Warning: Undefined array key "mm" in /www/wwwroot/www.ai-bt.com/si.php on line 10 Deprecated: trim(): Passing null to parameter #1 ($string) of type string is deprecated in /www/wwwroot/www.ai-bt.com/si.php on line 10 Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

Literature DB >> 271973

Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

E C Koper-Zwarthoff, R E Lockard, B Alzner-deWeerd, U L RajBhandary, J F Bol.

Abstract

The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.

Entities: Chemical Species

Mesh：

Substances：

Year: 1977 PMID： 271973 PMCID： PMC431782 DOI： 10.1073/pnas.74.12.5504

Source DB: PubMed Journal: Proc Natl Acad Sci U S A ISSN： 0027-8424 Impact factor: 11.205

33 in total

10. Initiation of polypeptide synthesis with various NH2-blocked aminoacyl-tRNAs under the direction of alfalfa mosaic virus RNA 4.

Authors: A Castel; B Kraal; P R Kerklaan; J Klok; L Bosch
Journal: Proc Natl Acad Sci U S A Date: 1977-12 Impact factor: 11.205

Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

1. Avian myeloblastosis virus RNA is terminally redundant: implications for the mechanism of retrovirus replication.

2. Nucleotide sequences of ribosome recgonition sites in messenger RNAs of vesicular stomatitis virus.

3. The initiation region of the SV40 VP1 gene.

4. Nucleotide sequences at the 5'termini of rabbit alpha and beta globin mRNA.

5. Structure-function relationship of 5' non-coding sequence of rabbit alpha- and beta-globin mRNA.

6. The primary structure of rabbit beta-globin mRNA as determined from cloned DNA.

7. Rous sarcoma virus genome is terminally redundant: the 5' sequence.

8. Nucleotide sequence at the 5' terminus of the avian sarcoma virus genome.

9. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA.

10. Mapping adenines, guanines, and pyrimidines in RNA.

1. Sequence of 1000 nucleotides at the 3' end of tobacco mosaic virus RNA.

2. 3'-Terminal nucleotide sequence of alfalfa mosaic virus RNA 4.

3. Expression of a chimeric CaMV 35S Bacillus thuringiensis insecticidal protein gene in transgenic tobacco.

4. Capped mRNAs with reduced secondary structure can function in extracts from poliovirus-infected cells.

5. Nucleotide sequence at the 5' extremity of turnip yellow mosaic virus genome RNA.

6. Requirement for 7-methylguanosine in translation of globin mRNA in vivo.

7. An improved rapid enzymatic method of RNA sequencing using chemical modification.

8. Nucleotide sequence of the 3'-noncoding region of alfalfa mosaic virus RNA 4 and its homology with the genomic RNAs.

9. Complete nucleotide sequence of alfalfa mosaic virus RNA 1.

10. Initiation of polypeptide synthesis with various NH2-blocked aminoacyl-tRNAs under the direction of alfalfa mosaic virus RNA 4.