Literature DB >> 27213124

Development and characterization of microsatellite primers for Chamaecyparis obtusa (Cupressaceae).

Young Mi Kim1, Yu Seung Shin1, Ji Hee Jeong1.   

Abstract

PREMISE OF THE STUDY: Although several microsatellite markers of Chamaecyparis obtusa (Cupressaceae) have been reported in previous studies, we newly developed and evaluated polymorphic microsatellite markers of C. obtusa, an economically important species in Korea as a major forestation tree species, for further genetic studies. METHODS AND
RESULTS: Microsatellite-enrichment libraries were constructed according to the selective hybridization method. From this output, we obtained 10 polymorphic and five monomorphic microsatellite markers for C. obtusa. Five of these developed markers were successfully amplified for C. pisifera, a related species.
CONCLUSIONS: These microsatellite markers can be valuable tools for further genetic studies of C. obtusa, and gathered genetic information may be useful for breeding program management.

Entities:  

Keywords:  Chamaecyparis obtusa; Cupressaceae; conifer; microsatellite

Year:  2016        PMID: 27213124      PMCID: PMC4873271          DOI: 10.3732/apps.1500136

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Chamaecyparis obtusa (Sieb. & Zucc.) Endl. (Cupressaceae), an economically important tree species frequently used for construction and native to Japan, was first introduced to Korea in 1904 and mainly planted in the southern provinces (Yoon, 1959). Recently, this species has received attention in Korea for its ability to adapt to ongoing climate change and to be used for outdoor recreation as a “healing forest” (An et al., 2009). Therefore, the demand for seeds of C. obtusa has increased. With this increasing demand, there has been a growing interest in breeding research on C. obtusa using molecular markers. Microsatellite markers, with codominance and high polymorphism, are preferred for molecular breeding programs because they allow high genetic resolution (Smouse and Chevillon, 1998; Bernatchez and Duchesne, 2000). Previous studies have developed microsatellite markers for C. obtusa and conducted investigations of its genetic variation and population structure. Nakao et al. (2001) and Matsumoto et al. (2006) developed nine and 15 polymorphic markers, respectively. These developed markers were employed in further genetic studies on genetic diversity and structure in a natural fragmented population of C. obtusa (Matsumoto et al., 2010). However, microsatellite markers have some shortcomings, such as genotyping error caused by null alleles, mutation, or mistyping, which can generate false exclusion or produce ghost individuals. To overcome such problems, likelihood-based approaches are preferred. The accuracy of estimates resulting from these analyses is dependent on (i.e., increased with) the number of loci (Wang, 2015). Accordingly, previously developed markers might be insufficient to employ various methodologies of genetic analysis used in molecular breeding and breeding population management. Therefore, to secure enough polymorphic loci, we developed and evaluated additional microsatellite markers for further genetic studies for C. obtusa.

METHODS AND RESULTS

A microsatellite-enrichment library was constructed on C. obtusa plants collected from seed production stands throughout South Korea. Genomic DNA was extracted from fresh leaves with a QIAamp 96 DNA QIAcube HT Kit (QIAGEN, Hilden, Germany) using QIAxtractor (QIAGEN). The library was constructed according to the method of Glenn and Schable (2005). Briefly, genomic DNA from the leaves of C. obtusa was digested with a restriction enzyme, RsaI, to obtain DNA fragments approximately ranging from 300 to 1000 bp and then ligated with a modified SNX linker incorporated with a GTTT PIG-tail. This method should facilitate that the PCR product can be cloned directly without obtaining a large proportion of small DNA fragments and have efficient A-tailing to yield good results from TA cloning. The ligation products were subjected to double enrichment steps by hybridization with 3′-biotinylated microsatellite probes. The DNA fragments containing microsatellites were ligated to pGEM-T vectors (Promega Corporation, Madison, Wisconsin, USA), and the ligation mixture was transformed into competent Escherichia coli DH5α cells. The resulting colonies were subjected to colony PCR to identify recombinant clones using M13 forward and reverse primer sets. The PCR products were purified and directly used for sequencing by the ABI 3730 DNA Analyzer (Applied Biosystems, Waltham, Massachusetts, USA). After the trimming of vector and linker sequences, the nucleotide sequences were assembled to generate nonredundant contigs using Lasergene SeqMan (ver. 7.0.0; DNASTAR, Madison, Wisconsin, USA). Putative SSRs were identified by MISA software (Thiel, 2010) with the following criteria: a minimum of three repeats for dinucleotides to hexanucleotides and a gap within 100 bp for composite class. Criteria for primer design were as follows: amplicon size of 85–350 bp and annealing temperature of 57–60°C. Twenty-one primers used in this study were synthesized by Biomedic Co. Ltd. (Bucheon, Korea; www.ibiomedic.co.kr). The primer specificity was validated by routine PCR using genomic DNA as templates. For the preliminary screening of markers to amplify putative single loci, routine genomic PCR was performed using genomic DNA from five samples of C. obtusa as templates. The PCR products were separated on a 2% agarose gel. Twenty-one candidate microsatellite primers, which amplified putative single loci, were selected to screen polymorphic markers and labeled with fluorescent dye (FAM). To validate the applicability of the 21 candidate primers to genetic studies, PCR amplifications were conducted for 90 samples from three seed production stands of C. obtusa located in Jeonbuk, Jeonnam, and Gyeongnam provinces, Korea. To test the transferability of the markers to the other related species, 12 samples of C. pisifera (Siebold & Zucc.) Endl. were collected in Chungbuk Province and used for further analysis. All the DNA samples used in this study were deposited at the Gene Bank of the National Forest Seed and Variety Center (NFSV, Korea); accession numbers and locality information are provided in Appendix 1. PCR was performed in 11-μL reactions containing 9 ng of template DNA, 1.5 or 2.5 mM MgCl2, 200 μM of each dNTP, 0.2 μM of 6-FAM fluorescent dye–labeled forward primer and reverse primer, 0.75 units of NeoTherm Taq DNA polymerase (GeneCraft, Hulme, United Kingdom), and 1× reaction buffer (GeneCraft). The PCR cycling was conducted as follows: 5 min at 94°C for predenaturation; 34 cycles of 30 s at 94°C, 1 min at 54–62°C for each primer, and 1 min at 72°C; and a final extension for 10 min at 72°C. The fluorescent PCR products were mixed with Hi-Di formamide and GeneScan 500 ROX Size Standard (Applied Biosystems). Those were visualized and scored using an ABI 3730 Genetic Analyzer (Applied Biosystems) and GeneMapper 4.1 software (Applied Biosystems). Fifteen (71.4%) of the 21 candidate primers were successfully amplified for C. obtusa. Ten of these produced polymorphic DNA fragments, and the remaining five primers produced monomorphic amplicons (Table 1). The percentage of amplification for C. pisifera was 33.3% (5/15). Genetic properties of the 10 polymorphic primers for C. obtusa were evaluated (Table 2). The number of alleles (A), number of effective alleles (Ae), and observed (Ho) and expected heterozygosity (He) were obtained by GenAlEx version 6.41 (Peakall and Smouse, 2006), and polymorphic information content (PIC) was calculated with CERVUS version 3.0.3 (Kalinowski et al., 2007). In the total samples (90), A ranged from four to 24 per locus, Ae ranged from 1.2 to 14.2, and PIC values ranged from 0.160 to 0.927. Ho and He varied from 0.000 to 0.988 and from 0.165 to 0.929, respectively. The Co2047 marker, which had a high Ae value, could be a most efficient marker to infer current pollen flow using an indirect method such as TwoGener or a direct method such as parentage analysis, because high PIC values can be the result of relatively even allele frequency.
Table 1.

Repeat motif, primer sequence, and size range for amplified microsatellite loci in Chamaecyparis species.

Allele size range (bp)
LocusPrimer sequences (5′–3′)Repeat motifC. obtusaC. pisiferaTa (°C)GenBank accession no.
Co2011F: TAAAAATCGCAAGGCCAACT(GAA)3244238/24154KF689697
R: TCGACCCAATTTGGAGTTACTT
Co2018*F: GCCCTAGAAACTCGGGGTAA(CA)16.(CA)11240–27062KF689702
R: GTTTGGGGCAATACACAGCGTAATA
Co2023*F: CACTATCGGGATGCTTGTGA(CT)28210–31055KF689706
R: GTTTAGAGAATGGACTCGATGCAAA
Co2033F: CCATTGGGCAAGGTTTCTTA(AC)914514555KF689713
R: GATGCTTCAGATGGGACCTC
Co2043*F: GGAATTAATTACCACGCTGAAA(CT)15TTCTC(CA)6160–21060KF689719
R: CCCCAAAAGCCTATGAGACA
Co2047*F: ATGCCCAAAACACACAAACA(CT)21200–28056KF689720
R: GTTTCTTCCCTTTGTCTCTTTGTCA
Co2050*F: GCCCTCAACCTCAAACCATA(GA)31110–180224/22856KF689723
R: GTTTCACACTCCCTTATCTCCCTCA
Co3008F: GAGAATGCACCAGGCAATAAA(AG)415255KF689734
R: GTTTGATCTTCAATTCCCTCCCATA
Co3016F: GGAAAAAGTTTGGCATCGAG(ACAG)515715755KF689739
R: GTTTCTCCTTGTGCCAACACAGAA
Co3026*F: CGAAACGAAACCAATTCCTC(CTAT)19210–29060KF689746
R: GTTTACCTCCTCCCACAATTCG
Co3033*F: TGTCTCACCAATGCCAAAAG(ATAG)8220–25060KF689750
R: CCACTCCCCCTTTTCAAATC
Co3038F: TTTCTCCCTTATCCACCTTCC(TCTG)524224255KF689753
R: TTCAACTCATCACATCATCCA
Co4012*F: CTTGCATCCCTACCTTGCAT(CATC)8…(CTAC)7140–19055KF689767
R: TTCCACTTCCATGTCAACCA
Co4014*F: TTCCACTTCCATGTCAACCA(TAGG)7150–20062KF689769
R: GTTTCTTGCATCCCTACCTTGCAT
Co4049*F: TTTGTCTGTTTATCTGCCTTTCTC(TCTA)7340–39056KF689781
R: GTTTGCTCCTATTGTGATTTTGAGTG

Note: — = information not available; Ta = annealing temperature.

Polymorphic microsatellite loci.

Table 2.

Genetic properties of 10 polymorphic microsatellite loci of Chamaecyparis obtusa.

Jeonbuk (N = 30)Jeonnam (N = 45)Gyeongnam (N = 15)Total (N = 90)
LocusnAAeHoHenAAeHoHenAAeHoHenAAeHoHePIC
Co202329165.80.759*0.827421710.90.881*0.9081494.80.857*0.79185249.90.8350.8990.889
Co204330102.70.533*0.6354273.60.690*0.72015106.50.9330.84787133.80.6780.7340.704
Co204727128.11.000*0.876432012.31.000*0.91915129.20.933*0.891852214.20.9880.9290.927
Co205029149.71.000*0.89744179.20.773*0.89115107.80.867*0.871882211.30.8640.9110.904
Co30262741.80.000*0.4534151.80.000*0.4581332.60.000*0.6158152.00.0000.4960.439
Co30332621.80.3850.4534442.20.5000.5371521.80.667*0.4448542.00.4940.4970.413
Co40122441.70.5000.4164451.40.3410.3011541.60.4670.3898351.60.4100.3550.336
Co40142931.20.1720.1604331.10.1160.1111431.40.071*0.3048651.20.1280.1650.160
Co40493063.60.867*0.7224395.80.9530.8261564.80.733*0.7918895.10.8860.8020.775
Co20181864.20.5560.7612994.50.690*0.7801253.30.5830.6945994.60.6270.7810.750

Note: A = number of alleles per locus; Ae = number of effective alleles per locus; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals sampled; n = number of individuals genotyped; PIC = polymorphism information content.

Significant deviation from Hardy–Weinberg equilibrium (P < 0.05).

Repeat motif, primer sequence, and size range for amplified microsatellite loci in Chamaecyparis species. Note: — = information not available; Ta = annealing temperature. Polymorphic microsatellite loci. Genetic properties of 10 polymorphic microsatellite loci of Chamaecyparis obtusa. Note: A = number of alleles per locus; Ae = number of effective alleles per locus; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals sampled; n = number of individuals genotyped; PIC = polymorphism information content. Significant deviation from Hardy–Weinberg equilibrium (P < 0.05).

CONCLUSIONS

Ten polymorphic microsatellite markers developed for C. obtusa are available for genetic studies, such as analyses of current pollen flow, seed flow, mating system, and population genetic structure. Of these microsatellite markers developed in C. obtusa, 33.3% were successfully amplified in the related species C. pisifera. The genetic information gathered by these markers could be useful for breeding program management of C. obtusa.
Appendix 1.

Accession numbers and locality information of Chamaecyparis samples used in this study. All DNA samples are deposited at the Gene Bank of the National Forest Seed and Variety Center (NFSV), Chungju, Korea.

SpeciesAccession no.Collection localityaGeographic coordinates
Chamaecyparis obtusa (Siebold & Zucc.) Endl.0300-03-00041555Jeonbuk35°43′01.83″N, 127°13′29.72″E
0300-03-00041556Jeonbuk35°43′01.67″N, 127°13′29.56″E
0300-03-00041557Jeonbuk35°43′01.74″N, 127°13′29.91″E
0300-03-00041558Jeonbuk35°43′01.83″N, 127°13′29.87″E
0300-03-00041559Jeonbuk35°43′01.61″N, 127°13′29.67″E
0300-03-00041560Jeonbuk35°43′01.64″N, 127°13′29.48″E
0300-03-00041561Jeonbuk35°43′01.48″N, 127°13′29.04″E
0300-03-00041562Jeonbuk35°43′01.41″N, 127°13′29.32″E
0300-03-00041567Jeonbuk35°43′01.54″N, 127°13′29.75″E
0300-03-00041568Jeonbuk35°43′01.48″N, 127°13′29.75″E
0300-03-00041569Jeonbuk35°43′01.48″N, 127°13′30.03″E
0300-03-00041637Jeonbuk35°43′00.02″N, 127°13′30.51″E
0300-03-00041661Jeonbuk35°42′59.56″N, 127°13′30.31″E
0300-03-00041693Jeonbuk35°42′59.14″N, 127°13′31.26″E
0300-03-00041725Jeonbuk35°42′58.39″N, 127°13′32.17″E
0300-03-00039814Jeonbuk35°24′14.47″N, 126°43′23.35″E
0300-03-00039838Jeonbuk35°24′14.96″N, 126°43′24.42″E
0300-03-00039870Jeonbuk35°24′14.64″N, 126°43′26.56″E
0300-03-00039902Jeonbuk35°24′14.05″N, 126°43′24.58″E
0300-03-00039916Jeonbuk35°24′14.38″N, 126°43′25.84″E
0300-03-00039917Jeonbuk35°24′14.38″N, 126°43′26.24″E
0300-03-00039919Jeonbuk35°24′14.25″N, 126°43′26.04″E
0300-03-00039922Jeonbuk35°24′14.38″N, 126°43′26.76″E
0300-03-00039923Jeonbuk35°24′14.29″N, 126°43′26.88″E
0300-03-00039924Jeonbuk35°24′14.22″N, 126°43′26.68″E
0300-03-00039925Jeonbuk35°24′14.16″N, 126°43′26.84″E
0300-03-00039928Jeonbuk35°24′14.26″N, 126°43′27.23″E
0300-03-00039929Jeonbuk35°24′14.19″N, 126°43′27.11″E
0300-03-00039930Jeonbuk35°24′14.09″N, 126°43′27.15″E
0300-03-00039931Jeonbuk35°24′13.96″N, 126°43′27.03″E
0300-03-00040129Jeonnam35°21′22.27″N, 126°53′33.46″E
0300-03-00040161Jeonnam35°21′22.85″N, 126°53′31.88″E
0300-03-00040177Jeonnam35°21′23.28″N, 126°53′32.43″E
0300-03-00040185Jeonnam35°21′22.92″N, 126°53′32.87″E
0300-03-00040495Jeonnam35°21′20.72″N, 126°53′35.68″E
0300-03-00040498Jeonnam35°21′20.88″N, 126°53′35.96″E
0300-03-00040502Jeonnam35°21′20.59″N, 126°53′35.76″E
0300-03-00040505Jeonnam35°21′20.68″N, 126°53′36.00″E
0300-03-00042405Jeonnam35°00′45.27″N, 127°10′51.45″E
0300-03-00042429Jeonnam35°00′45.17″N, 127°10′52.08″E
0300-03-00042461Jeonnam35°00′45.66″N, 127°10′52.32″E
0300-03-00042485Jeonnam35°00′46.11″N, 127°10′51.03″E
0300-03-00042299Jeonnam35°00′44.72″N, 127°10′48.85″E
0300-03-00042300Jeonnam35°00′44.75″N, 127°10′48.97″E
0300-03-00042303Jeonnam35°00′44.88″N, 127°10′49.08″E
0300-03-00041744Jeonnam35°00′45.82″N, 127°10′48.18″E
0300-03-00039118Jeonnam34°45′37.04″N, 126°44′05.36″E
0300-03-00039174Jeonnam34°45′36.27″N, 126°44′07.17″E
0300-03-00039200Jeonnam34°45′37.96″N, 126°44′08.66″E
0300-03-00039201Jeonnam34°45′37.89″N, 126°44′08.81″E
0300-03-00039206Jeonnam34°45′36.56″N, 126°44′08.05″E
0300-03-00039210Jeonnam34°45′37.31″N, 126°44′08.42″E
0300-03-00039211Jeonnam34°45′37.47″N, 126°44′08.05″E
0300-03-00042486Jeonnam34°40′08.12″N, 126°56′06.41″E
0300-03-00042487Jeonnam34°40′07.99″N, 126°56′06.37″E
0300-03-00042488Jeonnam34°40′08.02″N, 126°56′06.29″E
0300-03-00042489Jeonnam34°40′08.06″N, 126°56′06.13″E
0300-03-00042501Jeonnam34°40′08.09″N, 126°56′05.43″E
0300-03-00042525Jeonnam34°40′07.54″N, 126°56′05.07″E
0300-03-00042557Jeonnam34°40′07.05″N, 126°56′05.27″E
0300-03-00042589Jeonnam34°40′06.03″N, 126°56′03.15″E
0300-03-00045093Jeonnam34°54′29.34″N, 126°49′36.74″E
0300-03-00045101Jeonnam34°54′30.38″N, 126°49′37.96″E
0300-03-00045102Jeonnam34°54′30.12″N, 126°49′37.92″E
0300-03-00045104Jeonnam34°54′30.06″N, 126°49′38.28″E
0300-03-00045117Jeonnam34°54′29.67″N, 126°49′38.95″E
0300-03-00045149Jeonnam34°54′30.81″N, 126°49′40.09″E
0300-03-00045155Jeonnam34°54′30.61″N, 126°49′40.44″E
0300-03-00045157Jeonnam34°54′30.52″N, 126°49′40.76″E
0300-03-00045163Jeonnam34°54′29.64″N, 126°49′39.07″E
0300-03-00045164Jeonnam34°54′29.57″N, 126°49′39.58″E
0300-03-00045170Jeonnam34°54′29.74″N, 126°49′40.96″E
0300-03-00045171Jeonnam34°54′29.74″N, 126°49′40.08″E
0300-03-00045172Jeonnam34°54′29.08″N, 126°49′41.35″E
0300-03-00045173Jeonnam34°54′29.93″N, 126°49′40.99″E
0300-03-00047493Gyeongnam34°46′58.18″N, 127°58′19.49″E
0300-03-00047517Gyeongnam34°46′57.89″N, 127°58′20.39″E
0300-03-00047549Gyeongnam34°46′57.17″N, 127°58′20.07″E
0300-03-00047581Gyeongnam34°46′57.07″N, 127°58′20.31″E
0300-03-00046437Gyeongnam34°46′59.12″N, 127°58′04.09″E
0300-03-00046438Gyeongnam34°46′59.12″N, 127°58′04.28″E
0300-03-00046439Gyeongnam34°46′58.99″N, 127°58′04.16″E
0300-03-00046440Gyeongnam34°46′58.86″N, 127°58′04.12″E
0300-03-00046441Gyeongnam34°46′58.83″N, 127°58′04.28″E
0300-03-00046442Gyeongnam34°46′58.73″N, 127°58′04.16″E
0300-03-00046443Gyeongnam34°46′58.73″N, 127°58′04.28″E
0300-03-00046444Gyeongnam34°46′58.79″N, 127°58′04.36″E
0300-03-00046445Gyeongnam34°46′58.92″N, 127°58′04.04″E
0300-03-00046446Gyeongnam34°46′58.95″N, 127°58′04.56″E
0300-03-00046447Gyeongnam34°46′58.82″N, 127°58′04.56″E
Chamaecyparis pisifera (Siebold & Zucc.) Endl.0300-03-00085617–0300-03-00085628Chungbuk36°52′37.02″N, 127°58′25.80″E

Province in Korea.

  5 in total

1.  Individual identification from genetic marker data: developments and accuracy comparisons of methods.

Authors:  Jinliang Wang
Journal:  Mol Ecol Resour       Date:  2015-08-20       Impact factor: 7.090

2.  Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment.

Authors:  Steven T Kalinowski; Mark L Taper; Tristan C Marshall
Journal:  Mol Ecol       Date:  2007-03       Impact factor: 6.185

3.  Genetic diversity and structure of natural fragmented Chamaecyparis obtusa populations as revealed by microsatellite markers.

Authors:  Asako Matsumoto; Kohji Uchida; Yuriko Taguchi; Naoki Tani; Yoshihiko Tsumura
Journal:  J Plant Res       Date:  2010-01-21       Impact factor: 2.629

4.  Analytical aspects of population-specific DNA fingerprinting for individuals.

Authors:  P E Smouse; C Chevillon
Journal:  J Hered       Date:  1998 Mar-Apr       Impact factor: 2.645

5.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.