Literature DB >> 27144108

Microsatellite markers for hoop-petticoat daffodils (Narcissus sect. Bulbocodii; Amaryllidaceae).

Kálmán Könyves1, John C David2, Alastair Culham3.   

Abstract

PREMISE OF THE STUDY: Microsatellite markers were developed using hoop-petticoat daffodils (Narcissus sect. Bulbocodii; Amaryllidaceae) to aid in the taxonomic revision of the section, and to further evaluate their broad applicability for daffodil cultivar identification. METHODS AND
RESULTS: Three hundred fifty-one primer pairs were developed using a commercial service. Nineteen polymorphic and repeatable markers were developed by screening 67 of these primer pairs. Of these, 11 chosen markers were used to screen 317 samples; the number of alleles per locus ranged from four to 21, and the observed heterozygosity ranged from 0.101 to 0.297. There were null genotypes in some samples for six of the markers. All the microsatellites were transferable to other Narcissus sections.
CONCLUSIONS: The results indicate that these new markers have sufficient potential variation to be used for taxonomic revision of the genus and to distinguish many commercial daffodil cultivars.

Entities:  

Keywords:  Amaryllidaceae; Narcissus section Bulbocodii; daffodil cultivars; horticultural taxonomy; microsatellite markers; polyploidy

Year:  2016        PMID: 27144108      PMCID: PMC4850056          DOI: 10.3732/apps.1500127

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Narcissus L. (Amaryllidaceae) is the single most important ornamental crop for both the cut flower and the bulb trade combined. Complex breeding programs of daffodils over the past 150 yr have resulted in more than 30,000 registered cultivars (Könyves et al., 2011), but this makes the description and commercialization of new cultivars increasingly complex. Naming new cultivars requires the identification and description of discriminating features, and molecular markers, such as microsatellites, could provide fast, cheap, and easily searchable data to achieve this (Culham and Grant, 1999). To assess the use of microsatellites in Narcissus for cultivar identification and for taxonomic revision, we developed new microsatellite markers for Narcissus sect. Bulbocodii DC. (hoop-petticoat daffodils) as a test case. This section is an excellent study group due to its distinct floral morphology, having a large funnel-shaped corona; its limited distribution, ranging from southern Morocco to southwest France; and its long history in cultivation (David and Könyves, 2013). The section exhibits natural variation in both morphology and in chromosome number, ranging from diploid to octoploid (Fernandes, 1963), and the taxa frequently hybridize, resulting in four to 33 taxa from species down to varietal ranks, depending on taxonomic treatment. The microsatellite markers described here were developed using material from a naturally occurring population and screened using a combination of wild and cultivated plants to establish the extent of genetic variation.

METHODS AND RESULTS

Material from the wild was collected across the natural distribution of Narcissus sect. Bulbocodii (Könyves, 2014). In total, 44 populations were sampled (Appendix 1). Total genomic DNA was extracted using a modified cetyltrimethylammonium bromide (CTAB) protocol (Doyle and Doyle, 1987). Microsatellite library development and primer design were carried out by Genoscreen (Lille, France). An equimolar DNA mix of 10 individuals of population KET (Appendix 1) was enriched with eight microsatellite probes (TG, TC, AAC, AAG, AGG, ACG, ACAT, ACTC) and sequenced according to the GS FLX protocol by Malausa et al. (2011). The resulting library consisted of 37,979 raw sequences. Of these, 5765 contained microsatellites, and primers were designed for 351 using QDD (Meglécz et al., 2010) following Malausa et al. (2011). Resources allowed test PCR amplification of 67 primer pairs from the 351 developed. The primers were chosen to maximize the variation in length of amplicon, motif repeat sequence, and motif length. Test amplification of primers used one sample each from populations CAT and V, and four samples from an existing living collection (accession no. SJ20597, SJ001999, BD96/198, and Narcissus ‘Golden Bells’, the most widely available cultivar in this section; Appendix 2), with the equimolar DNA mix of population KET used as a positive control. PCR reactions were performed in a 10-μL volume containing final concentrations of 1× Bioline Biomix (Bioline Reagents Ltd., London, United Kingdom), 0.1–0.2 μM of each primer, and 10 ng of DNA template. Cycling conditions were 94°C for 120 s; 40 cycles of 94°C for 45 s, 48–63°C for 30 s, 72°C for 45 s; and finally 72°C for 10 min (see Table 1). The PCR products were separated on 2% w/v agarose gels in 1× TAE buffer (pH 8.0) stained with ethidium bromide with accompanying HyperLadder 100bp (Bioline Reagents Ltd.) as a marker. Gels were photographed under ultraviolet illumination to record the presence of PCR products. Of the 67 primer pairs selected for initial trial, 39 primer pairs amplified the expected target fragments. Microsatellite variability was tested with an equimolar DNA mix of 19 samples (marked with a/b in Appendix 1 and 2) by ligating the PCR products with the M13 promoter and labeling the products with 6-FAM according to Cryer et al. (2005). Fragment analysis of amplicons was carried out by Source BioScience (Nottingham, United Kingdom). The electropherograms were analyzed using GeneMapper version 4.0 (Applied Biosystems by Life Technologies, Carlsbad, California, USA). Thirty-three of the tested primer pairs amplified multiple clean peaks. Of these, the best 24, based on the overall quality of the electropherograms, were used to genotype seven samples (two samples each of populations KET and TIG, one each of populations CAT and POR, and one of Narcissus ‘Golden Bells’). Forward primers were labeled with fluorescent dyes 6-FAM, HEX (Sigma-Aldrich, St. Louis, Missouri, USA), NED, PET, or VIC (Thermo Fisher Scientific, Waltham, Massachusetts, USA). Readable electropherograms were obtained for 19 primer pairs (Table 1). Of these, resources allowed the 11 best markers (most length-variable and reproducible) to be used to genotype 317 samples of hoop-petticoat daffodils across the natural distribution range to assess the degree of polymorphism in nature (Table 2).
Table 1.

Characteristics of 19 microsatellite loci developed for Narcissus sect. Bulbocodii.

LocusPrimer sequences (5′–3′)Repeat motifAllele size range (bp)Ta (°C)GenBank accession no.
NSB14aF: TGTGTAAGCATACTAACGTTTCG(ATGT)14147–22148KT005774
R: AAAAGAGCACCAAGGATGAA
NSB52aF: CAATGGTGGAGCCTCTAATAGC(GT)10117–13859KT005775
R: TGTCATTCTTTACTTTGTTCTCATTCA
NSB73aF: GGAGAGGAGTGAGTGGAGTGA(CTT)8142–22160KT005776
R: CAGGCTGTTCAACTATCTTGC
NSB113aF: TTGTGATAAATAAAGGTGCAACTCA(AGT)678–12354KT005777
R: CATTGCCCGTGATAAGCTCT
NSB122aF: CAAAGTGTTTGTGAATTGCTTC(AC)9169–19859KT005778
R: GCAATGAGGAGCTTATGAATTAAC
NSB143aF: CTGTTTCTTTGTTCTGCACATT(GAA)7244–26959KT005779
R: TCCCAAAATTGCTTCTGAGC
NSB182aF: TTGTATTATACGTTGTTCTGGGGA(AC)12115–12158KT005780
R: GAGATGCTGACACGCAAACT
NSB232aF: CTCCACTTTGGTTGAATCCC(CT)9110–11863KT005781
R: GACTACCTCCTATTCTAAATGCCA
NSB253aF: GAGGATTACTGTAGCCAATTCCA(GTT)6100–14056KT005782
R: GGACTACAAGATGGCTTCCA
NSB263aF: CGAAGGAGGAGTCTTGGAAA(GAA)694–13160KT005783
R: GAGCAAACTCCTGGCTGAAG
NSB272aF: GGTTCTGCCGATGGACTAAT(CT)9122–14660KT005784
R: TTATCACATCCAACGGTTTGC
NSB23bF: TTCACCCTCAACTTTTAAAACCA(AAC)11146–16451KU300963
R: TGCTTTTGTTACATCCATAACG
NSB32bF: GCCCCACCAAAATAGAGAAA(AG)11106–12148KU300964
R: TCTGGATTTTATTTCCACCCC
NSB33bF: ACCTCACTATCTCCCAAAATGC(CTT)1087–9351KU300965
R: CCTCTTCTTCAAAATTAGCCAAA
NSB82bF: CATCATATTCATGGATGCCAA(TC)1010854KU300966
R: TGACAACACAATGAGCGAGTT
NSB152bF: GTGGACAAAAGGGGTAGCTG(TC)8250–25860KU300967
R: GCAAGAGAAGCTCTTCTTTCACTT
NSB273bF: TGGAAGATGAACCCTTACCA(AAG)5291–31063KU300968
R: GGAAGTGTCATTTGACCATAACA
NSB282bF: TGTGCATTAATTCTCTAATCCCT(TC)9104–11051KU300969
R: AAATTAATGTAGCGTTTCTTCATCA
NSB322bF: ATTCTAGAAGATATGATTTGATTTGGA(TC)7286–30058KU300970
R: TTGGCCGAGCTATACAATATG

Note: Ta = annealing temperature.

Marker selected; size range values based on 312–317 individuals (see Table 2).

Marker not selected; size range values based on seven individuals (see Methods and Results section).

Table 2.

Summary statistics of the chosen 11 microsatellites based on 312–317 hoop-petticoat daffodil samples.

LocusNo. successfully genotypedTotal no. of allelesNo. of alleles per individualAlleles per individual (mean ± SE)HoAllelic diversityProportion of null genotypes
NSB14317190–41.227 (± 0.039)0.2310.7840.121
NSB52314110–31.404 (± 0.028)0.2430.7990.002
NSB73314210–41.185 (± 0.025)0.1350.7400.022
NSB11331781–31.243 (± 0.022)0.1540.5610.000
NSB122317110–41.202 (± 0.023)0.1410.7310.011
NSB14331280–31.125 (± 0.021)0.1110.7180.027
NSB18231741–31.350 (± 0.025)0.2240.4540.000
NSB23231751–31.180 (± 0.022)0.1010.2790.000
NSB253317120–31.259 (± 0.029)0.2420.8420.064
NSB263314111–31.268 (± 0.023)0.1730.6650.000
NSB272317101–41.483 (± 0.029)0.2970.7660.000

Note: Ho = observed heterozygosity; SE = standard error.

Characteristics of 19 microsatellite loci developed for Narcissus sect. Bulbocodii. Note: Ta = annealing temperature. Marker selected; size range values based on 312–317 individuals (see Table 2). Marker not selected; size range values based on seven individuals (see Methods and Results section). Summary statistics of the chosen 11 microsatellites based on 312–317 hoop-petticoat daffodil samples. Note: Ho = observed heterozygosity; SE = standard error. PCR amplifications were performed as single reactions according to the previously detailed cycling conditions. The PCR products were combined for multiplex fragment analysis. Unambiguously identifying microsatellite alleles in polyploids can be challenging, as identifying stutter peaks in samples of unknown ploidy is difficult and can lead to inclusion of noise in a data set. To avoid this, alleles were scored according to the MANUAL 8 scoring routine described by Pfeiffer et al. (2011). Moreover, as the allele dosage of polyploids is unknown, traditional population genetic techniques (e.g., deviation from Hardy–Weinberg equilibrium) cannot readily be applied. Therefore, we used a presence-absence scoring of peaks to estimate polymorphism, similar to a dominant marker (e.g., amplified fragment length polymorphism [AFLP]) data set. The number of alleles per locus ranged from four to 21, the observed heterozygosity (Ho) ranged from 0.101 to 0.297, and allelic diversity (calculated as: , where p is the frequency with which the ith allele was detected) ranged from 0.279 to 0.842. In addition to the allelic variation, there were null genotypes for six of the markers, with frequency ranging from 0.002 to 0.121, confirmed by repeating PCR amplifications. The presence of null genotypes was expected due to incomplete transferability of these markers in section Bulbocodii. However, in a presence-absence data set these are valuable characters that allow samples with a null-allele data set for some individual markers to be included. Two populations each of the most widely sampled species (N. bulbocodium L. [CAT, ALD], N. cantabricus DC. [SDF, HOR], and N. romieuxii Braun-Blanq. & Maire [KET, OUL]) were used to calculate genotypic diversity estimators (Table 3). The total number of different alleles per population across all loci (A) ranged from 26 to 42, the number of private alleles per population across all loci (Ap) was between zero and three, proportion of observed heterozygotes averaged per locus (Ho) was from 0.19 to 0.35, proportion of null genotypes carried by each individual averaged across all loci (Fg0) ranged from 0 to 0.21, and the genotypic richness was 0.94 or 1 (calculated as: R = G − 1/N − 1; where G is the number of multilocus genotypes and N is the number of genotyped samples; Dorken and Eckert, 2001).
Table 3.

Results of initial genotypic variability screening among populations of Narcissus sect. Bulbocodii.

PopulationNAApHoFg0GR
N. bulbocodium
 CAT204220.220.064201
 ALD183930.320.21181
N. cantabricus
 SDF182800.230170.94
 HOR172600.190160.94
N. romieuxii
 KET164010.350161
 OUL124000.310121

Note: A = total number of different alleles across all loci; Ap = number of private alleles across all loci; Fg0 = proportion of null genotypes carried by each individual averaged across all loci; G = number of multilocus genotypes; Ho = proportion of observed heterozygotes per loci; N = number of individuals; R = genotypic richness.

Results of initial genotypic variability screening among populations of Narcissus sect. Bulbocodii. Note: A = total number of different alleles across all loci; Ap = number of private alleles across all loci; Fg0 = proportion of null genotypes carried by each individual averaged across all loci; G = number of multilocus genotypes; Ho = proportion of observed heterozygotes per loci; N = number of individuals; R = genotypic richness. Broader transferability of these markers was tested using 18 species belonging to seven of the nine (Blanchard, 1990) other Narcissus sections. The success of the transfer was assessed using fragment analysis. The 11 markers were all transferable to other Narcissus sections to some degree, ranging from 39% to 100% (Table 4).
Table 4.

Transferability of the chosen 11 microsatellite loci in 18 Narcissus species.

SectionSpeciesNSB14NSB52NSB73NSB113NSB122NSB143NSB182NSB232NSB253NSB263NSB272
Apodanthi A. Fern.N. cuatrecasasii Fern. Casas, M. Laínz & Ruíz Rejón+++++++++++
N. rupicola Dufour++++++++++
N. scaberulus Henriq.++++++++
Aurelia (Gay) BakerN. broussonetii Lag.++++++
Braxireon (Raf.) ValdésN. cavanillesii (Cav.) Barra & G. López+++++++++
Ganymedes (Haw.) Shult. f.N. triandrus L.+++++++++++
Jonquillae DC.N. assoanus Dufour++++++++++
N. jonquilla L.++++++++++
N. viridiflorus Schousb.++++++++++
Pseudonarcissi DC.N. asturiensis Pugsley++++++++
N. hispanicus Gouan+++++++++
N. lobularis Schult. f.++++++++++
N. perez-chiscanoi Fern. Casas+++++++++
N. segurensis S. Ríos, D. Rivera, Alcaraz & Obón+++++++++
N. yepesii S. Ríos, D. Rivera, Alcaraz & Obón++++++++++
Tazettae DC.N. dubius Gouan+++++++++++
N. elegans (Haw.) Spach++++++
N. papyraceus Ker Gawl.++++
Percentage transferability (%)896139948378831007294100

Note: + = successful fragment analysis; — = unsuccessful fragment analysis.

Transferability of the chosen 11 microsatellite loci in 18 Narcissus species. Note: + = successful fragment analysis; — = unsuccessful fragment analysis.

CONCLUSIONS

The microsatellite markers developed in this study are sufficiently variable to allow species-level and population-level variation of hoop-petticoat daffodils to be investigated. The markers show potential to be used to develop molecular identification tools for daffodil cultivars, and to contribute toward the taxonomic revision of section Bulbocodii. The high degree of transferability suggests that these markers have the potential to distinguish many Narcissus cultivars in most sections of the genus.
Appendix 1.

Voucher information and geographic location of Narcissus sect. Bulbocodii samples. All voucher specimens are deposited at the University of Reading Herbarium (RNG), Reading, United Kingdom.

PopulationSpeciesNCountryGPS coordinatesVoucher no.
AGEN. romieuxii Braun-Blanq. & Maire4Morocco32°55′N, 5°32′WKK#016
AINLN. romieuxii5Morocco33°23′N, 5°15′WKK#015
AKEN. bulbocodium L.2Spain42°43′N, 8°42′WBD#1001
ALDN. bulbocodiuma19Spain39°17′N, 6°18′WKK#023
ALMN. cantabricus DC.a17Spain36°52′N, 4°32′WKK#021
AMAN. romieuxii3Morocco31°13′N, 8°01′WKK#001
BD13-7N. bulbocodium1Spain40°37′N, 4°02′WBD#1102
BD13-8N. bulbocodium1Spain40°44′N, 4°01′WBD#1101
CATN. bulbocodiumb20Spain42°40′N, 8°43′WKK#027
HORN. cantabricus17Spain38°34′N, 6°05′WKK#022
HUEN. hedraeanthus Colmeiro subsp. luteolentus (Barra & G. López) Aedoa13Spain38°28′N, 3°46′WKK#019
IDAN. cantabricus10Morocco30°44′N, 9°20′WKK#003
JD11-1N. bulbocodiuma1Spain39°02′N, 4°32′WJDES#1101
JD11-10N. cantabricus1Spain38°28′N, 4°04′WJDES#1110
N. ×litigiosus Amo1Spain38°28′N, 4°04′WJDES#1111
JD11-14N. hedraeanthus subsp. luteolentus1Spain38°23′N, 3°27′WJDES#1114
N. ×cazorlanus Fern. Casas1Spain38°23′N, 3°27′WJDES#1115
JD11-16N. ×cazorlanus1Spain38°27′N, 3°19′WJDES#1116
JD11-17N. hedraeanthus subsp. luteolentus2Spain38°31′N, 2°46′WJDES#1117
JD11-19N. bulbocodium1Spain40°24′N, 1°26′WJDES#1119
JD11-20N. bulbocodiuma1Portugal40°16′N, 8°02′WJDES#1120
JD11-3N. bulbocodiuma1Spain39°01′N, 4°33′WJDES#1103
N. ×fosteri Lynch2Spain39°01′N, 4°33′WJDES#1104
JD11-7N. ×fosteria1Spain39°07′N, 4°33′WJDES#1107
JD11-8N. bulbocodium1Spain38°38′N, 4°05′WJDES#1108
N. cantabricus1Spain38°38′N, 4°05′WJDES#1109
JD12-8N. hedraeanthus subsp. hedraeanthus1Spain37°50′N, 3°03′WJDES#1208
JOAN. bulbocodium10Portugal39°29′N, 8°50′WJA#01
JTAZN. romieuxii10Morocco34°03′N, 4°08′WKK#012
JTIZN. romieuxii7Morocco35°00′N, 4°53′WKK#007
KETN. romieuxiib16Morocco34°57′N, 4°40′WKK#008
LEUHN. romieuxii5Morocco33°25′N, 5°12′WKK#014
MOUSSN. romieuxiib8Morocco33°07′N, 5°47′WKK#017
NORN. bulbocodiuma11Portugal40°37′N, 8°10′WKK#026
OULN. romieuxii12Morocco33°22′N, 6°00′WKK#018
OURN. bulbocodium10Morocco31°20′N, 7°45′WKK#002
PORN. obesus Salisb.a14Spain37°12′N, 7°04′WKK#024
RIFN. cantabricus7Morocco35°01′N, 4°09′WKK#010
SDAN. obesus9Portugal38°27′N, 9°01′WKK#025
SDFN. cantabricus19Spain37°14′N, 2°16′WKK#020
TAFRN. bulbocodium4Morocco29°43′N, 8°50′WKK#006
TANN. cantabricus13Morocco30°44′N, 9°21′WKK#004
TARQN. cantabricus8Morocco34°58′N, 4°23′WKK#009
THARN. cantabricus4Morocco34°40′N, 4°12′WKK#011
THEON. bulbocodium1Spain37°10' N; 7°43' WTS#01
TIGN. cantabricusb13Morocco29°32′N, 9°21′WKK#005
VN. bulbocodiuma2Spain42°40′N, 7°15′WKK#028
ZEKAN. romieuxii5Morocco34°03′N, 4°09′WKK#013

Note: N = number of individuals.

Population used in initial variability screening.

Two individuals used from the same population in initial variability screening.

Appendix 2.

Voucher information of samples from the living hoop-petticoat daffodil (Narcissus sect. Bulbocodii) collection at University of Reading (RNG), Reading, United Kingdom.

SpeciesAccession no.N
N. bulbocodiumSJ001999a1
N. cantabricusSJ205971
N. romieuxiiBD96/1981
N. ‘Golden Bells’GB_Wb1

Note: N = number of individuals.

Sample used in initial variability screening.

Sourced from Walkers Bulbs, Spalding, United Kingdom.

  4 in total

1.  QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

Authors:  Emese Meglécz; Caroline Costedoat; Vincent Dubut; André Gilles; Thibaut Malausa; Nicolas Pech; Jean-François Martin
Journal:  Bioinformatics       Date:  2009-12-10       Impact factor: 6.937

2.  High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries.

Authors:  Thibaut Malausa; André Gilles; Emese Meglécz; Hélène Blanquart; Stéphanie Duthoy; Caroline Costedoat; Vincent Dubut; Nicolas Pech; Philippe Castagnone-Sereno; Christophe Délye; Nicolas Feau; Pascal Frey; Philippe Gauthier; Thomas Guillemaud; Laurent Hazard; Valérie Le Corre; Brigitte Lung-Escarmant; Pierre-Jean G Malé; Stéphanie Ferreira; Jean-François Martin
Journal:  Mol Ecol Resour       Date:  2011-02-21       Impact factor: 7.090

3.  Characterization of microsatellite loci and reliable genotyping in a polyploid plant, Mercurialis perennis (Euphorbiaceae).

Authors:  Tanja Pfeiffer; Anna M Roschanski; John R Pannell; Grazyna Korbecka; Martin Schnittler
Journal:  J Hered       Date:  2011-05-16       Impact factor: 2.645

4.  High throughput, high resolution selection of polymorphic microsatellite loci for multiplex analysis.

Authors:  Nicholas C Cryer; David R Butler; Mike J Wilkinson
Journal:  Plant Methods       Date:  2005-08-18       Impact factor: 4.993

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.