Literature DB >> 27200271

First molecular evidence of Toxoplasma gondii in opossums (Didelphis virginiana) from Yucatan, Mexico.

M Torres-Castro1, H Noh-Pech1, R Puerto-Hernández1, B Reyes-Hernández1, A Panti-May2, S Hernández-Betancourt3, A Yeh-Gorocica1, L González-Herrera4, J Zavala-Castro1, F I Puerto1.   

Abstract

Toxoplasma gondii is an obligate intracellular parasite recognized as a causal agent of toxoplasmosis; zoonotic disease endemic in many countries worldwide, including Mexico. Different species of animals participate in the wild cycle infection, including opossums of the species Didelphis virginiana. Thirteen D. virginiana were captured in Yucatan, Mexico. Detection of T. gondii was achieved by Polymerase Chain Reaction, which determined an infection of 76.9% (10/13) in brains. Positive amplicons were sequenced for analysis, this produced results similar to T. gondii with identity and coverage values of 98% and 96-100%, respectively. This study presents the first molecular evidence of the circulation of T. gondii in D. virginiana from Mexico.

Entities:  

Keywords:  Didelphis virginiana; Mexico; Toxoplasma gondii; Yucatan

Year:  2016        PMID: 27200271      PMCID: PMC4824038          DOI: 10.4314/ovj.v6i1.8

Source DB:  PubMed          Journal:  Open Vet J        ISSN: 2218-6050


Introduction

Toxoplasmosis is a zoonotic parasitic disease with a worldwide distribution that is produced by Toxoplasma gondii. This protozoan has the capacity to infect birds and mammals, including human beings (Hernández-Cortazar et al., 2015). Their definitive hosts are individuals of the family Felidae such as domestic (Felis catus) and wild cats, that expel oocysts in their feces with sporozoites, infective stage of the parasite (Dubey et al., 2009). Approximately, 30% of the human population worldwide is chronically infected with T. gondii. This stage of the disease is characterized by the persistence of the parasite in the tissues of the affected organism, especially brain and heart. The most common sources of human infection are ingestion of tissue cysts in undercooked meat or of food or water contaminated with oocysts shed by felids and transplacental transmission (Pomares et al., 2011). Toxoplasmosis presents cycles of domestic and wild transmission. In the former, hIn the former, human beings, domestic cats and a wide variety of production animals are involved, for which reason it is well understood. This is not the case with the wild transmission, in which the synanthropic opossums participate along with numerous species of wild rodents (Dubey et al., 2009). In Mexico, human and animal toxoplasmosis has been reported in different regions; however, its rates of prevalence and incidence are higher in tropical zones where, given the prevailing environmental conditions such as high temperature and humidity, T. gondii can remain infective for long periods of time (Hernández-Cortazar et al., 2015). Opossums of the species Didelphis virginiana are widely distributed on the Yucatan Peninsula. They are abundant in domestic and peridomestic environments and act as hosts or reservoirs of infectious agents capable of causing diseases in human beings (Parada-López et al., 2013). Different studies in the region have shown that D. virginiana may act as a carrier of some zoonotic pathogens such as Salmonella entérica, Leptospira interrogans (Ruiz-Piña et al., 2002), Trypanosoma cruzi (Parada-López et al., 2013) and Rickettsia felis (Panti-May et al., 2015). However, the role of D. virginiana in the transmission cycle of T. gondii has not been established, despite the fact that the opossums can act as a source of infection by consumption of definitive hosts and even by human beings who inhabit tropical forest and rural areas (Santos-Fita et al., 2012). For this reason, the objective of this study was to determine the circulation of T. gondii in D. virginiana captured in communities in Yucatan, Mexico.

Materials and Methods

As part of a study conducted to identify pathogenic agents in synanthropic rodents; juvenile specimens of D. virginiana were captured in “Sherman” type traps (7.5 x 9 x 23, HB 83 Sherman Traps Inc., USA) that had been set in the peridomestic environment of dwellings in two rural and one urban communities of Yucatan, Mexico (Fig. 1). The animals were captured with the permission of the Ministry of Environment and Natural Resources (SEMARNAT, by its Spanish acronym) of Mexico (Registry No. SGPA/DGVS/02528/13) and following the statutes of the American Society of Mammalogists (ASM).
Fig. 1

Map of Mexico (A) showing the location of Yucatan (B) with the communities where the individuals of Didelphis virginiana were captured (black points).

Map of Mexico (A) showing the location of Yucatan (B) with the communities where the individuals of Didelphis virginiana were captured (black points). Captured individuals were transported to the Campus de Ciencias Biológicas y Agropecuarias-Universidad Autónoma de Yucaán (CCBA-UADY), where morphometric measurements were recorded. The individuals were then euthanized with pentobarbital sodium (intraperitoneal injection; 390 mg/ml; Stoskopf et al., 1999). The cranial cavities were opened using scissors and forceps sterilized. The brain was divided into two hemispheres, one of which was fragmented in two parts. One of these parts was macerated with a previously sterilized mortar and pestle, and preserved in 500 μl of RNAlater® (Thermo Fisher Scientific Inc., USA). A subsample (100 μl) was taken and processed with the solution TRIzol® Reagent (Thermo Fisher Scientific Inc., USA) for DNA extraction. Molecular detection was conducted using end-point PCR with the primers and methodology proposed by Boughattas et al. (2014). These primers amplify a fragment of 114 bp that repeats in tandem within the chromosome IX of T. gondii. All reactions included positive (total DNA of rodent brain [BALB/c] experimentally infected with T. gondii) and negative (sterile water) controls. Electrophoresis of the PCR products was conducted in 8% polyacrylamide gels dyed with silver nitrate (1.1M). In order to purify the positive amplicons, another electrophoresis was conducted in 1% agarose gels dyed with ethidium bromide. The band at 114bp was removed and purified with the Zymoclean™ Gel DNA Recovery Kit (Zymo Research Company™, USA), following the manufacturer´s instructions. Only six of the positive and purified products of PCR were sent for sequencing to the Instituto de Biotecnología-Universidad Nacional Autónoma de México (IBT-UNAM). The sequences obtained were compared using the Basic Local Alignment Search Tool (BLAST), of the National Institute of Health (NIH, USA; http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Results

A total of 13 specimens of D. virginiana were captured. Of these, 76.9% (10/13) were captured in the urban community and the other 23.1% (3/13) in the rural communities. All the captured individuals were juveniles and presented a range of weights from 69.5 to 130.9g. The PCR test produced a percentage of positivity of 76.9% (10/13). Fig. 2 shows a representative gel with positive fragments of 114bp. Similarly, Table 1 specifies the number of animals captured per community, the community type and its percentage of positivity according to the PCR test.
Fig. 2

Polyacrylamide gel 1%, showing the positive extractions: (1): Positive control; (2): Molecular weight ladder of 100 bp; (3): Empty lane; (4-8): Lanes with positive samples; (9-10): Empty lanes.

Table 1

Number of individuals captured per community and their percentage of positivity in the PCR test.

Number of individuals capturedCommunityType of communityLocationositives/total (%)
10MéridaUrban20°58´04´´N, 89°37´18´´W9/13 (69, 2)
2TixméhuacRural20°13´48´´N, 89°06´15´´N1/13 (7, 7)
1OpichénRural20°32´59´´N, 89°51´25´´W0/13 (0)
Total:1310/13 (76, 9)
Polyacrylamide gel 1%, showing the positive extractions: (1): Positive control; (2): Molecular weight ladder of 100 bp; (3): Empty lane; (4-8): Lanes with positive samples; (9-10): Empty lanes. Number of individuals captured per community and their percentage of positivity in the PCR test. The purified and sequenced of positives products were known as: SJTDV1, SJTDV2, SJTDV3, SJTDV4, SJTDV5 and TIXDV1. Unfortunately, due to the size of our amplified fragment was not possible to get an access number in the GenBank®. Table 2 shows the sequence products and the percentages values of identity and coverage for each one. In all cases, the sequences were similar to T. Gondii of the VEG strain (access number LN714499.1).
Table 2

Name and sequence of the positive products PCR and the values of percentages of identity and coverage obtained by BLAST analysis.

NameSequenceIdentity %Coverage %
SJTDV1TAGAGAGTACTAGAACGTCGCCGCTACTGC CCAGTTGTCATGCCATCGACGTAGACCCA98100
SJTDV2TAGAGAGTACTAGAACGTCGCCGCTACTGC CCAGTTGTCATGCCATCGACGTAGACCCA98100
SJTDV3CATAGAGAGTACTAGAACGTCGCCGCTACTGC CCAGTTGTCATGCCATCGACGTAGACCCA98100
SJTDV4CATAGAGAGTACTAGAACGTCGCCGCTACTGC CCAGTTGTCATGCCATCGACGTAGACCCA9898
SJTDV5CATAGAGAGTACTAGAACGTCGCCGCTACTGC CCAGTTGTCATGCCATCGACGTAGACCCA9898
TIXDV1CATAGAGAGTACTAGAACGTCGCCGCTACTGC CCAGTTGTCATGCCATCGACGTAGACCCAA9896
Name and sequence of the positive products PCR and the values of percentages of identity and coverage obtained by BLAST analysis.

Discussion

Information regarding the participation of D. virginiana in the infection cycle of T. gondii is scarce and limited (Mitchell et al., 2006). Two serological studies have been conducted to date in Mexico; one in Durango (Dubey et al., 2009) and the other in Mexico City (Suzán and Ceballos, 2005). The first reported a seroprevalence of 16.6%, while the second reported a percentage of positive reactions of 10%. Similarly, serological studies conducted on same animal species in Iowa (Smith et al., 1992), Connecticut (Mitchell et al., 2006), Louisiana (Houk et al., 2010) and Georgia (Dubey et al., 2011) in the USA, have produced percentages of seropositivity of 2.9%, 29%, 27% and 33.3%, respectively. The percentage of infection in our study (76.9%; 10/13), obtained via a molecular test, was very high. This percentage may be due to environmental factors presents in the region, especially temperature and relative humidity, which allow the survival of the parasite in the environment (Rendón-Franco et al., 2014). Likewise, the population characteristics of the opossums used in our study directly affects the result (Hernández-Cortazar et al., 2015). Another element that may influence the high percentage of infection found, is that most of the positive individuals were captured at the same site (Table 1), so sampling from different sites could produce a different percentage of infection. The manner in which D. virginiana comes into contact with T. gondii is not clear, due to the fact that the diet of omnivorous animals is composed mainly of endemic fruits and insects, which are rarely contaminated with oocysts (Smith and Frenkel, 1995). Nevertheless, Castillo-Morales et al. (2012) report that Yucatan presents elevated environmental contamination with oocysts, for which reason different domestic and wild species can be infected. Similarly, Ortega-Pacheco et al. (2013) state that infection in animals may be acquired through sources of water, soil and even in the air; which could be related to the presence of T. gondii in juvenile specimens of D. virginiana and other wild or synanthropic species. However, for a fuller understanding of the participation of D. virginiana in the transmission cycle of toxoplasmosis, studies with experimental infections are necessary. These could also provide information about the pathogeny of T. gondii in this particular species. The circulation of T. gondii in Yucatan has been widely documented in human beings (Jiménez-Coello et al., 2011) and domestic animals such as pigs, dogs and cats, in which high percentages of seroconversion have been found (Castillo-Morales et al., 2012; Jiménez-Coello et al., 2013; Ortega-Pacheco et al., 2013), demonstrating the wide distribution of the parasite. However, the participation of D. virginiana in the infectious cycle of toxoplasmosis has not been identified previously, for which reason our findings contribute to the understanding of the circulation of the pathogen in the region. To our knowledge, this is also the first report to use molecular techniques to show circulation of T. gondii in D. virginiana captured in Mexico.
  18 in total

1.  Trypanosoma cruzi infection in Didelphis virginiana in relation to population parameters and variables associated with presence in rural community dwellings in Yucatan, Mexico.

Authors:  Julián Parada-López; Silvia F Hernández-Betancourt; Hugo A Ruiz-Piña; Francisco J Escobedo-Ortegón; Salvador Medina-Peralta; Jesús A Panti-May
Journal:  Ecohealth       Date:  2013-02-13       Impact factor: 3.184

2.  Genetic characterisation of Toxoplasma gondii in wildlife from North America revealed widespread and high prevalence of the fourth clonal type.

Authors:  J P Dubey; G V Velmurugan; C Rajendran; M J Yabsley; N J Thomas; K B Beckmen; D Sinnett; D Ruid; J Hart; P A Fair; W E McFee; V Shearn-Bochsler; O C H Kwok; L R Ferreira; S Choudhary; E B Faria; H Zhou; T A Felix; C Su
Journal:  Int J Parasitol       Date:  2011-07-19       Impact factor: 3.981

3.  Immunological status against Toxoplasma gondii in non-cat owners from an endemic region of Mexico.

Authors:  Matilde Jiménez-Coello; Eugenia Guzmán-Marín; Antonio Ortega-Pacheco; Karla Y Acosta-Viana
Journal:  Vector Borne Zoonotic Dis       Date:  2011-01-22       Impact factor: 2.133

4.  Field immobilization and euthanasia of American opossum.

Authors:  M K Stoskopf; R E Meyer; M Jones; D O Baumbarger
Journal:  J Wildl Dis       Date:  1999-01       Impact factor: 1.535

5.  The role of feral mammals on wildlife infectious disease prevalence in two nature reserves within Mexico City limits.

Authors:  Gerardo Suzán; Gerardo Ceballos
Journal:  J Zoo Wildl Med       Date:  2005-09       Impact factor: 0.776

6.  Prevalence of antibodies to Toxoplasma gondii in wild mammals of Missouri and east central Kansas: biologic and ecologic considerations of transmission.

Authors:  D D Smith; J K Frenkel
Journal:  J Wildl Dis       Date:  1995-01       Impact factor: 1.535

7.  Detection of Rickettsia felis in Wild Mammals from Three Municipalities in Yucatan, Mexico.

Authors:  Jesús Alonso Panti-May; Marco Torres-Castro; Silvia Hernández-Betancourt; Karla Dzul-Rosado; Jorge Zavala-Castro; Karina López-Avila; Raúl Tello-Martín
Journal:  Ecohealth       Date:  2014-12-24       Impact factor: 4.464

Review 8.  Toxoplasmosis in Mexico: epidemiological situation in humans and animals.

Authors:  Ivonne Hernández-Cortazar; Karla Y Acosta-Viana; Antonio Ortega-Pacheco; Eugenia del S Guzman-Marin; Armando J Aguilar-Caballero; Matilde Jiménez-Coello
Journal:  Rev Inst Med Trop Sao Paulo       Date:  2015 Mar-Apr       Impact factor: 1.846

9.  Prevalence and risk factors of Toxoplasma gondii in fattening pigs farm from Yucatan, Mexico.

Authors:  A Ortega-Pacheco; K Y Acosta Viana; E Guzmán-Marín; J C Segura-Correa; M Alvarez-Fleites; M Jiménez-Coello
Journal:  Biomed Res Int       Date:  2013-06-06       Impact factor: 3.411

10.  Wildlife uses and hunting patterns in rural communities of the Yucatan Peninsula, Mexico.

Authors:  Dídac Santos-Fita; Eduardo J Naranjo; José Luis Rangel-Salazar
Journal:  J Ethnobiol Ethnomed       Date:  2012-10-02       Impact factor: 2.733

View more
  1 in total

Review 1.  Didelphis spp. opossums and their parasites in the Americas: A One Health perspective.

Authors:  Marcos Antônio Bezerra-Santos; Rafael Antonio Nascimento Ramos; Artur Kanadani Campos; Filipe Dantas-Torres; Domenico Otranto
Journal:  Parasitol Res       Date:  2021-03-31       Impact factor: 2.289

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.