used DNA sequencing

PrimerGeneSequenceFragment size (bp)
rpoB-FSTGGTCCGCTTGCACGAGGGTCAGA
rpoB 758
rpoB-RSCAGGAAGGGAATCATCGCGG
katG-FSTGCAGATGGGGCTGATCTACG
katG ACCCATGTCTCGGTGGATCAG596
katG-RS
inhA-FSACATACCTGCTGCGCAAT
inhA TCACATTCGACGCCAAAC400
inhA-RS

F forward; R reverse

Sequence of primers used DNA sequencing F forward; R reverse

Statistical analysis

The sensitivity and specificity parameters were calculated before and after discrepancies were resolved using statistical formula. Sensitivity was calculated as follows: (true positive/(true positive + false negative); specificity was calculated as follows: (true negative)/(true negative + false positive). The data were analyzed using the EPIDAT ver. 3.1 software. The study conforms to the international standards for reporting of diagnostic accuracy (STARD) requirements [21].

Results and Discussion

Detection of rifampicin resistance using HRM analysis

To evaluate the ability of the HRM assay to detect rifampicin resistance, we analyzed sequence variations in a 118 bp region of the rpoB gene on the DNA samples of 167 Mtb isolates. 89 isolates were sensitive and 78 were MDR as determined by MODS and confirmed by APM. According to the HRM results, there were phenotypic and genotypic (HRM analysis) concordance for 77 out of 78 resistant isolates. One phenotypic resistant isolate was genotypic sensitive and two phenotypic sensitive isolates were genotypic resistant by HRM (Fig. 1).
Fig. 1

HRM curve analysis for resistant discrimination in 118 bp amplified fragment from rpoB gene. Resistant profiles with positive and negative fluorescence are shows in red circles (five samples). Sensitive profiles are shows in black circle (seven samples)

HRM curve analysis for resistant discrimination in 118 bp amplified fragment from rpoB gene. Resistant profiles with positive and negative fluorescence are shows in red circles (five samples). Sensitive profiles are shows in black circle (seven samples)

Detection of isoniazid resistance using HRM analysis

To evaluate the ability of the HRM assay to detect isoniazid resistance, we analyzed sequence variations in a 235 bp region of the katG gene and in a 190 bp region of the inhA promoter the DNA samples of the 167 isolates. The results of the HRM analysis showed that there was phenotypic and genotypic (HRM analysis) concordance for 77 out of 78 resistant isolates. One phenotypic resistant isolate was genotypic sensitive. HRM analysis for katG gene detected 90 sensitive and 67 isoniazid resistant isolates (Fig. 2), and for the promoter region of inhA 90 sensitive and 10 isoniazid resistant isolates were detected (Fig. 3).
Fig. 2

HRM curve analysis for resistant discrimination in 235 pb amplified fragment from katG gene. Resistant profiles are show in red circle (four samples). Sensitive profiles are show in black circle (eight samples)

Fig. 3

HRM curve analysis for resistant discrimination in 190 pb amplified fragment from inhA promotor region. Resistant profiles are show in red circle (seven samples). Sensitive profiles are show in black circle (ten samples)

HRM curve analysis for resistant discrimination in 235 pb amplified fragment from katG gene. Resistant profiles are show in red circle (four samples). Sensitive profiles are show in black circle (eight samples) HRM curve analysis for resistant discrimination in 190 pb amplified fragment from inhA promotor region. Resistant profiles are show in red circle (seven samples). Sensitive profiles are show in black circle (ten samples) Seventy-eight samples with drug-resistant profiles were sequenced for the rpoB, katG and inhA targets (Table 3). Fourteen types of mutations were observed in the rpoB gene of the resistant samples, with S531L (TCG➔TTG) being the most common. In the katG gene, the most common mutation was S315T, and C → T (−15) for inhA promoter. All the mutations observed have been previously linked to resistance to INH and RIF.
Table 3

Results of HRM curves analysis for rpoB, katG and inhA targets in Mycobacterium tuberculosis

DRUGPHENOTYPETARGETMUTATIONHRM CURVE ASSAYDNA SEQUENCING
RIFAMPICINResistant (78) rpoB 53S531L (TCG → TTG)mutantmutant
14D516V (GAC → GTC)mutantmutant
2H526D (CAC → GAC)mutantmutant
1Q513L (CAA → CTA)mutantmutant
1Q513P (CAA → CCA)mutantmutant
1M515I (ATG → ATA), D516G (GAC → GGC)mutantmutant
1D516Y (GAC → TAC), N518H (AAC → CAC)mutantmutant
1H526R (CAC → CGC)mutantmutant
1H526Y (CAC → TAC)mutantmutant
1S531F (TCG → TTT)mutantmutant
1S531W (TCG → TGG)mutantmutant
1No mutationwildwild
Susceptible (89)87Not sequencedwild-
2514 Phe (TTC → TTT)mutantwild
ISONIAZIDResistant (78) katG 66S315T (AGC → ACC)mutantmutant
1S315T (AGC → ACC), C → T (−15)mutantmutant
inhA 10C → T (−15)mutantmutant
katG,inhA 1No mutationwildwild
Susceptible (89)87Not sequencedwild-
2No mutationwildwild
Results of HRM curves analysis for rpoB, katG and inhA targets in Mycobacterium tuberculosis Two samples with a sensitive phenotype that turn out resistant by HRM analysis were also sequenced. Sequencing revealed a synonymous mutation in codon 514 (TTC➔TTT), reason why the sample has a sensitive phenotype. A drug-resistant sample that gave wild-type results with HRM analysis had no mutations in rpoB, katG and inhA promoter, suggesting the possibility of mutations in other genes (like rpoA, rpoC, ahpC, kasA and ndh).

Analysis of sensitivity and specificity of HRM analysis

Most of HRM analysis results were consistent with the resistant or sensitive phenotype. The sensitivity for detection of rifampicin resistance was found to be 98.7 % and the specificity 97.75 %. For isoniazid resistance (katG and/or inhA), the sensitivity was found to be 98.7 % and the specificity 100 % (Table 4).
Table 4

Sensitivity and specificity of HRM analysis in comparison with Drug susceptibility

DrugTargetHRM profile% variantDrug susceptibility% resistantSensitivity (%) Specificity (%)
++
Rifampicin rpoB 798847.3788946.798.7 (92.2–99.9)97.75 (91.2–99.6)
Isoniazid katG and/or779046.1788946.798.7 (92.2–99.9)100 (94.2–99.9)
inhA promoter
Sensitivity and specificity of HRM analysis in comparison with Drug susceptibility

Conclusions

At present, a rapid and effective diagnosis for TB and MDR-TB is necessary to provide a better treatment for infected individuals. Molecular biology techniques like HRM analysis can be employed to detect MDR-TB due to their high sensitivity, specificity and efficiency [20, 22, 23]. In this study, we evaluated the performance of HRM curve analysis as a method for the rapid and accurate detection of mutations associated to MDR-TB. All isolates with drug-resistance profiles were confirmed by DNA sequencing analysis. In comparison with previous studies, our results of sensitivity and specificity are similar to others (24–26). One limitation of the current study is that the target region used for the HRM analysis does not cover all mutations related to resistance, and thus, the technique cannot yet replace conventional DST. Another limitation is that the test may detect silent or other mutations not actually associated with drug resistance. An advantage of this technique is that it can be implemented to detect fluoroquinolone, pyrazinamide and streptomycin resistance [24-26]. In conclusion, this study showed that using the rpoB, katG genes and inhA promoter region as targets in the HRM assay can be used to detect MDR-TB in culture isolates with high sensibility and specificity. Evaluation of the HRM assay on sputum samples would be an important next step to further expedite MDR-TB detection.

Abbreviations

HRM, high resolution melting; TB, tuberculosis; Mtb, Mycobacterium tuberculosis; DST, drug susceptibility testing; APM, Agar Proportion Method; MDR-TB, multidrug-resistance tuberculosis; MODS, Microscopic observations drug susceptibility
  23 in total

1.  Performance of the microscopic observation drug susceptibility assay in drug susceptibility testing for Mycobacterium tuberculosis.

Authors:  Walter G Park; William R Bishai; Richard E Chaisson; Susan E Dorman
Journal:  J Clin Microbiol       Date:  2002-12       Impact factor: 5.948

2.  The STARD statement for reporting studies of diagnostic accuracy: explanation and elaboration. The Standards for Reporting of Diagnostic Accuracy Group.

Authors:  Patrick M Bossuyt; Johannes B Reitsma; David E Bruns; Constantine A Gatsonis; Paul P Glasziou; Les M Irwig; David Moher; Drummond Rennie; Henrica C W de Vet; Jeroen G Lijmer
Journal:  Croat Med J       Date:  2003-10       Impact factor: 1.351

3.  Identification of katG mutations associated with high-level isoniazid resistance in Mycobacterium tuberculosis.

Authors:  Hiroki Ando; Yuji Kondo; Toshinori Suetake; Emiko Toyota; Seiya Kato; Toru Mori; Teruo Kirikae
Journal:  Antimicrob Agents Chemother       Date:  2010-03-08       Impact factor: 5.191

4.  Rapid detection of multidrug-resistant Mycobacterium tuberculosis by use of real-time PCR and high-resolution melt analysis.

Authors:  Melissa V Ramirez; Kelley C Cowart; Patricia J Campbell; Glenn P Morlock; David Sikes; Jonas M Winchell; James E Posey
Journal:  J Clin Microbiol       Date:  2010-09-01       Impact factor: 5.948

5.  A novel method based on high resolution melting (HRM) analysis for MIRU-VNTR genotyping of Mycobacterium tuberculosis.

Authors:  Yu Pang; Yang Zhou; Shengfen Wang; Jie Lu; Bing Lu; Guangxue He; Lixia Wang; Yanlin Zhao
Journal:  J Microbiol Methods       Date:  2011-06-13       Impact factor: 2.363

6.  [Cost analysis of rapid methods for diagnosis of multidrug resistant tuberculosis in different epidemiologic groups in Perú].

Authors:  Lely Solari; Alfonso Gutiérrez; Carmen Suárez; Oswaldo Jave; Edith Castillo; Gloria Yale; Luis Ascencios; Neyda Quispe; Eddy Valencia; Víctor Suárez
Journal:  Rev Peru Med Exp Salud Publica       Date:  2011 Jul-Sep

7.  Rapid, efficient detection and drug susceptibility testing of Mycobacterium tuberculosis in sputum by microscopic observation of broth cultures. The Tuberculosis Working Group in Peru.

Authors:  L Caviedes; T S Lee; R H Gilman; P Sheen; E Spellman; E H Lee; D E Berg; S Montenegro-James
Journal:  J Clin Microbiol       Date:  2000-03       Impact factor: 5.948

8.  Putative compensatory mutations in the rpoC gene of rifampin-resistant Mycobacterium tuberculosis are associated with ongoing transmission.

Authors:  M de Vos; B Müller; S Borrell; P A Black; P D van Helden; R M Warren; S Gagneux; T C Victor
Journal:  Antimicrob Agents Chemother       Date:  2012-12-03       Impact factor: 5.191

9.  High-resolution melting analysis for the rapid detection of fluoroquinolone and streptomycin resistance in Mycobacterium tuberculosis.

Authors:  Ann S G Lee; Danny C T Ong; Joshua C L Wong; Gilman K H Siu; Wing-Cheong Yam
Journal:  PLoS One       Date:  2012-02-21       Impact factor: 3.240

10.  Whole-genome sequencing of rifampicin-resistant Mycobacterium tuberculosis strains identifies compensatory mutations in RNA polymerase genes.

Authors:  Iñaki Comas; Sonia Borrell; Andreas Roetzer; Graham Rose; Bijaya Malla; Midori Kato-Maeda; James Galagan; Stefan Niemann; Sebastien Gagneux
Journal:  Nat Genet       Date:  2011-12-18       Impact factor: 38.330

View more
  10 in total

1.  Direct Detection of Rifampin and Isoniazid Resistance in Sputum Samples from Tuberculosis Patients by High-Resolution Melt Curve Analysis.

Authors:  Divya Anthwal; Rakesh Kumar Gupta; Manpreet Bhalla; Shinjini Bhatnagar; Jaya Sivaswami Tyagi; Sagarika Haldar
Journal:  J Clin Microbiol       Date:  2017-03-22       Impact factor: 5.948

Review 2.  Xpert MTB/XDR for detection of pulmonary tuberculosis and resistance to isoniazid, fluoroquinolones, ethionamide, and amikacin.

Authors:  Samantha Pillay; Karen R Steingart; Geraint R Davies; Marty Chaplin; Margaretha De Vos; Samuel G Schumacher; Rob Warren; Grant Theron
Journal:  Cochrane Database Syst Rev       Date:  2022-05-18

3.  Genotypic Distribution and a Potential Diagnostic Assay of Multidrug-Resistant Tuberculosis in Northern Thailand.

Authors:  Usanee Anukool; Ponrut Phunpae; Chayada Sitthidet Tharinjaroen; Bordin Butr-Indr; Sukanya Saikaew; Nathiprada Netirat; Sorasak Intorasoot; Vorasak Suthachai; Khajornsak Tragoolpua; Angkana Chaiprasert
Journal:  Infect Drug Resist       Date:  2020-09-30       Impact factor: 4.003

4.  Plasmid-based high-resolution melting analysis for accurate detection of rpoB mutations in Mycobacterium tuberculosis isolates from Moroccan patients.

Authors:  El Mehdi Bentaleb; My Driss El Messaoudi; Mohammed Abid; Malika Messaoudi; Ali K Yetisen; Hassan Sefrioui; Saaïd Amzazi; Hassan Ait Benhassou
Journal:  BMC Infect Dis       Date:  2017-08-07       Impact factor: 3.090

5.  Molecular detection of rifampin, isoniazid, and ofloxacin resistance in Iranian isolates of Mycobacterium tuberculosis by high-resolution melting analysis.

Authors:  Mehrandokht Sirous; Azar Dokht Khosravi; Mohammad Reza Tabandeh; Shokrollah Salmanzadeh; Nazanin Ahmadkhosravi; Sirus Amini
Journal:  Infect Drug Resist       Date:  2018-10-18       Impact factor: 4.003

6.  A rapid identification technique for drug-resistant Mycobacterium tuberculosis isolates using mismatch specific cleavage enzyme.

Authors:  Luis Jaramillo; David Tarazona; Kelly Levano; Marco Galarza; Omar Caceres; Maximilian Becker; Heinner Guio
Journal:  Bioinformation       Date:  2018-07-31

7.  Rifampicin and isoniazid drug resistance among patients diagnosed with pulmonary tuberculosis in southwestern Uganda.

Authors:  Lisa Nkatha Micheni; Kennedy Kassaza; Hellen Kinyi; Ibrahim Ntulume; Joel Bazira
Journal:  PLoS One       Date:  2021-10-29       Impact factor: 3.240

8.  Mycobacterium tuberculosis mixed infections and drug resistance in sub-Saharan Africa: a systematic review.

Authors:  Lisa Nkatha Micheni; Serawit Deyno; Joel Bazira
Journal:  Afr Health Sci       Date:  2022-03       Impact factor: 1.108

9.  Development and application of affordable SNP typing approaches to genotype Mycobacterium tuberculosis complex strains in low and high burden countries.

Authors:  Irving Cancino-Muñoz; Ana Gil-Brusola; Manuela Torres-Puente; Carla Mariner-Llicer; John Dogba; Victor Akinseye; Kehinde Adesokan; Ayi Kwaghe; Francis Ejeh; Simeon Cadmus; Iñaki Comas
Journal:  Sci Rep       Date:  2019-10-25       Impact factor: 4.379

10.  Rifampicin resistance in Mycobacterium tuberculosis in Iran: a two-centre study.

Authors:  F Bahraminia; M Zangiabadian; M J Nasiri; M Fattahi; M Goudarzi; R Ranjbar; A A Imani Fooladi
Journal:  New Microbes New Infect       Date:  2021-06-23
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.