Literature DB >> 27147196

Diversity and effect of Trichoderma spp. associated with green mold disease on Lentinula edodes in China.

Gangzheng Wang1,2, Xiantao Cao1,2, Xiaolong Ma1,2, Mengpei Guo1,2, Changhao Liu1,2, Lianlian Yan1,2, Yinbing Bian1,2.   

Abstract

Lentinula edodes, one of the most important edible mushrooms in China, is affected heavily by the infection of green mold that overgrows mushroom mycelia. We collected the diseased samples from main L. edodes cultivation regions in China to characterize the pathogen and to study the effect of Trichoderma spp. on L. edodes species. We identified six Trichoderma species, that is, T. harzianum, T. atroviride, T. viride, T. pleuroticola, T. longibrachiatum, and T. oblongisporum based on the internal transcribed spacer or tef1-α sequences and morphology characteristics. In confrontation cultures on Petri plates or in tubes, and in L. edodes cultures in a medium containing Trichoderma metabolites, L. edodes mycelia were not only distorted and swollen, but also inhibited by Trichoderma isolates. It is not possible that adjusting pH value or temperature is used for controlling L. edodes green disease, because the growth of most of Trichoderma isolates and L. edodes shared similar pH and temperature conditions.
© 2016 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Entities:  

Keywords:  Effect of Trichoderma spp. on L. edodes; Lentinula edodes; Trichoderma spp.; green mold; species diversity and distribution

Mesh:

Substances:

Year:  2016        PMID: 27147196      PMCID: PMC4985603          DOI: 10.1002/mbo3.364

Source DB:  PubMed          Journal:  Microbiologyopen        ISSN: 2045-8827            Impact factor:   3.139


Introduction

The fact that Trichoderma spp. can affect Agaricus bisporus was first described by Sinden and Hauser (1953). The disease did not receive much attention first primarily due to its infection in small areas of mushroom beds. However, a new severe problem was detected in numerous mushroom farms in Northern Ireland in 1985 where Trichoderma aggressivum causes green mold disease in A. bisporus (Seaby 1987). It appeared later in North America in 1992 that, first described and (Rinker et al. 1997). T. aggressivum rapidly overgrows compost and A. bisporus mycelium, and generates a wealth of green conidia to inhibit the formation of A. bisporus fruiting bodies, leading to a large reduction in mushroom yield (Anderson et al. 2001). From the perspective of L. edodes, green mold induced by Trichoderma can attack and kill L. edodes mycelia in the bed‐logs and reduce the mushroom yield. The main species detected in damaged bedlogs were T. harzianum Rifai and T. polysporum Rifai (Komatsu 1976). Subsequently, a number of researchers explored environmental factors and cultivation conditions, for instance, carbon and nitrogen source or temperature and water, for their effect on mycelial growth of L. edodes and Trichoderma spp. (Tokimoto and Komatsu 1979; Badham 1991). Simultaneously, Bruce et al. (1984) documented that a volatile of Trichoderma spp. could inhibit L. edodes mycelial growth. Selection and breeding studies of L. edodes species resistant to Trichoderma spp. have been conducted by many researchers (Tokimoto. et al. 1984; Lee Hye‐Min et al. 2008). Nevertheless, the studies of the effect of Trichoderma species on L. edodes are less well‐documented. To the best of our knowledge, the main Trichoderma species affecting L. edodes are T. harzianum, T. viride, T. longibrachiatum, and T. polysporum in Fujian province (Jiang et al. 1995). L. edodes, the second most important edible mushroom in worldwide production, is widely cultivated in China. Therefore, it is important to collect and identify Trichoderma spp. in the main cultivation areas. In this study, we collected a wealth of green mold disease logs from main Shiitake cultivation areas in China. Based on the morphology and internal transcribed spacer (ITS) sequence as well as tef1‐α sequence, we analyzed the species and distribution of Trichoderma spp. Additionally, we undertook the mycelial growth under different conditions and effect of Trichoderma spp. on L. edodes via scanning electron microscope. On the basis of this study, we will identify the best L. edodes strain to elaborate the mechanism of the interaction between L. edodes and Trichoderma spp. by the transcriptomic analysis.

Materials and Methods

Collection of green mold disease logs and isolation of fungal species

Between 2012 and 2013, green mold disease occurred continuously in L. edodes production areas in Suizhou, Hubei, leading to a significant negative effect on the development of L. edodes. Fifty‐nine Trichoderma isolates were collected from the diseased logs of L. edodes in four main cultivation areas (Table 1), and deposited in the culture collection of the Institute of Applied Mycology, Huazhong Agricultural University. All species were isolated and maintained according to Hatvani et al. (2007).
Table 1

The numbers and origin of Trichoderma spp. isolates used in the study

OriginStrainsSum
T. harzianum T. viride T. atroviride T. longibrachiatum T. pleuroticola T. oblongisporum
Suizhou,HubeiT8,T11,T12,T14,T15,T18,T19,T27,T32,T36,T44,T62T25,T40,T59T33,T43,T47T37,T60,T6121
Wuhan,HubeiT5,T482
Shiyan,HubeiT38,T46,T493
Biyang,HenanT7,T9,T16T13,T23T29,T307
Xixia,HenanT31,T50,T513
Sanmenxia,HenanT53,T54,T55T52,T56T576
Lishui,ZhejiangT20,T21,T26,T424
Qingyuan,ZhejiangT2T35,T393
Jingning,ZhejiangT4,T28,T413
Ningde,FujianT1,T10T243
Youxi,FujianT31
Minqing,FujianT6,T17T223
Sum394643359
The numbers and origin of Trichoderma spp. isolates used in the study

Species identification

Morphology analysis

The isolated species were incubated on complete yeast medium (CYM; 2% glucose, 0.2% yeast extract, 0.2% peptone, 0.046% KH2PO4, 0.1% K2HPO4, 0.05% MgSO4·7H2O) at 25°C in darkness, during which colony shape and pigment were documented. Simultaneously, four cover glasses were inserted slantingly into the CYM medium to observe the conidia and conidiophores via the microscope (U‐RFL‐T, Olympus) when the mycelia spread on the cover glass (Park et al. 2006).

Molecular analysis

Mycelium that has grown in CYM medium was used for DNA isolation using the CTAB (hexadecyltrimethylammonium bromide) method (Zhang et al. 2010). The PCR primer pairs (Table 2) and amplification procedures were used according to the method of Sadfi‐Zouaoui (Sadfi‐Zouaoui et al. 2009). PCR products were tested and sequenced by WuHan tsingke BioTech Co., Ltd. The sequences were inspected and refined manually, and blasted in TrichoBLAST databank. Additionally, the phylogenetic trees of the ITS and tef1‐α sequences were constructed with maximum likelihood method by MEGA 6.0.
Table 2

Primer species used in this study.

PrimersSequence
ITS‐1TCCGTAGGTGAACCTGCGG
ITS‐4TCCTCCGCTTATTGATGC
EF1‐728FCATCGAGAAGTTCGAGAAGG
EF1‐728RGCCATCCTTGGAGACCAGC
Primer species used in this study.

Culture characteristics of Trichoderma spp. and L. edodes species

Effect of different temperature treatments on mycelial growth of Trichoderma spp. and L. edodes species

Twenty‐three isolates were selected as the test species including the six species, T. harzianum: T3, T6, T10, T12, T20, T21, T27, T28, T38, T42, T55; T. atroviride: T25, T29, T30, T24; T. viride: T13, T23, T52; T. pleuroticola: T22, T35, T39; T. longibrachiatum: T57; and T. oblongisporum: T37. Two L. edodes species, Yuhua‐2 (mainly cultivated in Biyang, Hubei province of China) and Xiang939 (mainly cultivated in Qinyuan county, Zhejiang province of China), were selected as the control species. The 8 mm mycelial plugs in diameter were inoculated in CYM, and cultured separately at 15°C, 20°C, 25°C, 30°C, and 35°C. Each treatment was replicated for three times. Growth rate (mm/d) = (colony diameter‐plug diameter)/2n, where n represents cultivation days.

Effect of different pH on mycelial growth of Trichoderma spp. and L. edodes species

Two Trichoderma species on mushroom, namely the dominant species T. harzianum (T36) and the recently reported species T. oblongisporum (T37), and L. edodes Qiu‐7 were selected as the tested strain. The 8 mm plugs in diameter of testing species were inoculated on CYM separately at pH values of 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11, where different pH values were adjusting via adding HCl or NaOH solution filtered via the biofilter after sterilization. The treatment was repeated four times. The diameters were measured after 2 days (for T36 and T37) and 7 days (for Qiu‐7). Growth rate (mm/d) = (colony diameter‐plug diameter)/2n, where n represents cultivation days.

Effect of Trichoderma spp. on L. edoeds mycelia

Effect of Trichoderma spp. on L. edoeds mycelia in petri plates

Fifteen of the 59 isolates including six species were chosen to test the aggressiveness of the species. The experiments were carried out with three replicates as follows. Mycelial agar plugs (8 mm in diameter) were cut from the growing front of 7‐day‐old colonies of L. edodes species (Qiu‐7 mainly cultivated in Wuhan, Hubei province of China) and were inoculated onto CYM at 1 cm from the edge in Petri plates of 9 cm in diameter. Seven days later, mycelial plugs of Trichoderma cultures were inoculated in the same way but on the opposite side 1 cm apart from the plate edge. The confrontation conditions, inhibition rate of Trichoderma spp. against L. edodes mycelial growth, were observed. Then, the changes of L. edodes mycelium treated by T. harzianum, T. oblongisporum, and T. atroviride were observed via SEM (scanning electron microscope).

Effect of Trichoderma fermentation broth on L. edodes mycelium

To test Trichoderma fermentation broth effect on L. edodes mycelia, T. oblongisporum T37 plugs were inoculated into the PD (potato dextrose) broth, followed by 1 week culture in darkness at 25°C, 160 rpm. Mycelium cells were removed by filter paper, and the filtrate was treated by either further filtration via 0.22 μm filter paper. Then, filtrates were added to the CYM medium to thirty percent in volume, with 30% sterile water used for control. L. edodes Qiu‐7 mycelium plugs (8 mm in diameter) were inoculated on the medium and cultured in darkness at 25°C. Ten days later, the diameters of the colonies were measured to test the inhibition ratio and mycelium growth rate. Then, the changes of L. edodes mycelium were observed via SEM.

Data analysis

Data obtained were analyzed using statistical IBM SPASS20. (SPSS Inc., Chicago, IL, USA) Statistical significance was identified at the 95% confidence level (P < 0.05).

Results

Sample collection and survey on L. edodes rot log disease

L. edodes logs with green mold disease in Suizhou have the features of sudden outburst and rapid spread, especially after watering in the first flush mushroom. Logs infected by green mold showed similar disease symptoms: bag‐logs infected by the pathogen initially become soft, no green mold appearing, and with L. edodes mycelium growing, spots appeared in the bags (Fig. 1A). The spot turned green in the presence of high humidity or with increasing time, produced dark green conidia (Fig. 1B and C). Finally, all of the bag‐logs would become rotten and loose, and the mycelia from the diseased bags produced a mold odor of that pathogen and the good smell of L. edodes mycelia disappeared as L. edodes mycelia died off (Fig. 1D).
Figure 1

The process of symptom development of L. edodes green mold disease.

The process of symptom development of L. edodes green mold disease.

Morphology identification of the isolates

According to the classification method of Bissett (1984), Gams and Bissett (1998) and Park et al. (2006), six Trichoderma species, namely T. harzianum, T. atroviride, T. viride, T. pleuroticola, T. longibrachiatum, and T. oblongisporum, were isolated based on the colony shape, conidia, conidiophores size, chlamydospore, and pigment (Fig. 2). First, color of the colony is white, and become light green to dark green later because conidia clusters generating. The mycelial growth speeds of different isolate colony varied from 11.38 mm/d to 17.55 mm/d. Except for T. pleuroticola and T. longibrachiatum, lots of chlamydospores were found in late stage of the remaining isolate growth. The details of different Trichoderma isolate characteristics were seen in the Table 3.
Figure 2

Colony and microscopic characteristics of different Trichoderma isolates.

Table 3

Colony and microscopic characteristics of different Trichoderma isolates

SpeciesColony in CYMConidiophores and phialidesConidiaChlamydospores
T. harzianum 11.38 mm/d, powdery, light green, later gray green, floccose, white to grayish (Fig. 2A)Ampulliform, base constricted, center swollen, peak slender, 1.99–3.43 μm to 3.39–6.87 μm in length (Fig. 2B)Subglobose to ellipsoidal, smooth‐walled, mostly 2.17–2.83 μm × 2.08–3.87 μm in diameter (Fig. 2C)Elliptic (Fig. 2D)
T. viride 15.17 mm/d, white in the primary stage (Fig. 2E)Branched irregularly, slightly crooked or hook‐like, base constricted, center swollen, peak slender, 1.47–2.33 μm to 5.66–8.46 μm in length (Fig. 2F)Spherical or subglobose, 1.79–2.54 μm to 1.91–3.07 μm in diameter (Fig. 2G)Basidixed and subglobose (Fig. 2H)
T. atroviride 17.55 mm/d, light yellow rounded conidial cluster, dark green colony later (Fig. 2I)4.15–8.33 μm in diameter, and 1.49–2.86 μm in the width of the center, with most single phialides located in the conidiophores (Fig. 2K)Ellipsoidal to subglobose, and 1.94–3.16 μm to 2.32–3.97 μm in length (Fig. 2L)Basidixed and subglobose (Fig. 2J)
T. longibrachiatum 16.55 mm/d, white at first, septate, and |smooth‐walled, yellow pigment (Fig. 2 M)Cylindrical, base partly constricted, center slender, and shorter, 4.21–15.67 μm in the length, with the widest part being 1.23–3.95 μm (Fig. 2N, O, P)Formed in the phialides, green, and ellipsoidal (Fig. 2N, O, P)Not found
T. pleuroticola 15.55 mm/d, white, smooth‐walled, septate, yellow green conidial clusters(Fig. 2Q)Separately or opposite in the base of the principal axis, longer, base constriction not obvious, 3.88–10.34 μm in length, with the widest segment being 2.20–3.01 μm (Fig. 2R,S)Subglobose, green, smooth‐walled, 2.20–2.95 μm to 1.88–3.01 μm in diameter (Fig. 2T)Not found
T. oblongisporum 13.5–13.7 mm/d, floccose, white, and septate (Fig. 2U)Branched at vertical angles, primary branches single or opposite; ampulliform, 3.1–6.7 × 2.7–4.0 μm in length, base constricted, center swollen, and peak slender (Fig. 2X).Ellipsoidal or oblong, 3.3–4.7 × 2.4–3.2 μm(Fig. 2V)Subglobose to ellipsoidal (Fig. 2W)

CYM, complete yeast medium.

Colony and microscopic characteristics of different Trichoderma isolates. Colony and microscopic characteristics of different Trichoderma isolates CYM, complete yeast medium.

Molecular identification of the isolates

The ITS sequence sizes of 59 isolates were 532 bp to 604 bp (Fig. S1), and blasted in TrichoBLAST database. According to the highest similarity, the highest score value and the least e‐value, six Trichoderma species, that is T. harzianum, T. atroviride, T. viride, T. pleuroticola, T. longibrachiatum, and T. oblongisporum, were identified. Additionally, the tef1‐α sequence was used to identify the recently reported T. oblongisporum on mushroom and some Trichoderma species not identified via the ITS sequence (Fig. S2). The phylogenetic trees of the 59 Trichoderma isolates were constructed by maximum likelihood method based on ITS and tef1‐α sequences (Figs. 3, 4). The result demonstrated that all species were divided into six groups. T1, T2, T3, T4, T5, T6, T7, T8, T9, T10, T11, T12, T14, T15, T16, T17, T18, T19, T20, T21, T26, T27, T28, T31, T32, T36, T38, T41, T42, T44, T46, T48, T49, T50, T51, T53, T54, T55 , T62 and T. harzianum (KC874893, KC576705 and U78882) were classified in the same group. T. longibrachiatum (JQ796066) was grouped with the T33, T43, T47 and T57. From the perspective of the ITS sequence, T13, T23, T29, T30, T40, T52, T56 and T59 together with T. viride (KP689168, FJ426389) were classified in a group, and T24 and T25 were grouped into T. atroviride (AF456920, JF694930) and T. viride (FJ481123), while T29, T30, T40 and T59 morphology characteristics showed the higher similarity to those of T. atroviride. Therefore, we applied the tef1‐α sequences to identify that species accurately, and the results also suggested that T29, T30, T40 and T59 belonged to the group of T. atroviride (EF581849, KJ665422, KJ665417, JN387051). The sequences of T37, T60 and T61 were highly similar to that of T. oblongisporum (OQ083020 and FJ623268). T22, T35 and T39 showed the most consistency with T. pleuroticola (JQ040377).
Figure 3

Phylogenetic tree of the 59 Trichoderma isolates by maximum likelihood method based on ITS sequences (MEGA 6.0).

Figure 4

Phylogenetic tree of the 8 Trichoderma isolates not identified via ITS sequence by maximum likelihood method based on tef1‐α sequences (MEGA 6.0).

Phylogenetic tree of the 59 Trichoderma isolates by maximum likelihood method based on ITS sequences (MEGA 6.0). Phylogenetic tree of the 8 Trichoderma isolates not identified via ITS sequence by maximum likelihood method based on tef1‐α sequences (MEGA 6.0).

Effect of different temperatures and pH on L. edodes and Trichoderma spp. mycelia

Of 24 Trichoderma species, 18 species could grow at 15–35°C. Furthermore, the time of the sporulation was shorter with temperature increasing. However, several species, such as T52, T37, T42, T29, T30, and T23, stopped growth at 35°C. The growth rate of T39 and T21 peaked at 30°C, whereas that of the remaining species peaked at 25°C; the maximum rate of mycelial growth was 7.05–19.73 mm/d. However, the growth rate of T. oblongisporum which has been identified recently in edible fungi was the lowest 7.05 mm/d. From the perspective of L. edodes mycelia, Yuhua‐2 and Xiang939 grew well at 25°C, and the average growth rate of mycelia were 5.57 mm/d and 4.16 mm/d, respectively. Neither species grew at 35°C (Fig. S3). According to Figure S4, we could conclude that the suitable pH of two Trichoderma isolates and L. edodes Qiu‐7 species was 4–7. However, T36 and T37 could grow normally at a pH range 2–11. What is more, the growth rate of Trichoderma isolates was sharply faster than that of L. edodes in the same condition, suggesting that it is unlikely to inhibit the growth of Trichoderma isolates by adjusting pH values and environment temperature.

Effect of Trichoderma spp. on L. edodes mycelia

In dual culture of L. edodes and Trichoderma spp. on agar plate, differences were observed in the interactions of six Trichoderma species with L. edodes mycelia when measured by the inhibition rate for L. edodes hypha (Fig. S5). T. harzianum and T. pleuroticola inhibited heavily L. edodes mycelium growth, which was verified by the inhibition ratio ranging from 63% to 94%. T. viride could inhibit heavily L. edodes mycelial growth. Nevertheless, the inhibition effect among different species varied more obviously. The inhibition rates were 73% and 50% for T. atroviride isolates T29 and T24, respectively, with the sharpest variations among all species. However, T. longibrachiatum manifested inhibition ratio 29%. From the perspective of mycelial morphology, Trichoderma mycelia could overgrow and spread on L. edodes mycelia, forming irregular conidial clusters, resulting in gradual withering of L. edodes mycelia. Besides, various pigment and antagonistic streaks appeared on the back of the medium.

Changes in L. edodes mycelium treated by Trichoderma spp. in SEM

From the perspective of the interaction between Trichoderma mycelium and L. edodes mycelium, we observed that L. edodes hyphal cells from the interaction zone are distorted with local swellings, whereas the mycelium untreated by T. harzianum was smooth and straight (Fig. 5A and B), and T. harzianum hyphae could coil around the hyphae of L. edodes (Fig. 5C) through SEM (scanning electron microscopy) observation. After getting contact to T. oblongisporum and T. atroviride mycelia, L. edodes mycelia became ruptured and rough (Fig. 5D, E) After L. edodes mycelium grew about 15d in complete yeast broth medium, the Trichoderma plugs were added to the broth. Several days later, the L. edodes mycelium balls treated by Trichoderma spp. were broken or became smaller. Conversely, the mycelium palls untreated by Trichoderma spp. grew normally. Additionally, metabolites of T. oblongisporum T37 fermentation broth treated by different methods affected L. edodes mycelia growth differently. Compared with the control group, L. edodes mycelia that grew in the medium containing 30% T. oblongisporum metabolites were dramatically thick (Fig. 5F).
Figure 5

Effect of Trichoderma spp. and T. oblongisporum metabolites on L. edodes mycelia.

Effect of Trichoderma spp. and T. oblongisporum metabolites on L. edodes mycelia.

Discussion

Lentinula edodes mycelium in bed‐logs is attacked and killed by Trichoderma species, for instance, T. harzianum and T. polysporum, which produced antifungal substances and mycolytic enzymes that commonly caused injury to mycelial growth and fruit body formation of L. edodes, as well as having negative effect on the yield of Shiitake cultivation (Tokimoto 1985; Ulhoa and Peberdy 1992; Seaby 1998). However, little is known about the distribution and species of Trichoderma spp. attacking Shiitake mycelium in China. Therefore, we collected many diseased logs from main Shiitake cultivation areas, in order to characterize them and explore the interaction between them. In this study, colony morphology and conservative sequence including ITS and tef1‐α sequence were included to identify those Trichoderma species. Six Trichoderma species, such as T. harzianum, T. atroviride, T. viride, T. pleuroticola, T. longibrachiatum, and T. oblongisporum, were obtained from the diseased logs in main Shiitake cultivation areas of China. T. harzianum, a general and widespread pathogen in mushroom (Tokimoto and Komatsu 1995; Jiang et al. 1995; Savoie 1998; Lee Hye‐Min et al. 2008), accounted for 68% in all Trichoderma species isolated from the diseased Shiitake logs, as well as being observed extensively in four cultivation areas. This species is used widely for the biological control of plant pathogen (Steindorff et al. 2014; Troian et al. 2014). T. atroviride possessed stronger capacity attacking the L. edodes mycelium because of its mycelia overgrowing L. edodes mycelia, and was isolated in three cultivation areas except for Zhejiang province. The remaining species were rare in Shiitake logs: the mycelium of Shiitake was attacked weakly by T. longibrachiatum in Hubei and Henan; T. pleuroticola reported in diseased Oyster mushroom (Park et al. 2006) was only found on Shiitake in Zhejiang and Fujian, demonstrating that it had no host specificity, which may be relative to the environmental factors in two province that are in the subtropics; yet, T. viride was only detected on Shiitake in Henan province; simultaneously, T. oblongisporum was obtained only in Suizhou, Hubei, and the morphological characteristics and the chlamydospores were sharply different from other Trichoderma species (Cao et al. 2014). The environment factor differences, for instance temperature, humidity, sunshine, and the like, were affected sharply by mountains and rivers, and the activity of species varied under different conditions, which may influence the distribution of species. Widden P found that environmental conditions where different Trichoderma species live had obvious region distribution and changed as the season varied, which had an important role in Trichoderma spp. growth (Widden and Scattolin 1988).L. edodes hyphal cells from the interaction zone were thickened and rough with local swellings, which are consistent with the results of the interaction between Trichoderma spp. and L. edodes (Lee Hye‐Min et al. 2008) and Sclerotinia sclerotiorum (Troian et al. 2014). T. oblongisporum metabolites could get L. edodes mycelia thickened, and L. edodes hyphal cells got broken in the presence of Trichoderma spp., based on which we assumed that Trichoderma spp. showed various effects against L. edodes: they could inhibit the mycelium growth mainly by coiling or mycoparasitism, or produce a wealth of enzymes and the antibiotics to inhibit L. edodes mycelium growth, for instance, chitinase, β‐glucanases, anthraquinones, and isocyano metabolites. A battery of hydrolytic enzymes consisting of chitinases, β‐glucanases, and proteases produced by different T. aggressivum could attack mycelial walls of A. bisporus (Williams et al. 2003; Guthrie et al. 2005; Guthrie and Castle 2006). The antagonistic role of Trichoderma mycelia on those of L. edodes were relative to fungal cell wall lytic enzyme activities and ether‐soluble neutral antifungal compounds produced by Trichoderma spp. (Ishikawa et al. 1980; Tokimoto 1982), which was consistent with our result that L. edodes mycelia were degraded by Trichoderma metabolites through scanning electron microscopy observation. To better understand their interaction, we would explore how L. edodes is affected at both transcription and protein level via transcriptome and proteome analysis.

Conflict of Interest

None declared. Figure S1. The electrophoresis profile of ITS of the isolates. Figure S2. The electrophoresis of tef1‐α of the isolates. Figure S3. Effect of different temperature treatment of mycelia growth of 2 L. edodes and Trichoderma spp. isolates. Figure S4. Effect of different pH treatment on mycelia growth of two Trichodermaisolates and one L. edodes strain. Figure S5. Inhibition rate of 6 Trichodermaspecies on L. edodes Qiu‐7 in confrontation culture. Click here for additional data file.
  10 in total

1.  A simple method of genomic DNA extraction suitable for analysis of bulk fungal strains.

Authors:  Y J Zhang; S Zhang; X Z Liu; H A Wen; M Wang
Journal:  Lett Appl Microbiol       Date:  2010-05-14       Impact factor: 2.858

2.  Chitinase production during interaction of Trichoderma aggressivum and Agaricus bisporus.

Authors:  Jennifer L Guthrie; Alan J Castle
Journal:  Can J Microbiol       Date:  2006-10       Impact factor: 2.419

3.  An improved method for detection and quantification of chitinase activities.

Authors:  Jennifer L Guthrie; Sagal Khalif; Alan J Castle
Journal:  Can J Microbiol       Date:  2005-06       Impact factor: 2.419

4.  Saprotrophic and mycoparasitic components of aggressiveness of Trichoderma harzianum groups toward the commercial mushroom Agaricus bisporus.

Authors:  Josie Williams; John M Clarkson; Peter R Mills; Richard M Cooper
Journal:  Appl Environ Microbiol       Date:  2003-07       Impact factor: 4.792

5.  Biodiversity of Trichoderma strains in Tunisia.

Authors:  N Sadfi-Zouaoui; I Hannachi; M Rouaissi; M R Hajlaoui; M B Rubio; E Monte; A Boudabous; M R Hermosa
Journal:  Can J Microbiol       Date:  2009-02       Impact factor: 2.419

6.  Mycoparasitism studies of Trichoderma harzianum against Sclerotinia sclerotiorum: evaluation of antagonism and expression of cell wall-degrading enzymes genes.

Authors:  Rogério Fraga Troian; Andrei Stecca Steindorff; Marcelo Henrique Soller Ramada; Walquiria Arruda; Cirano José Ulhoa
Journal:  Biotechnol Lett       Date:  2014-06-26       Impact factor: 2.461

7.  Green Mold Diseases of Agaricus and Pleurotus spp. Are Caused by Related but Phylogenetically Different Trichoderma Species.

Authors:  L Hatvani; Z Antal; L Manczinger; A Szekeres; I S Druzhinina; C P Kubicek; A Nagy; E Nagy; C Vágvölgyi; L Kredics
Journal:  Phytopathology       Date:  2007-04       Impact factor: 4.025

8.  Breeding and Screening of Lentinula edodes Strains Resistant to Trichoderma spp.

Authors:  Hye-Min Lee; Won-Chull Bak; Bong-Hun Lee; Hyun Park; Kang-Hyeon Ka
Journal:  Mycobiology       Date:  2008-12-31       Impact factor: 1.858

9.  Identification of mycoparasitism-related genes against the phytopathogen Sclerotinia sclerotiorum through transcriptome and expression profile analysis in Trichoderma harzianum.

Authors:  Andrei Stecca Steindorff; Marcelo Henrique Soller Ramada; Alexandre Siqueira Guedes Coelho; Robert Neil Gerard Miller; Georgios Joannis Pappas; Cirano José Ulhoa; Eliane Ferreira Noronha
Journal:  BMC Genomics       Date:  2014-03-18       Impact factor: 3.969

10.  Two new species of trichoderma associated with green mold of oyster mushroom cultivation in Korea.

Authors:  Myung Soo Park; Kyung Sook Bae; Seung Hun Yu
Journal:  Mycobiology       Date:  2006-09-30       Impact factor: 1.858

  10 in total
  6 in total

1.  Comparative Transcriptome Analysis Provides Insights Into the Mechanism by Which 2,4-Dichlorophenoxyacetic Acid Improves Thermotolerance in Lentinula edodes.

Authors:  Ruiping Xu; Shasha Zhou; Jiaxin Song; Haiying Zhong; Tianwen Zhu; Yuhua Gong; Yan Zhou; Yinbing Bian
Journal:  Front Microbiol       Date:  2022-06-20       Impact factor: 6.064

2.  Selection and Validation of Reference Genes for qRT-PCR in Lentinula edodes under Different Experimental Conditions.

Authors:  Yi Luo; Gangzheng Wang; Chen Wang; Yuhua Gong; Yinbing Bian; Yan Zhou
Journal:  Genes (Basel)       Date:  2019-08-27       Impact factor: 4.096

3.  Hsp40 Protein LeDnaJ07 Enhances the Thermotolerance of Lentinula edodes and Regulates IAA Biosynthesis by Interacting LetrpE.

Authors:  Gangzheng Wang; Yi Luo; Chen Wang; Yan Zhou; Chunye Mou; Heng Kang; Yang Xiao; Yinbing Bian; Yu Hua Gong
Journal:  Front Microbiol       Date:  2020-04-17       Impact factor: 5.640

4.  FFGA1 Protein Is Essential for Regulating Vegetative Growth, Cell Wall Integrity, and Protection against Stress in Flammunina filiformis.

Authors:  Muyun Du; Yongbo Xie; Meng Wang; Huan Yang; Banghui Hu; Irum Mukhtar; Yuanyuan Liu; Yongxin Tao; Fang Liu; Baogui Xie
Journal:  J Fungi (Basel)       Date:  2022-04-14

5.  Phylogenetic Analysis of Trichoderma Species Associated with Green Mold Disease on Mushrooms and Two New Pathogens on Ganoderma sichuanense.

Authors:  Xiao-Ya An; Guo-Hui Cheng; Han-Xing Gao; Xue-Fei Li; Yang Yang; Dan Li; Yu Li
Journal:  J Fungi (Basel)       Date:  2022-07-03

6.  Expression Profile of Laccase Gene Family in White-Rot Basidiomycete Lentinula edodes under Different Environmental Stresses.

Authors:  Lianlian Yan; Ruiping Xu; Yinbing Bian; Hongxian Li; Yan Zhou
Journal:  Genes (Basel)       Date:  2019-12-16       Impact factor: 4.096

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.