| Literature DB >> 27148285 |
Pablo Fernández1, Ricardo Alcántara-de la Cruz1, Hugo Cruz-Hipólito2, María D Osuna3, Rafael De Prado1.
Abstract
Hedgehog dogtail (Cynosurus echinatus) is an annual grass, native to Europe, but also widely distributed in North and South America, South Africa, and Australia. Two hedgehog dogtail biotypes, one diclofop-methyl (DM)-resistant and one DM-susceptible were studied in detail for experimental dose-response resistance mechanisms. Herbicide rates that inhibited shoot growth by 50% (GR50) were determined for DM, being the resistance factor (GR50R/GR50S) of 43.81. When amitrole (Cyt. P450 inhibitor) was applied before treatment with DM, the R biotype growth was significantly inhibited (GR50 of 1019.9 g ai ha(-1)) compared with the GR50 (1484.6 g ai ha(-1)) found for the R biotype without pretreatment with amitrole. However, GR50 values for S biotype do not vary with or without amitrole pretreatment. Dose-response experiments carried out to evaluate cross-resistance, showed resistance to aryloxyphenoxypropionate (APP), cyclohexanedione (CHD) and phenylpyrazoline (PPZ) inhibiting herbicides. Both R and S biotypes had a similar (14)C-DM uptake and translocation. The herbicide was poorly distributed among leaves, the rest of the shoot and roots with unappreciable acropetal and/or basipetal DM translocation at 96 h after treatment (HAT). The metabolism of (14)C-DM, D-acid and D-conjugate metabolites were identified by thin-layer chromatography. The results showed that DM resistance in C. echinatus is likely due to enhanced herbicide metabolism, involving Cyt. P450 as was demonstrated by indirect assays (amitrole pretreatment). The ACCase in vitro assays showed that the target site was very sensitive to APP, CHD and PPZ herbicides in the C. echinatus S biotype, while the R biotype was insensitive to the previously mentioned herbicides. DNA sequencing studies confirmed that C. echinatus cross-resistance to ACCase inhibitors has been conferred by specific ACCase double point mutations Ile-2041-Asn and Cys-2088-Arg.Entities:
Keywords: 14C-DM; ACCase activity; ACCase point mutations; Cynosurus echinatus; metabolism
Year: 2016 PMID: 27148285 PMCID: PMC4826872 DOI: 10.3389/fpls.2016.00449
Source DB: PubMed Journal: Front Plant Sci ISSN: 1664-462X Impact factor: 5.753
Primers used to amplify the ACCase gene.
| Primers | Sequence (5–3′) |
|---|---|
| AC1781F | CTGCAGCTGGATAGTGGTGA |
| AC1781R | AAGCTTGTTCAGGGCAGAAA |
| AC2F | AGCTTGGAGGAATCCCTGTT |
| AC2R | GGGTCAAGCCTACCCATACA |
Equation parameters of the sigmoidal curve used to calculate the dose of herbicide required to reduce 50% of the fresh weight (GR50) of Cynosurus echinatus R and S biotypes, and the ratios obtained (FR resistance factor) of resistant biotypes.
| Herbicide | Biotype | Maximum | Minimum | Hill slope | GR50 (g ai ha-1) | FR | |
|---|---|---|---|---|---|---|---|
| Fenoxaprop-p-ethyl | S | 98.97 | 1.09 | 0.74 | 0.94 | 45.56 | 58.16 |
| R | 100 | 4.90 | 6.69 | 0.99 | 2650.28 | ||
| Cyhalofop-butyl | S | 99.99 | 1.07 | 0.83 | 0.99 | 200.97 | 19.93 |
| R | 99.94 | 8.62 | 2.11 | 0.94 | 2800.79 | ||
| Diclofop-methyl | S | 99.61 | 3.41 | 0.75 | 0.97 | 33.89 | 43.81 |
| R | 91.69 | 12.04 | 5.38 | 0.99 | 1484.58 | ||
| Setoxydim | S | 98.27 | 1.18 | 1.74 | 0.97 | 13.87 | 2.18 |
| R | 99.99 | 3.62 | 3.29 | 0.99 | 30.27 | ||
| Cycloxydim | S | 99.99 | 5.56 | 0.85 | 0.98 | 12.66 | 3.19 |
| R | 99.97 | 7.26 | 1.97 | 0.99 | 40.42 | ||
| Pinoxaden | S | 99.74 | 3.87 | 1.64 | 0.99 | 16.25 | 16.64 |
| R | 99.99 | 5.36 | 2.87 | 0.98 | 270.47 |
14C-DM uptake and translocation (% of absorbed) in C. echinatus R and S biotypes at different time applicationsa.
| Biotype | HAT | % Uptake | Translocation (% of absorbed) | ||
|---|---|---|---|---|---|
| Treated leaf | Shoots | Roots | |||
| Susceptible | 12 | 12.2 ± 2.1g | 84.0 ± 3.6ab | 16.0 ± 3.4ab | 0.0 |
| 24 | 38.4 ± 3.6e | 80.6 ± 4.0ab | 18.1 ± 2.2ab | 1.3 ± 0.5cd | |
| 48 | 63.7 ± 4.7d | 77.1 ± 3.3abc | 19.6 ± 3.7ab | 3.3 ± 1.1abc | |
| 72 | 86.7 ± 3.0b | 73.6 ± 2.5bc | 21.7 ± 4.1ab | 4.6 ± 1.5ab | |
| 96 | 90.6 ± 4.2a | 68.6 ± 3.1c | 25.6 ± 3.0a | 5.6 ± 1.3a | |
| Resistant | 12 | 8.1 ± 1.6h | 86.2 ± 3.6a | 14.2 ± 4.0b | 0.0 |
| 24 | 34.0 ± 3.2f | 84.4 ± 2.9ab | 15.4 ± 2.6b | 1.0 ± 0.3cd | |
| 48 | 65.7 ± 2.5d | 81.5 ± 4.8ab | 17.3 ± 4.0ab | 1.2 ± 0.7cd | |
| 72 | 83.3 ± 4.1c | 79.7 ± 4.0abc | 19.6 ± 3.1ab | 2.1 ± 0.8cd | |
| 96 | 88.2 ± 5.6ab | 76.1 ± 3.6abc | 22.4 ± 2.9ab | 1.7 ± 0.5cd | |
Equation parameters of the sigmoidal curve used to calculate herbicide concentration required to reduce 50% of the ACCase activity (I50) of C. echinatus R and S biotypes and the ratios obtained (FR resistance factor) of resistant biotypes.
| Herbicide | Biotype | Maximum | Minimum | Hill slope | I50 (μM) | RF | |
|---|---|---|---|---|---|---|---|
| Fenoxaprop | S | 99.63 | 5.32 | 0.86 | 0.99 | 1.58 | 15.3 |
| R | 100.00 | 6.61 | 0.90 | 0.99 | 24.18 | ||
| Cihalofop | S | 100.00 | 3.24 | 0.89 | 0.99 | 10.19 | 6.9 |
| R | 100.00 | 1.08 | 0.51 | 0.97 | 70.77 | ||
| Diclofop | S | 100.00 | 2.13 | 0.78 | 0.99 | 4.53 | 14.0 |
| R | 100.00 | 3.03 | 0.41 | 0.98 | 63.46 | ||
| Setoxidim | S | 98.34 | 1.07 | 0.69 | 0.97 | 800.11 | 4.3 |
| R | 98.39 | 4.07 | 0.81 | 0.98 | 3500.93 | ||
| Cycloxidim | S | 99.01 | 1.70 | 1.61 | 0.99 | 2.5 | 3.1 |
| R | 97.05 | 3.17 | 1.46 | 0.98 | 7.89 | ||
| Pinoxaden | S | 99.99 | 0.79 | 0.78 | 0.99 | 0.39 | 23.3 |
| R | 99.98 | 9.27 | 1.23 | 0.98 | 9.1 |
Nucleotide sequence and predicted amino acids of ACCase DNA isolated from susceptible and resistant populations of C. echinatus compared to Alopecurus myosuroides (GenBank Accession no. AJ310767).
| Aminoacid position∗ | 1789 | 2041 | 2065 | 2067 | 2077 | 2088 |
|---|---|---|---|---|---|---|
| AGT/Ser | AAG/Lys | GCA/Ala | ATT/Ile | |||
| AGA/Arg | ATG/Met | GGC/Gly | GTT/Val | |||
| AGA/Arg | ATG/Met | GGC/Gly | GTT/Val |