Literature DB >> 27270507

Genetic variations associated with six-white-point coat pigmentation in Diannan small-ear pigs.

Meng-Die Lü1,2,3, Xu-Man Han1, Yun-Fei Ma1, David M Irwin1, Yun Gao1, Jia-Kun Deng1, Adeniyi C Adeola1,2, Hai-Bing Xie1, Ya-Ping Zhang1,4.   

Abstract

A common phenotypic difference among domestic animals is variation in coat color. Six-white-point is a pigmentation pattern observed in varying pig breeds, which seems to have evolved through several different mechanistic pathways. Herein, we re-sequenced whole genomes of 31 Diannan small-ear pigs from China and found that the six-white-point coat color in Diannan small-ear pigs is likely regulated by polygenic loci, rather than by the MC1R locus. Strong associations were observed at three loci (EDNRB, CNTLN, and PINK1), which explain about 20 percent of the total coat color variance in the Diannan small-ear pigs. We found a mutation that is highly differentiated between six-white-point and black Diannan small-ear pigs, which is located in a conserved noncoding sequence upstream of the EDNRB gene and is a putative binding site of the CEBPB protein. This study advances our understanding of coat color evolution in Diannan small-ear pigs and expands our traditional knowledge of coat color being a monogenic trait.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27270507      PMCID: PMC4897638          DOI: 10.1038/srep27534

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Domestication of the pig has been accompanied with retention of a tremendous amount of phenotypic variation regarding growth, behavior, and coat color. The diverse domestic pig breeds thus provide valuable animal models for genetic studies on phenotypic variation123. Coat color was potentially exposed to artificial selection at an ancient time, dating back to about 5,000 years ago4. Variation in coat color may have important implications for pig breed development and conservation. Distinct coat colors have evolved in different pig breeds and may even have been used as visual characteristic to distinguish between breeds5. The most common coat colors found in domestic pigs include black, brown, white, red, spotted, belted, and two-end-black, which are distinct from the camouflage coat color of wild boars46789. The genetic mechanisms underlying variation in coat color is an interesting topic. Six-white-point (SWP) is a common kind of coat color in pigs that and is characterized by a white coat on the four feet, the head, and the end of tail but with the remaining coat being black. The SWP phenotype is observed in many well-known European and East Asian domestic pigs, including the Berkshire pigs from Europe10, as well as Diannan small-ear (DSE), Tibetan, Longlin and Anqing six-white-point pigs in China11. The SWP coat color in the Berkshire pigs was found to be influenced by the melanocortin 1 receptor encoding (MC1R) gene, with this phenotype regarded as a special presentation of spotted color, as it is usually observed with black spots on white or red backgrounds5. In Berkshire pigs, two mutations in the MC1R gene are likely involved in formation of the SWP coat color pattern. The D124N MC1R allele probably causes a complete black body color4. SWP in the Berkshire is derived from the MC1R D124N allele through a 2-bp insertion in the coding region that leads to a coding frameshift and a premature stop codon. The background skin expresses the 2-bp inserted MC1R premature transcript, while the black-spotted area expresses a transcript without the 2-bp insertion, possibly due to somatic reversion events10. Additional to the MC1R locus, further evidence indicated that variation in the KITLG gene may also influence the coat color of Berkshire pigs12. Due to the independent domestication of pigs in Europe and East Asia1314, black coat color has putatively evolved through different genetic mutations in the coding sequence of the MC1R gene in East Asia (L102P) and Europe (D124N)415. Thus how the SWP phenotype evolved in East Asian domestic pigs, where these animals have a MC1R allele containing the L102P substitution remains mysterious. In this study, we aimed to screen for genomic variants underlying the SWP phenotype using whole genome resequencing of DSE pigs from Yunnan province, China. DSE pigs have varying coat colors, including whole body black (denoted as “black” below) and SWP. Here we show that the SWP phenotype in DSE pigs is not attributed to variation in the MC1R gene, but rather it is associated with variations in multiple genes with differing phenotypic contributions.

Results

Coat colors in DSE pigs

To obtain coat color phenotype data on the DSE pig, we collected pig samples and classified their coat color as either SWP or black. A total of 1,977 DSE pig samples were collected with coat color phenotype information with 753 (38%) of the DSE pigs being black and 1,224 (62%) being SWP. A comparison of whole black body and SWP phenotypes of DSE pigs is shown in Fig. 1. The white point on the head of the DSE pigs is located on the forehead. The SWP phenotype in the examined DSE individuals is highly variable, with 1,171 of the 1,224 SWP having a partial phenotype with the absence of the white coat at one or more of the six points. From our findings, black individuals were observed in about 78.6% of litters produced by SWP parents, and about 33% were black in the total population produced by SWP parents. SWP individuals were observed in about 25.5% of litters from black parents, and about 21.6% were SWP in the total population from black parents. About 47% SWP and 53% black offspring were observed in the cross between black and SWP DSE pigs.
Figure 1

Typical coat color phenotypes in Diannan small-ear pigs.

(a) six-white-point pigmentation. (b) whole body black pigmentation.

Whole genome resequencing of DSE pigs

To study the SWP phenotype in the DSE pigs, we selected 31 individuals (17 SWP and 14 black) for whole genome re-sequencing. Among the 17 SWP individuals, 11 had the typical SWP phenotype. Genomes were sequenced at about 7× depth of coverage for 8 SWP individuals and about 3× for the remaining 23 individuals. Genomic reads were quality filtered and mapped to the pig reference genome16. On average, the resequencing data for each individual covered about 75% of the reference genome (Supplementary Table S1). We screened for genomic variants in the 31 individuals and a total of 23.9 million SNPs were identified. Among these SNPs, only about 150K and 107K were located in protein coding and UTR sequences, respectively, while most of them were located in noncoding sequences (6M in introns and 17.5M in intergenic sequences). Further classification showed that 69,707 SNPs were located in conserved sequences, 2,717,284 in putative regulatory sequences, and 347,597 in putative transcription factor DNA-binding motifs. Detailed information on the distribution of SNPs on each chromosome is shown in Supplementary Table S2.

Analysis of the MC1R gene

To determine whether the SWP in the DSE pigs is associated with the 2-bp insertion in the coding sequence of the MC1R gene, as previously shown in Berkshire pigs10, we searched for the presence of a 2-bp insertion in MC1R in SWP and black DSE pigs. The 2-bp insertion in MC1R was not detected in any of the re-sequenced DSE pigs, and both the SWP and black DSE pigs were homozygous for the expected L102P MC1R allele (Supplementary Table S3). This observation implies that the SWP phenotype in the DSE pigs is not caused by a 2-bp insertion in the MC1R gene. Black East Asian domestic pigs carry a L102P missense mutation in the MC1R gene10, as compared to a D124N mutation in some black domestic pigs from Europe4, and all of the re-sequenced DSE samples are homozygous for L102P. No mutations were identified at the D124 position (Supplementary Table S3), confirming that the MC1R allele in DSE pigs is of East Asian ancestry and not of European origin. In our comparative analysis, the MC1R locus does not show strong differentiation between the black and SWP DSE pigs (data not shown). These results further imply that the SWP coat color in DSE pigs likely is not be attributed by MC1R mutations.

Screening for genomic regions putatively associated with SWP phenotype

We first screened genomic regions that were highly differentiated between the SWP and black DSE pigs. In this analysis, 751 genes (Supplementary Table S4) were identified in genomic 10-kb sliding windows (containing at least 100 SNPs) with FST values above the chromosomal top 1% threshold (Fig. 2a, Supplementary Table S5). Some genes in the identified gene set are well known for roles in coat color regulation17, including the endothelin receptor type B (EDNRB) and dopachrome tautomerase (DCT) genes. EDNRB is important in the development of melanocytes18 and is involved in two-end-black phenotype regulation in pigs121920. DCT null mice show diluted pigmentation with reduced melanin content in hair21.
Figure 2

Whole genome screening of loci putatively associated with the SWP phenotype in DSE pigs.

(a) Autosomal plot of genomic differentiation (FST) between the SWP and black DSE pigs.(b) Autosomal XP-EHH plot in SWP DSE pigs with black DSE pigs as a background. (c) Association of IBD segments with the coat color phenotypes in the whole genome resequenced DSE pigs.

To determine whether some haplotypes are associated with the SWP phenotype in DSE pigs, we compared the extended haplotype homozygosity (EHH) between SWP and whole black DSE pigs with an XP-EHH analysis. In addition, as SWP DSE pigs may share some genomic sequences that were inherited from a recent common ancestor, we also examined the inheritance of genomic sequences by analyzing the sharing of identity-by-descent (IBD) segments in the DSE pigs. The XP-EHH- and IBD-based screening approaches (Fig. 2b,c) identified several genomic regions (Supplementary Table S6) replicating the signals in the FST analysis at the PTEN induced putative kinase 1 (PINK1) locus on chromosome 6, and at the SLC19A2 gene on chromosome 4.

Association analysis of candidate genes in a large population of DSE pigs

To further analyze the association of SWP with candidate genes identified in our analysis, we focused on 18 SNPs, representing 18 different candidate genes (Supplementary Table S7). These 18 SNPs were chosen in genomic regions (<1Mb) showing a clustering of at least twenty 10-kb sliding windows with FST above the chromosomal top 10% threshold and containing at least three 10-kb sliding windows (each containing at least 100 SNPs) with window FST values above the chromosomal top 5% threshold. We selected the 18 SNPs with a rationale that each was from the top 10 SNPs having the highest FST values in each region, with a preference for a SNP covered by the largest number of resequenced individuals and avoiding SNPs located in repetitive sequences. A large population (n = 384) of DSE pigs with their coat color phenotype information was collected, where 215 were black and 169 were SWP pigs (37.87% of which had the typical SWP phenotype). The genotypes of all 18 SNPs were determined from all 384 individuals. Genotyping showed that the derived allele frequency difference between the SWP and black DSE populations were in concordance with that obtained in the whole genome re-sequenced population (Fig. 3). Of the 18 SNPs, 3 SNPs showed a statistically significant (P < 0.05; Pearson’s Chi-squared test) difference in their allele frequencies between the black and SWP individuals. However, none of the SNPs were completely fixed in the SWP pigs.
Figure 3

Derived allele frequency distribution of 18 tagged SNPs in 384 DSE pigs.

The 18 SNPs represent 18 distinct loci. The allele frequencies were calculated in both the SWP (n = 169) and black (n = 215) DSE pigs.

The association of the genotypes at the 18 SNPs and the SWP phenotype in the 384 phenotypic pigs was tested and unveiled an association with the SWP phenotype for 11 of these SNPs. Pronounced associations were observed at 3 SNPs from the genomic regions containing the EDNRB (P = 1.01 × 10−11; OR = 2.988), centlein, centrosomal protein (CNTLN) (P = 5.58 × 10−10; OR = 2.714), and PINK1 (P = 3.04 × 10−7; OR = 2.269) encoding genes. Additional associations were observed for eight SNPs linked to the Golgi apparatus membrane protein TVP23 homolog C (TVP23C) (P = 1.12 × 10−5; OR = 1.908), aryl hydrocarbon receptor nuclear translocator 2 (ARNT2) (P = 1.37 × 10−5; OR = 1.983), ring finger protein 19A, E3 ubiquitin protein ligase (RNF19) (P = 1.15 × 10−4; OR = 1.857), coiled-coil domain containing 182 (MSI2) (P = 1.80 × 10−4; OR = 1.851), Down Syndrome cell adhesion molecule (DSCAM) (P = 3.41 × 10−4; OR = 1.775), SRY-box 5 (SOX5) (P = 2.04 × 10−4; OR = 1.725), sentrin-specific protease 1 (SENP1) (P = 3.0 × 10−3; OR = 1.544), and optic atrophy 1 (OPA1) (P = 3.66 × 10−3; OR = 1.597) encoding genes. In a least-squares linear regression analysis, we found that genetic variation in EDNRB, CNTLN, and PINK1 genes individually explain about 12.68%, 9.36%, and 7.14% coat color phenotypic variance in the DSE pigs respectively. However, the fraction of phenotypic variance explained by a single locus might be overestimated due to neglecting the fraction of variance explained by other loci, conditional on the genotypes at the focused locus. We performed a multiple regression analysis with the genetic variation combinations from these three loci, which showed that 18.52% of the coat color phenotypic variation was explained by the genetic co-variation from the EDNRB + CNTLN loci. Similarly, combinations of EDNRB + PINK1 and CNTLN + PINK1 explained 17.11% and 11.49% of the phenotypic variance, respectively. Genetic variation from the three loci explains 19.98% of the total phenotypic variance. The genetic variation from all 18 SNPs explains about 31.35% of the total phenotypic variance.

Potential regulatory sequence mutations in the EDNRB locus

We are interested in associations between the EDNRB gene and the SWP phenotype. Earlier studies revealed that EDNRB is an important gene in pigmentation regulation and is putatively involved in the two-end-black pigmentation in pigs1219. In our analysis, the EDNRB locus showed the strongest association with the SWP phenotype and explained the largest fraction of the phenotypic variance. We screened the SNPs at the EDNRB locus to identify mutations that are highly differentiated between the SWP and black DSE pigs. In the whole genome re-sequenced DSE population, a total of 452 SNPs were identified, of which 179 (Supplementary Table S8) were identified with differentiation between the SWP and black pigs above the chromosomal top 10% threshold. These 179 SNPs were all located in the intergenic sequence upstream of the EDRNB gene (Supplementary Figure S1). In a 100-way cross-species whole genome alignment analysis, 12 of the 179 SNPs (Table 1) were located in conserved noncoding sequences (CNS). As CNSs are a class of noncoding sequences that have evolved under strong evolutionary constraint, they are considered to potentially influence gene expression22. The location of SNPs inside a CNS is indicative of functional changes to expressional regulation of the EDRNB gene.
Table 1

SNPs located in putative regulatory sequences at the EDNRB locus on pig chromosome 11.

PositionAllelesDNaseITFBSTFBS MotifCNSPig sequence (chr11)Human sequence (chr13)
54,766,623C/TYesYes54,766,521–54,766,67178,543,585–78,543,735
54,769,314A/TCEBPBYes54,769,309–54,769,51778,553,924–78,554,189
54,769,363G/ACEBPBYes54,769,309–54,769,51778,553,924–78,554,189
54,769,400G/ACEBPBYes54,769,309–54,769,51778,553,924–78,554,189
54,769,424G/ACEBPBCEBPBYes54,769,416–54,769,43178,554,033–78,554,048
54,769,730T/CYesBACH1Yes54,769,711–54,769,79178,554,376–78,554,463
54,769,742C/TYesBACH1Yes54,769,711–54,769,79178,554,376–78,554,463
54,770,500C/AYesSTAT3;BACH1;FOS;MAFKYes54,770,363–54,770,59778,554,832–78,555,068
54,770,533G/AYesSTAT3;BACH1;FOS;MAFKYes54,770,363–54,770,59778,554,832–78,555,068
54,832,568C/TYesYes54,832,544–54,832,57278,561,160–78,561,188
54,837,948A/GYes54,837,930–54,837,96578,565,249–78,565,284
54,837,959A/GYes54,837,930–54,837,96578,565,249–78,565,284

DNaseI indicates a DNase I hypersensitive site; TFBS indicates transcription factor binding site; TFBS Motif indicates a transcription factor DNA-binding motif; CNS indicates a conserved noncoding sequence.

Interestingly, a SNP (G>A; chr11: 54,769,424) is located in a sequence which is orthologous to the human counterpart that has been demonstrated to be a DNA-binding motif for the CCAAT/enhancer binding protein, beta (CEBPB), a b-ZIP transcription factor that binds to the consensus sequence (5′-T[TG]NNGNAA[TG]-3′) in promoters and upstream elements and stimulates gene expression23. A cross-species genome alignment showed that this CEBPB DNA-binding motif upstream of the EDNRB gene is highly conserved in mammals (Fig. 4a), indicating that it likely has an important biological function under strong evolutionary constraint. Strikingly, the G>A SNP position is centered at the binding motif in the CEBPB binding sequence and the mutation alters the DNA-binding sequence to 5′-T[TG]NNANAA[TG]-3′ (underlined “A” is the derived allele in the SWP DSE pigs), at a nucleotide that is highly conserved in the enhancers of a variety of genes23. This mutation may lead to a change in transactivation efficiency. In the whole genome resequencing, the G>A SNP was detected in reads from 12 SWP and 13 whole body black DSE pigs. Among the 12 SWP pigs, 10 were homozygous for the derived allele (adenine), and 2 were heterozygous, while in comparison, in the 13 black pigs, 6 were homozygous for the ancestral allele, 5 were heterozygous, and only 2 were homozygous for the derived allele. However, this SNP is likely in linkage with, rather than being, a causative mutation, inferring from the distribution of mutant homozygotes in the black DSE pigs.
Figure 4

Cross-species alignment of genomic sequences enclosing two SNPs in the EDNRB and PINK1 loci.

(a) A SNP (chr11: 54,769,424; G>A) in the CEBPB DNA-binding motif upstream of the EDNRB gene. The position of the mutation position is indicated by a box. (b) A nonsynonymous mutation in the kinase domain of the PINK1. The arrow indicates the position of the mutation at a highly conserved residue from a variety of mammals.

Besides the SNP at the CEBPB recognition site, 11 additional SNPs (Table 1) were located in putative regulatory sequences. Among these, 3 SNPs (chr11: 54,769,314, 54,769,363, and 54,769,400) were found in the CEBPB binding sequence, with two SNPs (chr11: 54,770,500 and 54,770,533) identified in a sequence orthologous to a human sequence detected as a binding site by chromatin immunoprecipitation (ChIP) with the transcription factors STAT3, BACH1, FOS, and MAFK. Two additional SNPs (chr11: 54,769,730 and 54,769,742) were located in sequences orthologous to a human BACH1 binding sequence and a DNase I hypersensitive site. The SNP data set provides important mutation candidates for the SWP phenotype study.

Mutation analysis of the PINK1 locus

A 280-kb genomic sequence on chromosome 6 showed FST values reaching the chromosomal top 5% threshold. A total of 2,140 SNPs were found in this region. Among them, 553 SNPs were identified with FST values above the chromosomal top 10%. Six protein coding genes, including CAMK2N1, MUL1, FAM43B, CDA, PINK1, and DDOST, were identified within this 280-kb genomic span. The peak of the FST values of the 10-kb sliding windows is located on the PINK1 gene. Screening the 553 SNPs revealed two nonsynonymous and two synonymous mutations that were differentiated between the black and SWP DSE pigs. The two nonsynonymous mutations alter two residues (P195S and E396D) that are located in the kinase domain. The FST values are 0.42 and 0.24 at the P195S (chr6: 73,118,955; C>T) and E396D (chr6: 73,125,086; G>C) mutation sites. However, the SWP DSE pigs show an ancestral allele frequency (0.76) higher than the black DSE pigs (0.06) at the P195S coding site. In comparison, the derived allele frequency in the SWP DSE pigs (0.95) is much higher than in the black DSE pigs (0.40) at the E396D coding site. A multi-species sequence alignment showed that residue E396 is highly conserved in vertebrates (Fig. 4b), indicating a functional importance. Mutations at highly conserved residues in the kinase domain have been reported to impair or eliminate the PINK1 function24, thus the nonsynonymous mutation E396D potentially influences PINK1 function.

Discussion

Selection for coat color has occurred since the domestication of the pig. Substantial variation in coat color exists in domestic pigs, and this phenotype has been a focus of evolutionary studies25. In this study, we examined the genetics underlying the SWP phenotype in DSE pigs, a well-known indigenous domestic pig from China. The SWP phenotype is highly variable in the DSE pigs and with a complicated mode of inheritance. Our findings showed that black parents have SWP offspring while SWP parents black offspring. Therefore, we inferred from our observations that based on the occurrence of the SWP coat color in DSE pigs, this phenotype is likely to be under the regulation of polygenic loci. If the SWP was caused by a monogenic mutation, there should not be an occurrence of SWP parents with black offspring when SWP phenotype was inherited in a recessive mode, or alternatively, there should not be an occurrence of black parents with SWP offspring when SWP phenotype was inherited in a dominant mode. The inheritance of SWP phenotype is consistent with the multifactorial inheritance model of discrete traits proposed by Fisher26. However, we failed to identify an exact model for this phenotype inheritance. The higher proportion of black individuals observed as compared to the SWP individuals from a cross between black and SWP DSE pigs indicates a recessive mode of SWP inheritance at most of the associated loci. The association of the SWP phenotype with multiple loci is an indication of a complicated regulatory mechanism. Complete co-segregation of SWP with any mutation from a single locus in the DSE pigs could not be found, instead, many loci showed moderate levels of allele frequency differences in the SWP and black DSE populations. This suggests that different loci have varying contributions to the formation of the SWP phenotype. Furthermore, an increased fraction of the phenotypic variance can be explained by the combination of multiple loci compared to any individual locus. This is in sharp contrast to the black coat color that is likely under the regulation of missense mutations in the single MC1R gene in East Asian domestic pigs and wild boars415. Our results support a role of EDNRB in the regulation of the SWP phenotype. EDNRB encodes a G-protein-coupled heptahelical receptor, for the ligand endothelin-3 (EDN3), which is an important signaling pathway for establishing melanocyte development18. Mutations in EDNRB have been widely reported to affect the pigmentation in a variety of organisms, including mice272829, horse3031, zebrafish32, and human33. It is interesting to observe the strong association of the EDNRB gene with the SWP phenotype in DSE pigs, as variation in EDNRB is also associated with the two-end-black pigmentation pattern seen in many different Chinese indigenous pig breeds34. In contrast, we found that the SWP phenotype is probably regulated by mutations in the upstream regulatory sequences of the EDNRB gene. The abundance of regulatory sequences inside and surrounding the EDNRB genes may partially explain the reason for the involvement of this locus in the regulation of several different coat color phenotypes. We infer that mutations in these putative EDNRB regulatory sequences might have altered tempospatial gene expression of downstream target genes. Consistently, EDNRB shows a temporal expression pattern18 and regulatory sequence variation results in altered pigmentation35. The observed association of the PINK1 locus with SWP implies a role of melanocyte death in SWP regulation. PINK1 is widely accepted as a predisposition gene for early onset Parkinson disease3637. Germline deletion of PINK1 in mice significantly impaired the mitochondrial function38. RNA interference-induced PINK1 deficiency causes mitochondrial accumulation of calcium, impaired mitochondrial respiration, and ultimately cell death39. The early onset of Parkinson disease may be caused by PINK1-mediated selective death of nerve cells. We propose that the SWP phenotype in some DSE individuals is attributed to PINK1-mediated selective death of melanocytes. This speculation is supported by our observation that, in some SWP DSE pigs, the area of white coat on four legs can increase, but never decrease, as a SWP DSE pig ages (data not shown), a phenomenon that can be explained by an irreversible melanocyte death process. Besides these well-known loci, our study identified several new candidate genes for further study of coat color phenotypic variation in pigs, although the underlying mechanism is not well understood. The putative role of these genes should be tested with functional experiments. This study provided us an opportunity to detect genetic loci associated with the SWP phenotype in DSE pigs and enrich our understanding on pigmentation regulation in domestic pigs. The results expanded our knowledge on coat color regulation, and provided additional insight on the well-addressed monogenic pigmentation regulation mechanisms and should have further implications on the conservation of the DSE pig.

Methods

All methods were performed in accordance with the guidelines approved by the Kunming Institute of Zoology, Chinese Academy of Sciences. All experimental protocols were approved by the Kunming Institute of Zoology, Chinese Academy of Sciences.

Sample and phenotype information collection

Samples and their phenotypes were collected from a purebred DSE pig population from our farm in Xishuangbanna, Yunnan Province, China. We collected DSE pig samples at day 1 after birth with a record of their coat color. All collected individuals were denoted as either black or SWP, irrespective of the moderate level of variations regarding the area, presence/absence of the white spots in some points in the SWP individuals. The occurrence of the SWP coat color was counted from 1,977 DSE pigs and 415 DSE pigs (186 SWP and 229 black) were used in this study.

Whole genome resequencing

17 SWP and 14 black DSE pigs were included in the whole genome resequencing. Genomic DNA was extracted using the phenol-chloroform method and precipitated by 75% alcohol. Genomic DNA resequencing libraries were constructed with an insert size of 500-bp, following the Illumina library protocols. 100-bp paired-end reads were generated from the resequencing libraries with a Hiseq2000 instrument (Illumina Inc.). 8 SWP samples were sequenced to a coverage depth of about 7× and the other samples to about 3×.

Variant calling and SNP annotation

The genomic reads were aligned to the pig reference genome (Sus Scrofa 10.2)16 with the BWA program40. Alignment outputs (BAM files) were sorted and PCR duplicates generated during genomic library construction were removed using SAMtools41. Genomic variants were called using the GATK42. SNPs were annotated with the GTF file downloaded from the Ensembl website. In the annotation, a SNP was classified into protein coding (synonymous or nonsynonymous), untranslated region, intron, or intergenic according to their genomic position in the protein coding genes. To further annotate the SNPs in putative regulatory sequences, we downloaded human data from the Encyclopedia of DNA elements (ENCODE)43 project and identified putative regulatory sequences in the pig genome that are orthologous to the human counterpart with an ENCODE annotation (manuscript in preparation). Conserved noncoding sequences were identified from a 100-way whole genome alignment from 100 vertebrates that was downloaded from the UCSC genome browser (URL: http://genome.ucsc.edu). SNPs were analyzed according to their locations in the putative regulatory sequences and conserved noncoding sequences.

Identification of putative loci underlying SWP regulation

Genetic differentiation (FST) between SWP and black DSE pigs was calculated using VCFtools44, with 10-kb non-overlapping sliding windows for the autosomes. Genes in the sliding windows with FST above the chromosomal top 1% threshold were used as candidates for the SWP phenotype. Haplotypes were inferred using Beagle software45. XP-EHH was calculated to examine haplotypes that showed low levels of linkage decay in the SWP DSE pigs464748. To examine inheritance from a common ancestor, identity-by-descendent (IBD) segments between any two individuals were identified using the GERMLINE program49, and the clustering of IBD segments was calculated using the DASH program50. The association between IBD clusters and the SWP phenotype was calculated using the PLINK software51.

Genotyping and association analysis

To further analyze the association of candidate loci with the SWP phenotypes in a large DSE population, the genotypes of 18 tagged SNPs was established from a total of 384 DSE pigs (215 black and 169 SWP) using the Sequenom MassArray platform (Agena Bioscience). The derived allele was deduced as alternative allele to that in the pig reference genome. The 18 SNPs were chosen as tags for 18 loci that were putatively associated with the SWP phenotypes. SNPs and primers are shown in Table 2. Associations were calculated with the PLINK software51. The fraction of phenotypic variance explained by each locus was calculated as the R2 value in a least-squares linear regression analysis with a model
Table 2

Primer information for 18 candidate SNPs used in the genotyping of DSE pigs.

CHRPOSITIONForward PCR PrimerReverse PCR PrimerSite-specific extension primer
chr13140,229,419ACGTTGGATGGGAGAACTTCATGGATCCTGACGTTGGATGGCCTACACTTAAAGATATTCTACTATTATAGATATAACCTGCCATTTT
chr1511,815,900ACGTTGGATGGATATAGACTCTGACCAACCACGTTGGATGGCAAATCTCTTCTTAACAGCCCTCTTCTTAACAGTTTTAATTAGG
chr1592,243,930ACGTTGGATGGGTGAGCTGCATTGTAAGAGACGTTGGATGCTAGTGTGATCAGCATGTCGCAGTGCAATATTCAAAAGTC
chr673,118,955ACGTTGGATGGGAATGATCTCTGGGCCTCACGTTGGATGTATGAGGCCACCATGCCTGTAGCACCAGGCTTCTT
chr1229,151,265ACGTTGGATGGCATCACATGTATTAATAGACGTTGGATGCAGCTCTTGATACTGAGAACGAGAACATTTACCATATATCTTTTAT
chr440,901,362ACGTTGGATGCTTGAGACATGGCAACAGAGACGTTGGATGAGGTAGAAAGACAGAGCCAGTCCAACAAACACCTTTTT
chr439,532,637ACGTTGGATGTCAGTAGTCAAAAGAAGCCGACGTTGGATGGTCTGTCTTTTGATGCTATCCGCTATCCATATTTTAATATCTGC
chr1470,198,568ACGTTGGATGGTCACTTGACAGAGTTTCACACGTTGGATGGATAGGGCTGTATTCCAAACAATGCTGTCATACTATATGATGTAA
chr553,130,878ACGTTGGATGGTATGTCCTCTGTCCTCTTCACGTTGGATGCATCATGTTACGCTCCACAGGGCTCCACAGAATAGTGTTTAATAAG
chr754,807,944ACGTTGGATGTGTTGTGGGACTTAGAGGTGACGTTGGATGCATAGAAACAAAACCTAGTGGGAACAAAACCTAGTGTAGTCAA
chr853,930,374ACGTTGGATGGCGAATCAACATAAAAAAGGACGTTGGATGTCCCAAAGGTGATAGAAAAGATGTAGAAAGATTTATAGGGC
chr1234,761,833ACGTTGGATGTGCCTGTCTCAGAAAGCATCACGTTGGATGCAGAGAAGTGTCGGAACATCCGGAACATCTTTGTAATGA
chr13193,328,223ACGTTGGATGGTGCCCAACAAAAGGCTATCACGTTGGATGTGAACTTCAAGTTTTTCCCCTTTTTTCCCATTTTTAGAACATAC
chr13213,659,304ACGTTGGATGCAGCGTACTGATTTCCCTTCACGTTGGATGTCACGTTCCTTCCCCTACAGTCCCGTGACTGTTGCACAC
chr581,642,632ACGTTGGATGCATCGGATACACGTATCTTAACGTTGGATGCTTGGAATCCATTCTCCTGCGGACTCCATTCTCCTGCTTGTCTA
chr1171,412,807ACGTTGGATGGACTGTTAGTATAGATTTCAGACGTTGGATGAAACCACTGCTGGTTGTTGCCCGATTTCCCACAGCAATAA
chr1154,762,085ACGTTGGATGCAGACCCTTTTGTGAAAGGCACGTTGGATGATTTCCAACACCTGCAAGCCAAGCCAATAATCTGATTTTTCC
chr1181,925,800ACGTTGGATGGAGAATAACATGAATGTTGGCACGTTGGATGACAACACCGAAATGAACCAGCCAGAAAACTGAAAGGG
where Y is the coat color phenotype, G is the fixed effects of genotyped SNPs, and e is residual error.

Additional Information

How to cite this article: Lü, M.-D. et al. Genetic variations associated with six-white-point coat pigmentation in Diannan small-ear pigs. Sci. Rep. 6, 27534; doi: 10.1038/srep27534 (2016).
  48 in total

Review 1.  Domestic-animal genomics: deciphering the genetics of complex traits.

Authors:  Leif Andersson; Michel Georges
Journal:  Nat Rev Genet       Date:  2004-03       Impact factor: 53.242

2.  Artificial selection of the melanocortin receptor 1 gene in Chinese domestic pigs during domestication.

Authors:  J Li; H Yang; J-r Li; H-p Li; T Ning; X-R Pan; P Shi; Y-P Zhang
Journal:  Heredity (Edinb)       Date:  2010-02-24       Impact factor: 3.821

3.  A 6-bp deletion in the TYRP1 gene causes the brown colouration phenotype in Chinese indigenous pigs.

Authors:  J Ren; H Mao; Z Zhang; S Xiao; N Ding; L Huang
Journal:  Heredity (Edinb)       Date:  2010-10-27       Impact factor: 3.821

4.  DASH: a method for identical-by-descent haplotype mapping uncovers association with recent variation.

Authors:  Alexander Gusev; Eimear E Kenny; Jennifer K Lowe; Jaqueline Salit; Richa Saxena; Sekar Kathiresan; David M Altshuler; Jeffrey M Friedman; Jan L Breslow; Itsik Pe'er
Journal:  Am J Hum Genet       Date:  2011-05-27       Impact factor: 11.025

5.  Worldwide phylogeography of wild boar reveals multiple centers of pig domestication.

Authors:  Greger Larson; Keith Dobney; Umberto Albarella; Meiying Fang; Elizabeth Matisoo-Smith; Judith Robins; Stewart Lowden; Heather Finlayson; Tina Brand; Eske Willerslev; Peter Rowley-Conwy; Leif Andersson; Alan Cooper
Journal:  Science       Date:  2005-03-11       Impact factor: 47.728

6.  PINK1 controls mitochondrial localization of Parkin through direct phosphorylation.

Authors:  Yongsung Kim; Jeehye Park; Sunhong Kim; Saera Song; Seok-Kyu Kwon; Sang-Hee Lee; Tohru Kitada; Jin-Man Kim; Jongkyeong Chung
Journal:  Biochem Biophys Res Commun       Date:  2008-10-26       Impact factor: 3.575

7.  A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family.

Authors:  S Akira; H Isshiki; T Sugita; O Tanabe; S Kinoshita; Y Nishio; T Nakajima; T Hirano; T Kishimoto
Journal:  EMBO J       Date:  1990-06       Impact factor: 11.598

8.  The genetics of human adaptation: hard sweeps, soft sweeps, and polygenic adaptation.

Authors:  Jonathan K Pritchard; Joseph K Pickrell; Graham Coop
Journal:  Curr Biol       Date:  2010-02-23       Impact factor: 10.834

9.  Analyses of pig genomes provide insight into porcine demography and evolution.

Authors:  Martien A M Groenen; Alan L Archibald; Hirohide Uenishi; Christopher K Tuggle; Yasuhiro Takeuchi; Max F Rothschild; Claire Rogel-Gaillard; Chankyu Park; Denis Milan; Hendrik-Jan Megens; Shengting Li; Denis M Larkin; Heebal Kim; Laurent A F Frantz; Mario Caccamo; Hyeonju Ahn; Bronwen L Aken; Anna Anselmo; Christian Anthon; Loretta Auvil; Bouabid Badaoui; Craig W Beattie; Christian Bendixen; Daniel Berman; Frank Blecha; Jonas Blomberg; Lars Bolund; Mirte Bosse; Sara Botti; Zhan Bujie; Megan Bystrom; Boris Capitanu; Denise Carvalho-Silva; Patrick Chardon; Celine Chen; Ryan Cheng; Sang-Haeng Choi; William Chow; Richard C Clark; Christopher Clee; Richard P M A Crooijmans; Harry D Dawson; Patrice Dehais; Fioravante De Sapio; Bert Dibbits; Nizar Drou; Zhi-Qiang Du; Kellye Eversole; João Fadista; Susan Fairley; Thomas Faraut; Geoffrey J Faulkner; Katie E Fowler; Merete Fredholm; Eric Fritz; James G R Gilbert; Elisabetta Giuffra; Jan Gorodkin; Darren K Griffin; Jennifer L Harrow; Alexander Hayward; Kerstin Howe; Zhi-Liang Hu; Sean J Humphray; Toby Hunt; Henrik Hornshøj; Jin-Tae Jeon; Patric Jern; Matthew Jones; Jerzy Jurka; Hiroyuki Kanamori; Ronan Kapetanovic; Jaebum Kim; Jae-Hwan Kim; Kyu-Won Kim; Tae-Hun Kim; Greger Larson; Kyooyeol Lee; Kyung-Tai Lee; Richard Leggett; Harris A Lewin; Yingrui Li; Wansheng Liu; Jane E Loveland; Yao Lu; Joan K Lunney; Jian Ma; Ole Madsen; Katherine Mann; Lucy Matthews; Stuart McLaren; Takeya Morozumi; Michael P Murtaugh; Jitendra Narayan; Dinh Truong Nguyen; Peixiang Ni; Song-Jung Oh; Suneel Onteru; Frank Panitz; Eung-Woo Park; Hong-Seog Park; Geraldine Pascal; Yogesh Paudel; Miguel Perez-Enciso; Ricardo Ramirez-Gonzalez; James M Reecy; Sandra Rodriguez-Zas; Gary A Rohrer; Lauretta Rund; Yongming Sang; Kyle Schachtschneider; Joshua G Schraiber; John Schwartz; Linda Scobie; Carol Scott; Stephen Searle; Bertrand Servin; Bruce R Southey; Goran Sperber; Peter Stadler; Jonathan V Sweedler; Hakim Tafer; Bo Thomsen; Rashmi Wali; Jian Wang; Jun Wang; Simon White; Xun Xu; Martine Yerle; Guojie Zhang; Jianguo Zhang; Jie Zhang; Shuhong Zhao; Jane Rogers; Carol Churcher; Lawrence B Schook
Journal:  Nature       Date:  2012-11-15       Impact factor: 49.962

10.  Evolution of conserved secondary structures and their function in transcriptional regulation networks.

Authors:  Hai-Bing Xie; David M Irwin; Ya-Ping Zhang
Journal:  BMC Genomics       Date:  2008-11-02       Impact factor: 3.969

View more
  5 in total

1.  First study on phenotypic and morphological characteristics of Malaysian Kedah-Kelantan cattle (Bos indicus) and method of estimating their body weight.

Authors:  Mohammed Sirajul Islam; Nurhusien Yimer; Abd Wahid Haron; Faez Firdaus Jesse Abdullah; Mark Hiew Wen Han; Kamalludin Mamat-Hamidi; Hafizah Binti Mohamad Zawawi
Journal:  Vet World       Date:  2022-03-26

2.  Genetic diversity and population structure of six autochthonous pig breeds from Croatia, Serbia, and Slovenia.

Authors:  Minja Zorc; Dubravko Škorput; Kristina Gvozdanović; Polona Margeta; Danijel Karolyi; Zoran Luković; Krešimir Salajpal; Radomir Savić; Maria Muñoz; Samuele Bovo; Ivona Djurkin Kušec; Čedomir Radović; Goran Kušec; Marjeta Čandek Potokar; Peter Dovč
Journal:  Genet Sel Evol       Date:  2022-04-28       Impact factor: 5.100

3.  Identifying Candidate Genes for Short Gestation Length Trait in Chinese Qingping Pigs by Whole-Genome Resequencing and RNA Sequencing.

Authors:  Zezhang Liu; Jun Yang; Hong Li; Zhuxia Zhong; Jian Huang; Jie Fu; Hucheng Zhao; Xiaolei Liu; Siwen Jiang
Journal:  Front Genet       Date:  2022-05-16       Impact factor: 4.772

4.  Comparative Transcriptome Analysis of Mink (Neovison vison) Skin Reveals the Key Genes Involved in the Melanogenesis of Black and White Coat Colour.

Authors:  Xingchao Song; Chao Xu; Zongyue Liu; Zhigang Yue; Linling Liu; Tongao Yang; Bo Cong; Fuhe Yang
Journal:  Sci Rep       Date:  2017-09-29       Impact factor: 4.379

5.  Whole genome resequencing reveals an association of ABCC4 variants with preaxial polydactyly in pigs.

Authors:  Cheng Ma; Saber Khederzadeh; Adeniyi C Adeola; Xu-Man Han; Hai-Bing Xie; Ya-Ping Zhang
Journal:  BMC Genomics       Date:  2020-03-30       Impact factor: 3.969

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.