Literature DB >> 27274810

Lmod2 piggyBac mutant mice exhibit dilated cardiomyopathy.

Shuang Li1, Kaiqi Mo1, Hong Tian2, Chen Chu2, Shuna Sun2, Lei Tian3, Sheng Ding3, Tong-Ruei Li1, Xiaohui Wu1, Fang Liu2, Zhen Zhang4, Tian Xu3, Ling V Sun1.   

Abstract

BACKGROUND: Leiomodin proteins, Lmod1, Lmod2 and Lmod3, are key regulators of the thin filament length in muscles. While Lmod1 is specifically expressed in smooth muscles, both Lmod2 and Lmod3 are expressed in striated muscles including both cardiac and skeletal muscles. We and others have previously shown that Lmod3 mainly function in skeletal muscles and the mutant mice display disorganized sarcomere. Lmod2 protein has been found to act as an actin filament nucleator in both cell-free assays and in cultured rat and chicken cardiomyocytes.
RESULTS: To better understand the function of Lmod2 in vivo, we have identified and characterized a piggyBac (PB) insertional mouse mutant. Our analysis revealed that the PB transposon inserts in the first exon of the Lmod2 gene and severely disrupts its expression. We found that Lmod2 (PB/PB) mice exhibit typical dilated cardiomyopathy (DCM) with ventricular arrhythmias and postnatal lethality. Electron microscope reveals that the Lmod2 (PB/PB) hearts carry disordered sarcomere, disarrayed thin filaments, and distorted intercalated discs (ICDs). Those ICDs display not only decreased convolutions, but also reduced electron-dense staining, indicating less ICDs component proteins in Lmod2 (PB/PB) hearts. Consistent with the phenotype, the expression of the ICD component genes, β-catenin and Connexin43, are down-regulated.
CONCLUSIONS: Taken together, our data reveal that Lmod2 is required in heart thin filaments for integrity of sarcomere and ICD and deficient mice exhibit DCM with ventricular arrhythmias and postnatal lethality. The Lmod2 (PB/PB) mutant offers a valuable resource for interrogation of pathogenesis and development of therapeutics for DCM.

Entities:  

Keywords:  Dilated cardiomyopathy; Intercalated discs; Leiomodin2 mutant; Sarcomere

Year:  2016        PMID: 27274810      PMCID: PMC4893230          DOI: 10.1186/s13578-016-0101-y

Source DB:  PubMed          Journal:  Cell Biosci        ISSN: 2045-3701            Impact factor:   7.133


Background

The Leiomodin proteins, Lmod1, Lmod2 and Lmod3, are a subgroup of the Tropomodulin (Tmod) protein family and are regulators of the thin filament length in muscles [1-3]. While Lmod1 is specifically expressed in smooth muscles, both Lmod2 and Lmod3 are expressed in striated muscles including both cardiac and skeletal muscles [4-6]. We and others have previously shown that Lmod3 mainly functions in skeletal muscles [6-8] and Lmod3 mutants exhibit muscle atrophy in fast fibers [6]. The mutant mice display disorganized sarcomere and the presence of nemaline bodies in skeletal muscles, a hallmark of the disease nemaline myopathy (NM), consistent with the finding that LMOD3 is mutated in the NM patients [7]. Lmod2 protein has been found to act as an actin filament nucleator in both cell-free assays and in cultured rat and chicken cardiomyocytes [2, 5]. Overexpression of Lmod2 results in the elongated thin filaments and knockdown exhibited disrupted sarcomere assembly in cultured cardiomyocytes [2, 5]. Furthermore, it has been shown that Lmod2 is an antagonist of Tmod1 in cardiomyocytes [2, 5]. Knockout mice of Tmod1 are embryonic lethal due to cardiac defects, and overexpression of Tmod1 in the heart causes myofibril disorganization and dilated cardiomyopathy (DCM) [9-13]. However, the physiological function of Lmod2 remains unknown. We hypothesized that the phenotype of loss of Lmod2 in mice might mimic that of the overexpression of its antagonist Tmod1, and the mutant mice are high likely to carry DCM. Dilated cardiomyopathy is a common form of cardiomyopathies and the third most common inheritable heart disease [14]. DCM is diagnosed as dilated left ventricular accompanied by systolic dysfunction, less than 50 % ejection fraction (EF) [15]. These symptoms may be accompanied by other complications, including arrhythmias, coagulation, and congestive heart failure (CHF), which often lead to lethality [16, 17]. It has been estimated that DCM causes at least half of heart failures and less than 50 % of the DCM patients survive beyond year 5 after the diagnosis [16, 18, 19]. To better understand the function of Lmod2 in vivo, we have identified a piggyBac (PB) insertional mutant that disrupts Lmod2 expression and carried out phenotypic characterization of this mutant. We show here that Lmod2 is crucial for postnatal survival and essential for cardiac function. Lmod2 deficient mice display DCM with disrupted sarcomeres and intercalated discs (ICDs) including the expression of ICD genes, which offer a new mouse model for this deadly disease.

Results

Generation of Lmod2-deficient mice

Our group has shown that the PB transposon is highly active in mice and human cells and could be used to rapidly generate a large collection of insertional mouse mutants in a cost-effective manner [20]. One of the PB mutants that we generated has an insertion in the Lmod2 gene (Lmod2 in FVB/N background) [21]. This PB transposon is inserted in the non-coding region of the first exon of the Lmod2 transcriptional unit (Fig. 1a) and significantly down regulated the expression of the gene as revealed by quantitative RT-PCR (less than 5 and 10 % in homozygous mutant males and females in comparison to wild-type control Fig. 1b).
Fig. 1

PB transposon disrupts Lmod2 expression. a Schematic representation of the Lmod2 transcription unit and the position of PB insertion. Coding and untranslated region are depicted as black and white boxes, respectively. b Quantitative RT-PCR analysis of Lmod2 mRNA from heart of 3-week-old male and female mice with indicated genotypes, n = 3. Arrows PCR primers

PB transposon disrupts Lmod2 expression. a Schematic representation of the Lmod2 transcription unit and the position of PB insertion. Coding and untranslated region are depicted as black and white boxes, respectively. b Quantitative RT-PCR analysis of Lmod2 mRNA from heart of 3-week-old male and female mice with indicated genotypes, n = 3. Arrows PCR primers Tmod1 is an antagonist of Lmod2 at the pointed end of the thin filaments in cardiac muscle [5]. It has been suggested that the expression of Tmod1 could be affected by Lmod2 [5]. We therefore analyzed the transcriptional level of Tmod1 by quantitative PCR and found that the mRNA level of Tmod1 remains the same in 25 days old Lmod2 hearts compared to controls (Fig. 2a).
Fig. 2

Tmod1 and Lmod3 Expression in Lmod2 mutant mice. a mRNA level of Tmod1 is not changed in Lmod2PB/PB hearts compared with wild-type control. b Lmod3 protein level is also not changed in Lmod2PB/PB mice as shown here in western blotting and statistics

Tmod1 and Lmod3 Expression in Lmod2 mutant mice. a mRNA level of Tmod1 is not changed in Lmod2PB/PB hearts compared with wild-type control. b Lmod3 protein level is also not changed in Lmod2PB/PB mice as shown here in western blotting and statistics Lmod3, another member of the Leiomodin family, also expresses in heart together with Lmod2. It might be up regulated to functionally compensate the down-regulation of Lmod2. However, Western analysis revealed that the Lmod3 protein level in the hearts of Lmod2 is unchanged compared to its controls (Fig. 2b). Together, these data indicate that the phenotypes observed below are likely caused by reduction of Lmod2 gene activity alone and not a compound effect disrupting other Tmod family members.

Lmod2 mice exhibit postnatal lethality

Lmod2 mice are born with the expected ratio as well as their Lmod2 and wild-type littermates. This indicates that Lmod2 is not essential for mouse embryonic development. While Lmod2 mice are born alive with normal appearance and body weight, the mutant animals exhibit postnatal death around 3rd week of age and are all dead by 9th week (Fig. 3a). Furthermore, male mutant animals are also underweight after three weeks (Fig. 3b). Heterozygous Lmod2 animals have normal life spans and display no discernable phenotype including fertility. This result indicates that Lmod2 is crucial for postnatal survival.
Fig. 3

Lmod2PB/PB mice exhibit postnatal lethality and underweight in surviving males. Survival a and growth b curves of male and female Lmod2PB/PB mice compared with Lmod2PB/+ and Lmod2+/+ mice

Lmod2PB/PB mice exhibit postnatal lethality and underweight in surviving males. Survival a and growth b curves of male and female Lmod2PB/PB mice compared with Lmod2PB/+ and Lmod2+/+ mice

Lmod2 hearts display dilated cardiomyopathy defects

The Lmod2 mice have no overt signs of distress until 1 to 2 days before death. These signs include curling up, less movement, and dyspnea. Given that Lmod2 is expressed in heart [4], these phenotypes suggest that the mutant animals may suffer from cardiac dysfunction. We therefore conducted histological and physiological analyses of the Lmod2 mutant hearts from 25 days old mice before the animals display any signs of distress. Interestingly, all the analyzed Lmod2 mutants display enlarged ventricular lumens and thin ventricular walls, phenocopying the symptoms in human DCM patients (n=17, Fig. 4a). The histopathological defects were also confirmed by echocardiography analysis. The mutant hearts had dilated ventricular lumens (Fig. 4b) and thinner heart walls during both systolic and diastolic periods (Fig. 4c). Consistent with these, morphometric ratios (heart weight/body weight) were increased in these animals as well (Fig. 4d).
Fig. 4

Lmod2PB/PB hearts display dilated cardiomyopathy defects. 25-day old Lmod2PB/PB mice were examined for cardiac morphology and functions. a Longitudinal (upper) and transverse (lower) H&E stain sections of paraffin-embedded hearts (Scale bar 1 mm). b, c, e Echocardiography analysis of Lmod2PB/PB hearts in comparison to wild-type control n = 5. b Higher LV end diastolic and systolic diameter. LVID left ventricular diameter. c Thinner LV anterior and posterior wall. LVPW left ventricular posterior wall; LVAW left ventricular anterior wall. d Morphometric ratios (heart/body weight) of both male and female Lmod2PB/PB mice are significantly increased. e Reduced ejection fraction and fractional shortening values. f Quantitative RT-PCR analysis of atrial natriuretic factor (ANF) and brain natriuretic peptide (BNP) revealed increased expression of the heart hypertrophy and heart failure biomarkers n = 3. LV left ventricle; d diastolic; s: systolic. g, h Electronic Cardiogram revealed lengthening QTc value of Lmod2PB/PB mice in comparison to controls

Lmod2PB/PB hearts display dilated cardiomyopathy defects. 25-day old Lmod2PB/PB mice were examined for cardiac morphology and functions. a Longitudinal (upper) and transverse (lower) H&E stain sections of paraffin-embedded hearts (Scale bar 1 mm). b, c, e Echocardiography analysis of Lmod2PB/PB hearts in comparison to wild-type control n = 5. b Higher LV end diastolic and systolic diameter. LVID left ventricular diameter. c Thinner LV anterior and posterior wall. LVPW left ventricular posterior wall; LVAW left ventricular anterior wall. d Morphometric ratios (heart/body weight) of both male and female Lmod2PB/PB mice are significantly increased. e Reduced ejection fraction and fractional shortening values. f Quantitative RT-PCR analysis of atrial natriuretic factor (ANF) and brain natriuretic peptide (BNP) revealed increased expression of the heart hypertrophy and heart failure biomarkers n = 3. LV left ventricle; d diastolic; s: systolic. g, h Electronic Cardiogram revealed lengthening QTc value of Lmod2PB/PB mice in comparison to controls Echocardiography analysis also revealed that the mutant hearts displayed lower ejection fraction (EF) and fraction shortening (FS) values (Fig. 4e), characteristic DCM deficit. Furthermore, electrocardiography (ECG) analysis revealed lengthened corrected QT interval (QTc) in Lmod2 mice in comparison to controls (Fig. 4g, h). The lengthened QTc value means delayed electrical repolarization of the ventricles, indicating ventricular arrhythmia [22], complications that many DCM patients also develop. The expression of atrial natriuretic factor (ANF) and brain natriuretic peptide (BNP) were examined in mutant animals before signs of heart failure [23]. We discovered that the Lmod2 mutant mice already exhibited a significant increase in gene expression for the heart hypertrophy and heart failure biomarkers (Fig. 4f). Finally, Masson’s Trichrome staining revealed that there was no observable increase in fibrosis in these animals (data not shown).

Lmod2-deficiency leads to sarcomere and ICD disorganization

We further characterized cardiac muscles of Lmod2 mice (25 days old) by paraffin section and transmission electron microscope (EM). We noticed that the area between the muscle fibers is larger in Lmod2 cardiac muscles than the wild-type control (Fig. 5a, b, i). EM analysis revealed altered sarcomeres with irregular Z-discs and unidentifiable M-lines in Lmod2 cardiac fibers (Fig. 5c–f). For those fibers with recognizable Z-discs, measuring the length of the sarcomeres revealed shorter sarcomeres than wild-type control (Fig. 5j). Moreover, the filaments in the Lmod2 cardiac fibers are also disarrayed in comparison to wild-type control (Fig. 5e, f). Finally, the ICDs in Lmod2 cardiac fibers are less convoluted and have reduced electron dense (Fig. 5g, h). The ICD morphological changes suggest that the mutant fibers might have less ICD proteins. Quantitative RT-PCR (QPCR) indeed identified reduced expression of two of major ICD genes, β-catenin and Connexin43 (Cx43), components of fascia adherens and gap junctions, respectively (Fig. 5k). Together, these data indicate that Lmod2 deficient cardiac fibers have disrupted sarcomeres and ICDs including the expression of ICD genes.
Fig. 5

ICD and sarcomere defects of Lmod2PB/PB heart fibers and reduced expression of ICDs proteins. a, b Longitudinal sections of 25d paraffin-embedded hearts stained with H&E. c–h Representative electron micrographs of cardiac LV tissue from 25 days old Lmod2+/+ (c, e, g) and Lmod2PB/PB (e, f, h) mice. Sarcomeres (S) are shortened and disorganized in Lmod2PB/PB myocardium (c, d). Z-discs (Z) and M-lines (M) are disorganized and unrecognizable, respectively, in Lmod2PB/PB myocardium (e, f). Reduced convolution and electron dense of ICD (arrow) in Lmod2PB/PB myocardium (g, h). i Area and perimeter of the area between the muscle fibers are increased in Lmod2 PB/PB hearts compared with wild-type control n = 8. j Statistics of sarcomere length in Lmod2PB/PB myocardium n = 20. k Quantitative RT-PCR of major intercalated discs (ICD) genes n = 3. Scale bars 200 μm in b, 1 μm in d, 500 μm in f, h

ICD and sarcomere defects of Lmod2PB/PB heart fibers and reduced expression of ICDs proteins. a, b Longitudinal sections of 25d paraffin-embedded hearts stained with H&E. c–h Representative electron micrographs of cardiac LV tissue from 25 days old Lmod2+/+ (c, e, g) and Lmod2PB/PB (e, f, h) mice. Sarcomeres (S) are shortened and disorganized in Lmod2PB/PB myocardium (c, d). Z-discs (Z) and M-lines (M) are disorganized and unrecognizable, respectively, in Lmod2PB/PB myocardium (e, f). Reduced convolution and electron dense of ICD (arrow) in Lmod2PB/PB myocardium (g, h). i Area and perimeter of the area between the muscle fibers are increased in Lmod2 PB/PB hearts compared with wild-type control n = 8. j Statistics of sarcomere length in Lmod2PB/PB myocardium n = 20. k Quantitative RT-PCR of major intercalated discs (ICD) genes n = 3. Scale bars 200 μm in b, 1 μm in d, 500 μm in f, h

Discussion

Using PB insertional mutants, we have studied two members of the Lmod family, Lmod2 and Lmod3, which express in the cardiac and skeletal muscles. We previously reported that Lmod3 deficiency lead to severe skeletal muscle weakness with atrophy specific to fast fibers [6]. EM analysis revealed disorganized sarcomeres in skeletal muscles of Lmod3 mutant mice. Here we report the characterization of Lmod2-deficient mice caused by PB insertion in the first exon. Unlike Lmod3-deficient mice that are born small with skeletal muscle atrophy [6], Lmod2-deficient animals are born with normal appearance and body weight. Only male Lmod2-deficient mice exhibit underweight in the 4th week. On the other hand, Lmod2-deficient mice exhibit postnatal lethality and all mutant animals die from 3 to 9 weeks after birth. This postnatal lethality together with previous report of Lmod2 in cultured cardiomyocytes [2, 5] suggests a role of the gene in cardiac function. We have therefore carried out a pathological analysis of the Lmod2 mutant heart. Our study shows that the Lmod2 mutant hearts have enlarged ventricular with systolic dysfunction reflected with EF value less than 50 %, features that are characteristic to DCM patients. Investigation with transmission electron microscopy reveals that the Lmod2 cardiac muscles exhibit disordered sarcomeres and ICDs. The morphologies of Z-discs, M-lines, and thin filaments in sarcomeres are all affected. Intercalated disc is composed of highly organized fascia adherens, gap junctions and desmosomes, and glues cardiomyocytes together. Disruption of ICD would also lead to cardiomyopathy [24]. Recently, it has been shown that mutation in non-ICD component protein could also result in ICD structure abnormality and cardiomyopathy [25]. In the previous reported case, an increase in convolutions of ICD was reported in the cardiomyopathy patient [25]. Here we show that Lmod2 cardiomyocytes have a decrease in ICD convolution and cardiomyopathy. Disruption of ICD is also confirmed by reduction in electron density and expression of two of major ICD genes, β-catenin and Connexin43 (Cx43), components of fascia adherens and gap junctions. Therefore, Lmod2 mouse model represents a new ICD phenotype related to DCM. During preparation of our manuscript, we noticed that a report of Lmod2 knockout mouse characterization [26]. While DCM was observed in both models, there were differences in ultrastructure of cardiac muscles. In contrast to Lmod2 phenotypes, Lmod2 knockout model reported widen Z-discs and increased convolutions of ICDs [26]. The difference could be due to the C57BL/6J background for the Lmod2 knockout and FVB/N for Lmod2. The morphological defects in cardiac muscles proceed the symptom of heart failure in animals. Similarly, the expressions of the heart hypertrophy and heart failure biomarkers, atrial natriuretic factor (ANF) and brain natriuretic peptide (BNP), are elevated before the detection of heart failure. Together, these data show that Lmod2 deficiency leads to structure abnormality of cardiac muscles, which results in DCM, and that Lmod2 mice offer a new model for studying DCM mechanisms and developing therapeutics.

Conclusion

Taken together, our data reveal that Lmod2 is required in heart thin filaments for integrity of sarcomere and ICD and deficient mice exhibit DCM with ventricular arrhythmias and postnatal lethality. The Lmod2PB/PB mutant offers a valuable resource for interrogation of pathogenesis and development of therapeutics for DCM.

Methods

Mouse strains

The founder Lmod2 mouse was produced by a large-scale genome-wide insertional mutagenesis with the PB transposon in the FVB/N mice [20, 27].

Genotyping

Genomic DNA was isolated by a 56 °C overnight digestion of mouse toes in 200 μL lysis buffer (100 mM NaCl, 10 mM Tris pH 8.0, 25 mM EDTA, and 0.5 % SDS) plus fresh 0.1 mg/ml proteinase K. PCR was performed with primers within exon 1 of Lmod2 (forward: 5′-AGCTGTCGGCTTTCAATTTTTTTCC-3′; reverse: 5′-TGTCTTCCAGCTCCCTCTCAAG-3′, 247 bp product) and primers within the PB transposon (forward: 5′-CTGAGATGTCCTAAATGCACAGCG-3′ and reverse: 5′-TGTCTTCCAGCTCCCTCTCAAG-3′, 819 bp product). PCR conditions used were as the following: an initial denaturation step at 93 °C for 3 min, then followed by a 40 cycle of 93 °C for 30 s/57 °C for 30 s/65 °C for 2 min, and one more elongation at 65 °C for 10 min as the final step.

Reverse transcription and quantitative RT-PCR

Total RNA was isolated from 3-week-old mouse heart with Trizol (Invitrogen). The cDNA was synthesized then using the PrimeScriptTM RT reagent Kit (Takara). Quantitative RT-PCR was performed with AceQ qPCR SYBR Green Master Mix (Vazyme) according to the manufacturer’s instruction. All quantitative RT-PCR primers are listed in Table 1.
Table 1

Quantitative RT-PCR primers

GeneForward (5′→3′)Reverse (5′→3′)
Lmod2ACCTTATCCCGATTTGCTGAAGACCTTGAGCATGTCTGCAATG
GAPDHTGTTCCTACCCCCAATGTGTCCGGAGTTGCTGTTGAAGTCGCAG
Tmod1TGAGCTAGATGAACTAGACCCTGCGGTCCTTAAATTCCTTCGCTTG
ANFCATCACCCTGGGCTTCTTCCTCATCACCCTGGGCTTCTTCCT
BNPGCGGCATGGATCTCCTGAAGGGCGGCATGGATCTCCTGAAGG
PlakoglobinTGGCAACAGACATACACCTACGGGTGGTAGTCTTCTTGAGTGTG
N-cadherinAGCGCAGTCTTACCGAAGGTCGCTGCTTTCATACTGAACTTT
VinculinGAGGCTGAACTGCTTCAATCACCAGATTTGACGAGGTGCCTA
β-cateninATGGAGCCGGACAGAAAAGCCTTGCCACTCAGGGAAGGA
Cx43ACAGCGGTTGAGTCAGCTTGGAGAGATGGGGAAGGACTTGT
Quantitative RT-PCR primers

Western blotting

Hearts were dissected and lysed in RIPA buffer with Complete Protease inhibitors (Roche) and PMSF (Phenylmercury acetate) (Sigma) on ice. The BCA Assay (Themo) was applied to quantify total proteins extracted. The western blotting procedure was carried out according to standard protocol with a brief introduction here. Protein bands were separated by SDS/PAGE and transferred to nitrocellulose membranes (Immobilon-P). The transferred membrane was blotted first 5 % skim milk for 1 h. Blots were then incubated with a primary antibody and a secondary antibody consecutively to detect protein of interest. Primary antibodies used are the following: Lmod3 (1:1000; HPA036034, Sigma), GAPDH (1:3000; AC001, ABclonal). Secondary antibody used is the Anti-rabbit IgG antibody conjugated to PerCP-Cy5.5 (1:3000; sc-45101, Santa Cruz). Signal was finally visualized by enhanced chemiluminescence (34,080, Themo).

Echocardiography and ECG

Mice were anesthetized by inhalation of 1–2 % isoflurane delivered in a gas mixture with oxygen, medical-grade compressed air, and nitrogen. The anesthetized mice went through echocardiography with the Vevo 770 microultrasound system (VisualSonics Inc. Toronto, Canada). Both parasternal long-axis and short-axis views of the left ventricles were analyzed with a 707B transducer according to the manufacturer’s instruction. Data were recorded in M mode. Conscious and unrestrained mice were used for ECG analysis with the ECGenie electrocardiography system (Mouse Specifics, Inc., Boston, MA) according to the manufacturer’s instruction. Before experimental tests, mice should be trained for 3–5 days to behave normally in this machine. Only data from continuous recordings of 20–30 ECG signals were included in the final analyses. A physiologic waveform analysis platform “eMOUSE” (Mouse Specifics, Inc.) was applied for data analysis.

Transmission electron microscopy

Samples for transmission electron microscopy were prepared using the standard procedure: hearts were excised, washed in PBS, fixed in 2.5 % glutaraldehyde in 0.1 M cacodylate buffer for more than 2 h, washed in 0.1 M cacodylate buffer for 3 × 15 min, post-fixed with 1 % potassium ferrocyanide reduced OsO4 on ice for 2–3 h, dehydrated through graded ethanol and acetone, and finally embedded in EMbed 812 resin. Ultrathin sections (60 nm) were analyzed on a Technai G2 Spirit BioTWIN electron microscope, and images were collected with a 4 × 4 digital camera (Optronics). Length of sarcomere was measured using ImageJ.

Histology

Hearts were excised, washed in PBS, fixed in 4 % paraformaldehyde solution (Sangon Biotech) overnight, dehydrated, and embedded in paraffin. Longitudinal or transverse sections (10 μm) were stained with a Masson Trichrome Stain Kit (Maixin Biotech) or according to the classical hematoxylin and eosin (H&E) staining protocol (Sigma), and finally mounted with DPX Mountant (Sigma). Light microscopy images were captured using a Nikon Eclipse microscope with a Nikon DS-Ri1 camera and/or a Zeiss Axio Zoom V16 stereomicroscope with an AxioCam MRc camera.

Statistics

Data were presented as mean ± SED in figures. Two-tailed unpaired Student’s t-test was used unless otherwise stated. The significance is indicated as the label of one or more * with the following categories: (1) * P < 0.05; (2) ** P < 0.01; 3) *** P < 0.005. Prism 6 (GraphPad Software) was used for plotting.
  25 in total

1.  Leiomodin-3 dysfunction results in thin filament disorganization and nemaline myopathy.

Authors:  Michaela Yuen; Sarah A Sandaradura; James J Dowling; Alla S Kostyukova; Natalia Moroz; Kate G Quinlan; Vilma-Lotta Lehtokari; Gianina Ravenscroft; Emily J Todd; Ozge Ceyhan-Birsoy; David S Gokhin; Jérome Maluenda; Monkol Lek; Flora Nolent; Christopher T Pappas; Stefanie M Novak; Adele D'Amico; Edoardo Malfatti; Brett P Thomas; Stacey B Gabriel; Namrata Gupta; Mark J Daly; Biljana Ilkovski; Peter J Houweling; Ann E Davidson; Lindsay C Swanson; Catherine A Brownstein; Vandana A Gupta; Livija Medne; Patrick Shannon; Nicole Martin; David P Bick; Anders Flisberg; Eva Holmberg; Peter Van den Bergh; Pablo Lapunzina; Leigh B Waddell; Darcée D Sloboda; Enrico Bertini; David Chitayat; William R Telfer; Annie Laquerrière; Carol C Gregorio; Coen A C Ottenheijm; Carsten G Bönnemann; Katarina Pelin; Alan H Beggs; Yukiko K Hayashi; Norma B Romero; Nigel G Laing; Ichizo Nishino; Carina Wallgren-Pettersson; Judith Melki; Velia M Fowler; Daniel G MacArthur; Kathryn N North; Nigel F Clarke
Journal:  J Clin Invest       Date:  2014-09-24       Impact factor: 14.808

2.  Knockout of Lmod2 results in shorter thin filaments followed by dilated cardiomyopathy and juvenile lethality.

Authors:  Christopher T Pappas; Rachel M Mayfield; Christine Henderson; Nima Jamilpour; Cathleen Cover; Zachary Hernandez; Kirk R Hutchinson; Miensheng Chu; Ki-Hwan Nam; Jose M Valdez; Pak Kin Wong; Henk L Granzier; Carol C Gregorio
Journal:  Proc Natl Acad Sci U S A       Date:  2015-10-20       Impact factor: 11.205

3.  Efficient transposition of the piggyBac (PB) transposon in mammalian cells and mice.

Authors:  Sheng Ding; Xiaohui Wu; Gang Li; Min Han; Yuan Zhuang; Tian Xu
Journal:  Cell       Date:  2005-08-12       Impact factor: 41.582

4.  Disruption in the tropomodulin1 (Tmod1) gene compromises cardiomyocyte development in murine embryonic stem cells by arresting myofibril maturation.

Authors:  Yasuko Ono; Catherine Schwach; Parker B Antin; Carol C Gregorio
Journal:  Dev Biol       Date:  2005-06-15       Impact factor: 3.582

5.  Leiomodin 3 and tropomodulin 4 have overlapping functions during skeletal myofibrillogenesis.

Authors:  Chinedu U Nworu; Robert Kraft; Daniel C Schnurr; Carol C Gregorio; Paul A Krieg
Journal:  J Cell Sci       Date:  2014-11-27       Impact factor: 5.285

6.  Severe myopathy in mice lacking the MEF2/SRF-dependent gene leiomodin-3.

Authors:  Bercin K Cenik; Ankit Garg; John R McAnally; John M Shelton; James A Richardson; Rhonda Bassel-Duby; Eric N Olson; Ning Liu
Journal:  J Clin Invest       Date:  2015-03-16       Impact factor: 14.808

Review 7.  Molecular biology and the prolonged QT syndromes.

Authors:  J A Towbin; M Vatta
Journal:  Am J Med       Date:  2001-04-01       Impact factor: 4.965

8.  Leiomodin is an actin filament nucleator in muscle cells.

Authors:  David Chereau; Malgorzata Boczkowska; Aneta Skwarek-Maruszewska; Ikuko Fujiwara; David B Hayes; Grzegorz Rebowski; Pekka Lappalainen; Thomas D Pollard; Roberto Dominguez
Journal:  Science       Date:  2008-04-11       Impact factor: 47.728

Review 9.  Inherited cardiomyopathies.

Authors:  Hariharan Raju; Corinna Alberg; Gurdeep S Sagoo; Hilary Burton; Elijah R Behr
Journal:  BMJ       Date:  2011-11-21

10.  Clinical and genetic issues in dilated cardiomyopathy: a review for genetics professionals.

Authors:  Ray E Hershberger; Ana Morales; Jill D Siegfried
Journal:  Genet Med       Date:  2010-11       Impact factor: 8.822

View more
  10 in total

Review 1.  Tropomodulins and Leiomodins: Actin Pointed End Caps and Nucleators in Muscles.

Authors:  Velia M Fowler; Roberto Dominguez
Journal:  Biophys J       Date:  2017-05-09       Impact factor: 4.033

2.  Co-expression networks reveal the tissue-specific regulation of transcription and splicing.

Authors:  Ashis Saha; Yungil Kim; Ariel D H Gewirtz; Brian Jo; Chuan Gao; Ian C McDowell; Barbara E Engelhardt; Alexis Battle
Journal:  Genome Res       Date:  2017-10-11       Impact factor: 9.043

Review 3.  Animal Models to Study Cardiac Arrhythmias.

Authors:  Daniel J Blackwell; Jeffrey Schmeckpeper; Bjorn C Knollmann
Journal:  Circ Res       Date:  2022-06-09       Impact factor: 23.213

Review 4.  The Mechanisms of Thin Filament Assembly and Length Regulation in Muscles.

Authors:  Szilárd Szikora; Péter Görög; József Mihály
Journal:  Int J Mol Sci       Date:  2022-05-10       Impact factor: 6.208

5.  Disruption of cardiac thin filament assembly arising from a mutation in LMOD2: A novel mechanism of neonatal dilated cardiomyopathy.

Authors:  Rebecca C Ahrens-Nicklas; Christopher T Pappas; Gerrie P Farman; Rachel M Mayfield; Tania M Larrinaga; Livija Medne; Alyssa Ritter; Ian D Krantz; Chaya Murali; Kimberly Y Lin; Justin H Berger; Sabrina W Yum; Chrystalle Katte Carreon; Carol C Gregorio
Journal:  Sci Adv       Date:  2019-09-04       Impact factor: 14.136

6.  Novel insights into sarcomere regulatory systems control of cardiac thin filament activation.

Authors:  Christopher Solís; R John Solaro
Journal:  J Gen Physiol       Date:  2021-07-05       Impact factor: 4.086

7.  Identification and Functional Prediction of Long Non-Coding RNAs in Dilated Cardiomyopathy by Bioinformatics Analysis.

Authors:  Yu-Xiao Chen; Jie Ding; Wei-Er Zhou; Xuan Zhang; Xiao-Tong Sun; Xi-Ying Wang; Chi Zhang; Ni Li; Guo-Feng Shao; Shen-Jiang Hu; Jian Yang
Journal:  Front Genet       Date:  2021-04-16       Impact factor: 4.599

8.  Neonatal-lethal dilated cardiomyopathy due to a homozygous LMOD2 donor splice-site variant.

Authors:  Michaela Yuen; Lisa Worgan; Jessika Iwanski; Christopher T Pappas; Himanshu Joshi; Jared M Churko; Susan Arbuckle; Edwin P Kirk; Ying Zhu; Tony Roscioli; Carol C Gregorio; Sandra T Cooper
Journal:  Eur J Hum Genet       Date:  2022-01-26       Impact factor: 4.246

9.  Cardiac leiomodin2 binds to the sides of actin filaments and regulates the ATPase activity of myosin.

Authors:  Dávid Szatmári; Beáta Bugyi; Zoltán Ujfalusi; László Grama; Réka Dudás; Miklós Nyitrai
Journal:  PLoS One       Date:  2017-10-12       Impact factor: 3.240

10.  In vivo elongation of thin filaments results in heart failure.

Authors:  Lei Mi-Mi; Gerrie P Farman; Rachel M Mayfield; Joshua Strom; Miensheng Chu; Christopher T Pappas; Carol C Gregorio
Journal:  PLoS One       Date:  2020-01-03       Impact factor: 3.240

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.