| Literature DB >> 27251040 |
Jaspreet Jain1, Kalika Mathur1, Jatin Shrinet1, Raj K Bhatnagar1, Sujatha Sunil2.
Abstract
BACKGROUND: RNA viruses are characterized by high rate of mutations mainly due to the lack of proofreading repair activities associated with its RNA-dependent RNA-polymerase (RdRp). In case of arboviruses, this phenomenon has lead to the existence of mixed population of genomic variants within the host called quasi-species. The stability of strains within the quasi-species lies on mutations that are positively selected which in turn depend on whether these mutations are beneficial in either or both hosts. Coevolution of amino acids (aa) is one phenomenon that leads to establishment of favorable traits in viruses and leading to their fitness.Entities:
Keywords: Chikungunya virus; Coevolution; Eukaryotic linear motifs; Nonstructural proteins
Mesh:
Substances:
Year: 2016 PMID: 27251040 PMCID: PMC4890524 DOI: 10.1186/s12985-016-0543-1
Source DB: PubMed Journal: Virol J ISSN: 1743-422X Impact factor: 4.099
Details of chikungunya samples used in the study
| CHIKV ID | Year of sample collection | IgM status | RT-PCR |
|---|---|---|---|
| IND-10-DEL1 | 2010 | Negative | Positive |
| IND-10-DEL2 | 2010 | Negative | Positive |
| IND-10-DEL3 | 2010 | Negative | Positive |
| IND-10-DEL4 | 2010 | Negative | Positive |
| IND-10-DEL5 | 2010 | Negative | Positive |
| IND-10-DEL6 | 2010 | Negative | Positive |
| IND-10-DEL8 | 2010 | Positive | Positive |
| IND-10-DEL9 | 2010 | Negative | Positive |
| IND-10-DEL10 | 2010 | Negative | Positive |
| IND-10-DEL11 | 2010 | Positive | Positive |
| IND-10-DEL12 | 2010 | Negative | Positive |
| IND-11-DEL01 | 2011 | Negative | Positive |
| IND-12-DEL02 | 2012 | Negative | Positive |
| IND-12-DEL15 | 2012 | Not Done | Positive |
Primers used for gene amplification
| Primer name | Sequence |
|---|---|
| nsP1 FP | GTAATGGATCCTGTGTACGTGG |
| nsP1 RP | TGCACCCGCTCTGTCCT |
| nsP2 FP | GTAATGGGAATAATAGAGACTCCGAGA |
| nsP2 RP | TCCTGCTCGGGTGGCCTG |
| nsP3 FP | GTAATGGGATGTGCACCGTCGTACCGG |
| nsP3 RP | TTACTCGTCGTCCGTGTCTG |
| nsP4 FP | GTAATGGGACGACTAGACAGGGCAGGTG |
| nsP4 RP | AGGACCGCCGTACAAAGTTA |
| E1 FP | GTAATGGCGTACGAACACGTAACAG |
| E1 RP | TTAGTGCCTGCTGAACGACAC |
| E2 FP | GTAATGGGAAGCACCAAGGACAACTTCAAT |
| E2 RP | TTTAGCTGTTCTGATGCAGC |
| E3 FP | GTAATGGGATGGAGTCTTGCCATCCCAGT |
| E3 RP | GCGTCGCTGGCGGTGG |
| Capsid FP | GTAATGGAGTTCATCCCAACCC |
| Capsid RP | CTCTTCGGCTCCCTCAG |
| 6K FP | GTAATGGCGGCCACATACCAAGAG |
| 6K RP | GCTCACAGTGTGGGCAC |
Amino acid variations in Delhi samples in comparison with ESCA lineage and other Indian samples
| a: Amino acid variations of Delhi samples in nsP1 | ||||||||||||
| Name of protein | Sample Site | 128 | 253 | 314 | 376 | 488 | ||||||
| CHIKV nsp1 | S27- African Prototype | T | K | M | T | Q | ||||||
| Andhra Pradesh | K | K | L/M | M | R | |||||||
| ( | ||||||||||||
| Gujarat | K | K | L/M | M | R | |||||||
| ( | ||||||||||||
| Karnataka | K | K | L | M | R | |||||||
| ( | ||||||||||||
| Kerala | K | K | L/M | M | R | |||||||
| ( | ||||||||||||
| Rajasthan | K | K | M | M | R | |||||||
| ( | ||||||||||||
| Tamil Nadu | K | K | M | M | R | |||||||
| ( | ||||||||||||
| West Bengal | T | T | M | T | Q | |||||||
| ( | ||||||||||||
| Maharashtra | T/K | T/K | M | M | R | |||||||
| ( | ||||||||||||
| Delhi | K | K | M | M | R | |||||||
| ( | ||||||||||||
| b: Amino acid variations of Delhi samples in nsP2 | ||||||||||||
| Name of protein | Sample Site | 48 | 54 | 181 | 237 | 238 | 329 | 374 | 411 | 539 | 708 | 793 |
| CHIKV nsp2 | S27- African Prototype | V | N | V | L | L | K | H | N | L | L | A |
| Andhra Pradesh | V | N | V | L | L | K | Y | N | L | L | V | |
| ( | ||||||||||||
| Gujarat | V | N | V | L | L | K | Y | N | L | L | V | |
| ( | ||||||||||||
| Karnataka | V | N | V/A | L | L | K | Y | N | L | L | V | |
| ( | ||||||||||||
| Kerala | A/V | N | V | R/L | P/L | E/K | Y | D/N | L/S | P/L | V | |
| ( | ||||||||||||
| Rajasthan | V | N | V | L | L | K | Y | N | L | L | V | |
| ( | ||||||||||||
| Tamil Nadu | V | N | V | L | L | K | Y | N | L | L | V | |
| ( | ||||||||||||
| West Bengal | V | S | V | L | L | K | H | N | L | L | A | |
| ( | ||||||||||||
| Maharashtra | V | S/N | V | L | L | K | H/Y | N | L | L | V/A | |
| ( | ||||||||||||
| Delhi | V | N | V | L | L | K | Y | N | L | L | V | |
| ( | ||||||||||||
| c: Amino acid variations of Delhi samples in nsP3 | ||||||||||||
| Name of protein | Sample Site | 175 | 217 | 341 | 353 | 501 | ||||||
| CHIKV nsp3 | S27- African Prototype | V | Y | T | I | L | ||||||
| Andhra Pradesh | I | H | T/M | I | L | |||||||
| ( | ||||||||||||
| Gujarat | I | H | T | I | S/L | |||||||
| ( | ||||||||||||
| Karnataka | I | H | T | I | S/L | |||||||
| ( | ||||||||||||
| Kerala | I | H | T | I | L | |||||||
| ( | ||||||||||||
| Rajasthan | I | H | T | I | L | |||||||
| ( | ||||||||||||
| Tamil Nadu | I | H | M | I | L | |||||||
| ( | ||||||||||||
| West Bengal | V | Y | T | T | L | |||||||
| ( | ||||||||||||
| Maharashtra | I/V | Y/H | T | I/T | L | |||||||
| ( | ||||||||||||
| Delhi | I | H | T | I | L | |||||||
| ( | ||||||||||||
| d: Amino acid variations of Delhi samples in nsP4 | ||||||||||||
| Name of protein | Sample Site | 43 | 85 | 90 | 235 | |||||||
| CHIKV nsp4 | S27- African Prototype | A | R | S | Q | |||||||
| Andhra Pradesh | A | R | S | Q | ||||||||
| ( | ||||||||||||
| Gujarat | A | R | S | Q | ||||||||
| ( | ||||||||||||
| Karnataka | A | R | S | Q | ||||||||
| ( | ||||||||||||
| Kerala | A | R | S | Q | ||||||||
| ( | ||||||||||||
| Rajasthan | A | R | S | Q | ||||||||
| ( | ||||||||||||
| Tamil Nadu | A | R | S | Q | ||||||||
| ( | ||||||||||||
| West Bengal | L | K | A | R | ||||||||
| ( | ||||||||||||
| Maharashtra | L/A | K/R | A/S | R/Q | ||||||||
| ( | ||||||||||||
| Delhi | A | R | S | Q | ||||||||
| ( | ||||||||||||
Fig. 1Phylogenetic analysis of nsPs. Total 209 nsP sequences (14 of CHIKV Delhi samples and 195 available in public domain) were aligned using MEGA 6.0 software to construct phylogenetic tree based on Neighbor-joining algorithm and Poisson distribution distance model. Bootstrap values were kept 1500 to ensure reliability. a Phylogenetic analysis of the Delhi sequences was done and its placement in CHIKV genotype group was determined. b Inset of ECSA clade. All samples used for the study belonged to the ECSA clade. : represent samples from Delhi region and : represents S27- African Prototype used as control for the study
Tajima’s neutrality test
| M (number of sequences) | S (Number of segregating sites | ps (ps = S/n) | Θ (Θ = ps/a1) | Π (nucleotide diversity) | D (Tajima test statistics) |
|---|---|---|---|---|---|
| 196 | 112 | 0.111888 | 0.019656 | 0.011574 | -1.29759 |
Fig. 2Coevolution analysis of nsPs. a-d MSA of all CHIKV nsP sequences (total 209) were analyzed using CAPS software to study coevolving aa within individual nsPs. Mutated aa pairs with correlation value above 0.5 were used for construction of network using Cytoscape software. Edge color varies with correlation value: red (1.0), orange (~0.9), purple (~0.8), light green (~0.7), black (~0.6) and dark green (~0.5). Node names include aa residue positions in individual nsP (as well as in polyprotein)
Fig. 3Coevolution analysis of non-structural polyprotein. Complete polyprotein was analyzed for inter-molecular coevolving aa residues using CAPS software and network was generated similarly using Cytoscape software. Edge color varies with correlation value: red (1.0), orange (~0.9), purple (~0.8), light green (~0.7), black (~0.6) and dark green (~0.5) and individual nsPs have been differently colored (nsP1: blue, nsP2: red, nsP3: pink, nsP4: green)
The tables show the predicted ELMs for the coevolving residues along with the coevolving positions of amino acid residue of non-structural proteins of Chikungunya virus. The coevolving amino acid residues are written in the bracket “()”
| a: ELMs for coevolving residues in nsP1 where, | |
| Position (residue) | ELMsa |
| 3(S) | LIG_WD40_WDR5_VDV_1, LIG_LIR_Gen_1, DEG_Nend_UBRbox_2 |
| 75(D) | DRK,CLV_NRD_NRD_1 |
| 172(V) | DOC_MAPK_1 |
| 176(V) | DOC_MAPK_1 |
| 291(M) | MOD_ProDKin_1, MOD_PKA_1, MOD_PKA_1, DOC_WW_Pin1_4 |
| 383(L) | LIG_SH2_STAT5 |
| 409(V) | DOC_CYCLIN_1 |
| 453(G) | MOD_GSK3_1 |
| 472(R) | TRG_LysEnd_APsAcLL_1,DOC_CYCLIN_1, CLV_PCSK_SKI1_1 |
| 485(N) | MOD_GlcNHglycan |
| 486(A) | MOD_GlcNHglycan |
| 506(H) | DEG_APCC_DBOX_1 |
| 517(E) | LIG_TRAF2_1 |
| b: ELMs for coevolving residues in nsP2 | |
| Position (residue) | Motifsb |
| 16(L) | MOD_GSK3_1,LIG_FHA_1 |
| 170(K) | LIG_SH3_1,LIG_SH3_3 |
| 273(L) | DOC_MAPK_1 |
| 338(M) | LIG_SUMO_SIM_par_1 |
| 463(S) | MOD_GSK3_1 |
| 510(K) | MOD_ProDKin_1,LIG_14-3-3_3,DOC_WW_Pin1_4 |
| 54(S) | LIG_Integrin_isoDGR_1 |
| 642(Y) | MOD_NEK2_1,MOD_GlcNHglycan |
| 683(V) | LIG_LIR_LC3C_4,LIG_SUMO_SIM_anti_2 |
| 69(V) | TRG_LysEnd_APsAcLL_1,LIG_SH3_3,LIG_eIF4E_1 |
| 768(S) | MOD_NEK2_1 |
| c: ELMs for coevolving residues in nsP3 | |
| Position (residue) | Motifsc |
| 122(T) | LIG_14-3-3_2,MOD_NEK2_1,MOD_PKA_2 |
| 132(M) | CLV_C14_Caspase3-7,MOD_GSK3_1 |
| 327(S) | LIG_TRAF2_1,MOD_CK1_1,MOD_CK2_1,MOD_GSK3_1,MOD_PKA_2 |
| 330(S) | MOD_GlcNHglycan,LIG_TRAF2_1,MOD_CK1_1,MOD_CK2_1,MOD_GSK3_1,MOD_PKA_2 |
| 332(Q) | MOD_GlcNHglycan,LIG_TRAF2_1,MOD_CK1_1,MOD_CK2_1,MOD_GSK3_1 |
| 349(V) | MOD_PLK |
| 361(D) | CLV_C14_Caspase3-7 |
| 377(H) | MOD_GSK3_1 |
| 378(T) | MOD_GSK3_1 |
| 381(S) | MOD_GSK3_1 |
| 395(S) | LIG_SH3_3 |
| 397(V) | LIG_SH3_3 |
| 408(R) | CLV_PCSK_SKI1_1,MOD_N-GLC_1,DOC_CYCLIN_1,DOC_MAPK_1,MOD_PKB_1,TRG_ER_diArg_1 |
| 411(T) | CLV_PCSK_SKI1_1,MOD_N-GLC_1,DOC_CYCLIN_1,DOC_MAPK_1,MOD_CK2_1,MOD_PKB_1 |
| 434(L) | DEG_APCC_DBOX_1 |
| 436(P) | DEG_APCC_DBOX_1 |
| 437(A) | DEG_APCC_DBOX_1 |
| 452(Q) | DOC_PP2B_LxvP_1 |
| 455(P) | MOD_CK2_1 |
| 462(N) | LIG_SH3_3,MOD_CK1_1 |
| 463(H) | LIG_SH3_3 |
| 464(P) | LIG_EVH1_2,LIG_SH3_3,MOD_GSK3_1 |
| 466(I) | LIG_EVH1_2,MOD_GSK3_1 |
| d: ELMs for coevolving residues in nsP4 | |
| Position (residue) | Motifsd |
| 113(V) | MOD_CK2_1,MOD_GSK3_1,MOD_PKA_2 |
| 137(S) | DOC_USP7_1,MOD_GSK3_1 |
| 15(K) | DOC_MAPK_1,MOD_GSK3_1,MOD_PKA_2 |
| 182(S) | LIG_14-3-3_3,MOD_CK1_1,MOD_GSK3_1 |
| 20(S) | DOC_MAPK_1,MOD_GSK3_1,MOD_PKA_2 |
| 512(H) | MOD_GSK3_1,MOD_NEK2_1 |
| 571(Y) | MOD_CK2_1 |
| 582(A) | LIG_SUMO_SIM_anti_2 |
| 603(V) | DOC_MAPK_1,MOD_NEK2_2 |
| 77(I) | LIG_Actin_WH2_2 |
| 79(R) | CLV_PCSK_FUR_1,DOC_MAPK_1,LIG_Actin_WH2_2 |
| 81(K) | CLV_PCSK_FUR_1,CLV_PCSK_PC1ET2_1,DOC_MAPK_1,LIG_Actin_WH2_2 |
| 90(A) | LIG_FHA_1,LIG_SH2_STAT5,LIG_SH3_3,MOD_ProDKin_1,DOC_WW_Pin1_4 |
a LIG_WD40_WDR5_VDV_1 WDR5 WD40 repeat (blade 5,6)-binding ligand, LIG_LIR_Gen_1 Atg8 protein family ligands, DEG_Nend_UBRbox_2 N-degron, CLV_NRD_NRD_1 NRD cleavage site, DOC_MAPK_1 MAPK docking motifs, MOD_ProDKin_1 MAPK Phosphorylation Site, MOD_PKA_1 PKA Phosphorylation site, DOC_WW_Pin1_4 WW domain ligands, LIG_SH2_STAT5 SH2 ligand, DOC_CYCLIN_1 Cyclin recognition site, MOD_GSK3_1 GSK3 phosphorylation site, TRG_LysEnd_APsAcLL_1 Endosome-Lysosome-Basolateral sorting signals, CLV_PCSK_SKI1_1 PCSK cleavage site, MOD_GlcNHglycan Glycosaminoglycan attachment site, DEG_APCC_DBOX_1 APCC-binding Destruction motifs, LIG_TRAF2_1 TRAF2 binding site
b MOD_GSK3_1 GSK3 phosphorylation site, LIG_FHA_1 FHA phosphopeptide ligands, LIG_SH3_1 SH3 ligand, LIG_SH3_3 SH3 ligand, DOC_MAPK_1 MAPK docking motifs, LIG_SUMO_SIM_par_1 SUMO interaction site, MOD_ProDKin_1 MAPK Phosphorylation Site, LIG_14-3-3_3 14-3-3 ligand, DOC_WW_Pin1_4 WW domain ligands, LIG_Integrin_isoDGR_1 Integrin binding sites, MOD_NEK2_1 NEK2 phosphorylation site, MOD_GlcNHglycan Glycosaminoglycan attachment site, LIG_LIR_LC3C_4 Atg8 protein family ligands, LIG_SUMO_SIM_anti_2 SUMO interaction site, TRG_LysEnd_APsAcLL_1 Endosome-Lysosome-Basolateral sorting signals, LIG_eIF4E_1 eIF4E binding motif
c LIG_14-3-3_2 14-3-3 ligand, MOD_NEK2_1 NEK2 phosphorylation site, MOD_PKA_2 PKA Phosphorylation site, MOD_GSK3_1 GSK3 phosphorylation site, LIG_TRAF2_1 TRAF2 binding site, MOD_CK1_1 CK1 Phosphorylation site, MOD_PLK Plk phosphorylation site, LIG_SH3_3 SH3 ligand, MOD_N-GLC_1 N-glycosylation site, DOC_CYCLIN_1 Cyclin recognition site, MOD_PKB_1 PKB Phosphorylation site, TRG_ER_diArg_1 di Arginine retention/retrieving signal, DOC_PP2B_LxvP_1 Calcineurin (PP2B)-docking motif LxvP, LIG_EVH1_2 EVH1 ligands
d MOD_CK2_1 CK2 Phosphorylation site, MOD_GSK3_1 GSK3 phosphorylation site, MOD_PKA_2 PKA Phosphorylation site, DOC_USP7_1 USP7 binding motif, LIG_14-3-3_3 14-3-3 ligand, MOD_CK1_1 CK1 Phosphorylation site, MOD_NEK2_1 NEK2 phosphorylation site, LIG_Actin_WH2_2 Actin-binding motifs, CLV_PCSK_FUR_1 PCSK cleavage site, LIG_FHA_1 FHA phosphopeptide ligands, LIG_SH2_STAT5 SH2 ligand, LIG_SH3_3 SH3 ligand, MOD_ProDKin_1 MAPK Phosphorylation Site, DOC_WW_Pin1_4 WW domain ligands
Fig. 4The figure represents the correlation between ELMs GO terms and coevolving pairs. The nodes are colored according to the respective protein and colored solid edges represent the correlation coefficient value. Values are also written along with the edge. Dash-lines represent the relation between coevolving pair and their respective ELM functions. The ELM names are also shown in the figure