Shi-Bin Jiang1, Xu-Jun He2, Ying-Jie Xia2, Wei-Jian Hu3, Jun-Gang Luo1, Jun Zhang4, Hou-Quan Tao5. 1. Department of Surgery, Zhejiang Provincial People's Hospital, Hangzhou, People's Republic of China; Wenzhou Medical University, Wenzhou, People's Republic of China. 2. Department of Surgery, Zhejiang Provincial People's Hospital, Hangzhou, People's Republic of China; Key Laboratory of Gastroenterology of Zhejiang Province, Zhejiang Provincial People's Hospital, Hangzhou, Zhejiang, People's Republic of China. 3. Wenzhou Medical University, Wenzhou, People's Republic of China. 4. Wenzhou Medical University, Wenzhou, People's Republic of China; Key Laboratory of Gastroenterology of Zhejiang Province, Zhejiang Provincial People's Hospital, Hangzhou, Zhejiang, People's Republic of China. 5. Department of Surgery, Zhejiang Provincial People's Hospital, Hangzhou, People's Republic of China; Wenzhou Medical University, Wenzhou, People's Republic of China; Key Laboratory of Gastroenterology of Zhejiang Province, Zhejiang Provincial People's Hospital, Hangzhou, Zhejiang, People's Republic of China.
Abstract
MicroRNA (miR)-145-5p has been reported to function as a suppressor of cancer and plays an important role in cancer invasiveness. Epithelial-mesenchymal transition (EMT) is an important process in cancer invasion and migration. However, the involvement of miR-145-5p in EMT in human gastric cancer (GC) remains unclear. In this study, we aimed to investigate the molecular mechanisms by which miR-145-5p regulates EMT in GC invasiveness. We used quantitative real-time polymerase chain reaction to investigate the miR-145-5p expression level in GC and matched normal tissues. The effects of miR-145-5p on GC cell invasion and migration abilities were evaluated using Transwell models. The relationships among miR-145-5p and zinc-finger E-box binding homeobox 2 (ZEB2), E-cadherin, and N-cadherin were analyzed by quantitative real-time polymerase chain reaction and Western blot analyses. miR-145-5p levels in primary GC tissues obtained from 60 patients were significantly downregulated, compared to those in paired normal tissues. Lauren classification, depth of tumor invasion, lymph node metastasis, lymphatic invasion, and tumor-node-metastasis stage were associated with miR-145-5p expression. miR-145-5p inhibits the expression of the candidate target gene ZEB2 to delay the invasion and migration of GC cells. ZEB2 acts as transcriptional repressor of E-cadherin, while miR-145-5p is known to suppress N-cadherin directly to regulate EMT. Therefore, we concluded that miR-145-5p may target N-cadherin and ZEB2 directly to influence EMT.
MicroRNA (miR)-145-5p has been reported to function as a suppressor of cancer and plays an important role in cancer invasiveness. Epithelial-mesenchymal transition (EMT) is an important process in cancer invasion and migration. However, the involvement of miR-145-5p in EMT in humangastric cancer (GC) remains unclear. In this study, we aimed to investigate the molecular mechanisms by which miR-145-5p regulates EMT in GC invasiveness. We used quantitative real-time polymerase chain reaction to investigate the miR-145-5p expression level in GC and matched normal tissues. The effects of miR-145-5p on GC cell invasion and migration abilities were evaluated using Transwell models. The relationships among miR-145-5p and zinc-finger E-box binding homeobox 2 (ZEB2), E-cadherin, and N-cadherin were analyzed by quantitative real-time polymerase chain reaction and Western blot analyses. miR-145-5p levels in primary GC tissues obtained from 60 patients were significantly downregulated, compared to those in paired normal tissues. Lauren classification, depth of tumor invasion, lymph node metastasis, lymphatic invasion, and tumor-node-metastasis stage were associated with miR-145-5p expression. miR-145-5p inhibits the expression of the candidate target gene ZEB2 to delay the invasion and migration of GC cells. ZEB2 acts as transcriptional repressor of E-cadherin, while miR-145-5p is known to suppress N-cadherin directly to regulate EMT. Therefore, we concluded that miR-145-5p may target N-cadherin and ZEB2 directly to influence EMT.
Gastric cancer (GC) is one of the most common malignancies of the digestive system in People’s Republic of China.1,2 The majority of GC deaths are caused by cancer cell invasion and metastasis.3 However, the underlying mechanisms of cancer cell invasion and migration in GC progression remain unclear and further elucidation of the molecular mechanisms underlying these processes is urgently required to improve treatment and prolong survival in patients with advanced GC.MicroRNAs (miRs) are small noncoding RNAs, which act as posttranscriptional regulators of gene expression during tumor development and carcinogenesis.4,5 A series of studies have shown that numerous miRs influence the capacity for invasion, migration, and proliferation of cancer cells in GC.5,6 miR-145-5p has been reported as a tumor suppressor in several types of tumors, such as colon,7,8 breast,9 and prostate cancers.10 Furthermore, previous studies have shown that miR-145-5p is downregulated in GC and may function as a suppressor gene.11 However, the mechanisms by which miR-145-5p inhibits GC, especially by suppressing epithelial–mesenchymal transition (EMT) to inhibit GC metastasis, have not yet been reported.EMT plays a key role in cancer cell invasion and migration during the development and progression of cancer and metastasis. The concept of EMT was proposed by Greenburg and Hay early in 198212 and refers to the loss of polarity and connections between epithelial cells and the acquisition of an interstitial cell phenotype under the influence of a number of factors. The cells then gain the ability to migrate.13 During the progression of EMT, downregulation of adhesion molecules, such as E-cadherin, and upregulation of mesenchymal markers, such as N-cadherin, decrease epithelial cell–cell adhesion and promote cancer cell invasion and migration.Gao et al14 identified the N-cadherin gene as a direct target of miR-145-5p, which is upregulated in GC. Accumulating evidence indicates that zinc-finger E-box binding homeobox 2 (ZEB2) is a candidate target gene of miR-145-5p and acts as an EMT-inducing transcription factor, promoting invasion and migration in many tumors.15–19 Searches of the miRBase Targets, TargetScan Release 5.0 (http://www.targetscan.org/), and PicTar databases and previous reports implicated ZEB2 as the candidate target gene of miR-145-5p in GC. Thus, we speculated that miR-145-5p inhibits metastasis of GC cells by targeting ZEB2, although the specific mechanism remains to be clarified. In this present study, we confirmed that miR-145-5p inhibits GC cell invasion and metastasis through directly targeting N-cadherin and ZEB2 to suppress EMT. Moreover, we investigated the correlation between miR-145-5p expression levels in GC tissues and clinicopathologic parameters.
Materials and methods
Patients and tissue samples
All fresh clinical tissue samples were collected with the written informed consent of 60 patients who underwent gastric resection at the Department of Gastrointestinal Surgery in the People’s Hospital of Zhejiang Province (People’s Republic of China) from 2012 to 2014. None of the patients received chemotherapy prior to surgery. The tumor pathological type was diagnosed by three independent pathologists, and the matched normal gastric epithelial tissues, which were collected from more than 5 cm away from the tumors, were also verified at the same time. The project was approved by the ethics committee of Zhejiang Provincial People’s Hospital.
Cell culture
The human GC cell lines (BGC-823, SGC-7901, MKN-45, AGS, and GES-1) were purchased from the Cell Bank of Shanghai Institute of Cell Biology (Shanghai, People’s Republic of China) and cultured in Roswell Park Memorial Institute 1640 (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (Sigma-Aldrich Co., St Louis, MO, USA) at 37°C under a humidified atmosphere containing 5% CO2.
Cell transfection
AGS and SGC-7901 cells (1×105 per well) were seeded in six-well plates. After 24 hours, the cells were transfected with an miR-145-5p mimic, an miR-145-5p mimic negative control, an miR-145-5p inhibitor, or an miR-145-5p inhibitor negative control (Ribo Bio, Guangzhou, People’s Republic of China), using Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, Waltham, MA, USA) and following the manufacturer’s protocol. After transfection, the cells were collected for future examination and the effects of miR-145-5p transfection were determined by quantitative real-time polymerase chain reaction (qRT-PCR) at 24 hours posttransfection.
RNA isolation, reverse transcription, and qRT-PCR
Total RNA was isolated from the tissue samples and GC cells using TRIzol reagent (Thermo Fisher Scientific). RNA concentration and purity were determined using Nanodrop 2000 (Thermo Fisher Scientific). Reverse transcription was performed using the One-step PrimeScript miRNA cDNA synthesis kit (D350A; TaKaRa Biotechnology [Dalian] Co., Ltd., Dalian, People’s Republic of China). qRT-PCR was carried out on the MX3000P system (Stratagene, La Jolla, CA, USA) using gene-specific primers with the SYBR Premix ExTaq kit (DRR081A; TaKaRa Biotechnology [Dalian] Co., Ltd.) to detect the expression levels of miR-145-5p, ZEB2, E-cadherin, and N-cadherin. All reactions were performed in triplicate. U6 (RNU6B) or glyceraldehyde 3-phosphate dehydrogenase was used as an internal standard for normalization of miR-145-5p, ZEB2, E-cadherin, and N-cadherin expression levels.The primers of candidate genes were designed using Primer 5.0 software (PREMIER Biosoft International, Palo Alto, CA, USA), and are listed in Table 1. Melting curve analysis was carried out at the end of the PCR cycles to confirm the most suitable amplification condition. The qPCR conditions were as follows: initial denaturation (4 minutes at 95°C) and then 40 cycles of denaturation at 95°C for 10 seconds, annealing at the appropriate temperature for 30 seconds (specific temperatures are shown in Table 1), and extension at 72°C for 30 seconds. The melting curve settings were as follows: 95°C for 1 minute, 55°C for 30 seconds, 95°C for 30 seconds. The fluorescence signal was continuously acquired per 0.1°C from 55°C to 95°C. The relative expression levels were calculated using the 2−ΔΔct method.
Table 1
Sequence of primers used in this study
Name
Sequence (5′→3′)
Annealing temperatures (°C)
miR-145-5p
GTCCAGTTTTCCCAGGAATCCCT
60
RNU6B
CGCTTCACGAATTTGCGTGTCAT
60
GAPDH
Forward TGAAGGTCGGAGTCAACGG
55–60
Reverse TGGAAGATGGTGATGGGATT
ZEB2
Forward GAAGATGAAATAAGGGAGGG
60
Reverse CTGGGTAAATAATGGCTGTG
E-cadherin
Forward CGAGAGCTACACGTTCACGG
56
Reverse GGGTGTCGAGGGAAAAATAGG
N-cadherin
Forward TGCGGTACAGTGTAACTGGG
60
Reverse GAAACCGGGCTATCTGCTCG
IRS-1
Forward CTGCACAACCGTGCTAAGG
59
Reverse CGTCACCGTAGCTCAAGTCC
FSCN1
Forward CCAGGGTATGGACCTGTCTG
58
Reverse GTGTGGGTACGGAAGGCAC
c-Myc
Forward TCCCTCCACTCGGAAGGAC
55
Reverse CTGGTGCATTTTCGGTTGTTG
Ets-1
Forward GATAGTTGTGATCGCCTCACC
60
Reverse GTCCTCTGAGTCGAAGCTGTC
In vitro cell migration and invasion assays
The migration assay was performed with Transwell plates (3422; Corning Incorporated, Corning, NY, USA) containing a membrane with 8 μm pores. Cell invasion assays were performed using invasion chambers (354480; BD, Franklin Lakes, NJ, USA) precoated with Matrigel. Cells (2×105 for invasion assays and 5×104 cells for migration assays) were resuspended in serum-free medium and seeded into the upper chamber. Culture medium containing 20% fetal bovine serum was added to the lower chamber as the chemoattractant. The cells were incubated in a humidified incubator at 37°C for 24 hours (migration assays) or 36 hours (invasion assays). Noninvading cells in the upper chambers were removed with cotton swabs. The cells attached to the lower surface were fixed and stained. The number of cells which attached to the lower surface was counted in five random fields under a microscope (×200).
Western blotting
Western blot analysis was performed according to the protocol provided by the manufacturer (Bio-Rad Laboratories Inc., Hercules, CA, USA). Briefly, protein was extracted from cells using radio immunoprecipitation assay (RIPA) lysis buffer (Beyotime, Shanghai, People’s Republic of China). Each sample was separated on a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (6%–10% gel) and then transferred onto polyvinylidene difluoride membranes. The polyvinylidene difluoride membranes were blocked with 5% nonfat milk for 2 hours and then incubated with primary rabbit antihuman antibodies for detection of N-cadherin (EPR1791-4 at 1/5,000 dilution; Abcam, San Francisco, CA, USA), E-cadherin (EP700Y at 1/10,000 dilution; Abcam), and ZEB2 (SC-271984 at 1/500 dilution; Santa Cruz Biotechnology Inc., Dallas, TX, USA) overnight at 4°C. The membranes were incubated with a horseradish peroxidase-labeled goat antirabbit IgG antibody for 1 hour. After washing (×4) with Tris-Buffered Saline and Tween 20 Buffer (TBST), the bands were developed using an enhanced chemiluminescence system (GE Healthcare UK Ltd, Little Chalfont, UK). Relative protein expression was normalized to β-actin.
Statistical analyses
All statistical analyses were performed using Statistical Package for the Social Sciences version 13.0 (SPSS Inc., Chicago, IL, USA). Data are presented as mean ± standard deviation. The means of normally distributed data were compared by either paired sample t-tests or two independent samples t-tests as appropriate. If the results were not normally distributed, Wilcoxon test was used as appropriate. Analysis of variance followed by a posttest was used to assess the different expression levels of miR-145-5p in gastric cell lines. Chi-square or Fisher’s exact test was used to assess the statistical significance of the association between miR-145-5p and clinicopathologic parameters. A P-value of <0.05 was considered to indicate statistical significance.
Results
miR-145-5p is downregulated in GC tissues and cell lines
miR-145-5p expression in GC tissues was significantly downregulated compared with that in matched normal tissues (Figure 1). Analysis of the expression of miR-145-5p in four human GC cell lines and a normal cell line (GES-1) yielded the following pattern of expression levels: GES-1 > SGC-7901 > BGC-823 > MKN-45 > AGS (Figure 2). Also, miR-145-5p expression was decreased in all four cancer cell lines compared with that in GES-1, with the highest and lowest levels detected in SGC-7901 and AGS, respectively. These two cell lines were, therefore, selected for use in transfection experiments.
Figure 1
qRT-PCR analysis of miR-145-5p expression in GC tissues.
Notes: miR-145-5p expression was lower in 60 GC tissue samples than in the pair-matched adjacent normal tissues (P<0.05). Each sample was analyzed in triplicate and normalized to the endogenous control RNU6B. Data represent the mean ± SD of three individual experiments.
qRT-PCR analysis of miR-145-5p expression in GC cell lines.
Notes: The relative miR-145-5p expression in GC cell lines was much lower than that in the normal control cell line, GES-1. The pattern of expression levels was GES-1 > SGC-7901 > BGC-823 > MKN-45 > AGS. Analysis of variance followed by a posttest indicated significantly lower miR-145-5p expression levels in AGS, SGC-7901, MKN-45, and BGC-823, compared with those in GES-1 (all P<0.05). The relative expression of miR-145-5p was normalized to the endogenous control RNU6B. Data represent the mean ± SD of three individual experiments.
Correlation between miR-145-5p expression level and clinicopathologic factors
There was a significant difference in miR-145-5p expression levels between GC tissues and matched normal tissues (3.63±0.67 vs 6.62±0.73) (Figure 1). The miR-145-5p expression levels in GC tissues and normal tissues were evaluated with receiver operating characteristic curve analysis (y-axis, sensitivity; x-axis, [1 − specificity]), and a cut-off value (1.785) was set as the maximum (sensitivity + specificity). Then the expression value that provided the best accuracy was identified and the tumor specimens were classified based on this cut-off into low-expression and high-expression groups. The results showed that low miR-145-5p expression level was significantly related to tumor depth, lymph node metastasis, lymphatic invasion, and tumor–node–metastasis (TNM) stage (Table 2).
Table 2
miR-145-5p expression and clinicopathologic factors of gastric cancer
Factor
High expression (n=14)
Low expression (n=46)
P-value
Age, years
<60
7
22
0.887
≥60
7
24
Sex
Male
12
41
0.727
Female
2
5
Lauren classification
Intestinal type
2
30
0.001*
Diffuse type
12
16
Tumor diameter (cm)
<5
7
27
0.565
≥5
7
19
Depth of tumor invasion
m, sm, mp
10
7
0.00004*
s, se, si
4
39
Lymph node metastasis
Yes
3
35
0.0002*
No
11
11
Venous invasion
Yes
2
8
0.785
No
12
38
Lymphatic invasion
Yes
4
34
0.002*
No
10
12
Neural invasion
Yes
3
10
0.98
No
11
36
Distant metastasis
Yes
1
6
0.547
No
13
40
TNM stage
I
6
7
0.042*
II
5
10
III
2
23
IV
1
6
Note:
P<0.05.
Abbreviations: m, tumor invasion of mucosa; miR, microRNA; mp, muscularis propria; s, subserosa; se, penetration of serosa; si, invasion of serosa; sm, submucosa; TNM, tumor–node–metastasis.
miR-145-5p suppresses GC cell migration and invasion in vitro
The AGS cell line, expressing relatively low levels of miR-145-5p, was transfected with an miR-145-5p mimic or a negative control. qRT-PCR analysis confirmed that transfection with the miR-145-5p mimic resulted in significant overexpression of miR-145-5p (Figure 3A). As expected, miR-145-5p overexpression significantly suppressed AGS cell migration and invasion ability (P<0.05) (Figure 3B).
Figure 3
(A) miR-145-5p expression in AGS cells transfected with an miR-145-5p mimic was increased, compared with the negative control. miR-145-5p expression in SGC-7901 cells transfected with an miR-145-5p inhibitor was decreased, compared with that in the negative control (*P<0.05). The relative expression of miR-145-5p was normalized to the endogenous control RNU6B. Data represent the mean ± SD of three individual experiments. (B and C) Transwell assay of miR-145-5p. (B) AGS GC cells transfected with an miR-145-5p mimic showed reduced migration and invasion activity, compared with the negative control (*P<0.05). (C) SGC-7901 GC cells transfected with an miR-145-5p inhibitor showed increased migration and invasion activity, compared with the negative control (*P<0.05). Data represent the mean ± SD of three individual experiments.
The SGC-7901 cell line, expressing relatively high levels of miR-145-5p, was also transfected with an miR-145-5p inhibitor or a negative control. qRT-PCR analysis confirmed that transfection with the miR-145-5p inhibitor resulted in significantly reduced expression of miR-145-5p (Figure 3A). The invasion and migration capacity of SGC-7901 cells was significantly increased following transfection with the miR-145-5p inhibitor compared with the inhibitor negative control (P<0.05) (Figure 3C). These results confirmed that miR-145-5p suppresses the invasion and migration ability of GC cells.
miR-145-5p inhibits N-cadherin, ZEB2, and EMT to suppress the invasion and metastatic capacity of GC cells
To investigate the possible mechanisms by which miR-145-5p suppresses GC cell invasiveness and EMT, we identified a list of candidate target genes of miR-145-5p, such as IRS-1, FSCN-1, Ets-1, ZEB2, and c-Myc, by searching the miRBase Targets, TargetScan Release 5.0, and PicTar databases, as well as previous reports. The expression of these genes was screened by qRT-PCR in GC cells transfected with an miR-145-5p mimic or inhibitor. In GC cells transfected with miR-145-5p mimic or inhibitor, the changes in ZEB2 expression levels were inversely correlated with miR-145-5p and E-cadherin levels. However, the expression levels of other candidate genes were not correlated with miR-145-5p expression in GC lines (Figure S1). These data indicated that ZEB2 may be a candidate target gene of miR-145-5p involved in the regulation of E-cadherin expression.Furthermore, qRT-PCR and Western blot analyses showed obvious downregulation of N-cadherin in AGS cells transfected with the miR-145-5p mimic (Figures 4 and 5), while N-cadherin was upregulated in SGC-7901 cells transfected with the miR-145-5p inhibitor compared with the corresponding negative control (Figures 4 and 5).
Figure 4
miR-145-5p inhibited N-cadherin and ZEB2 expression and enhanced E-cadherin expression.
Notes: (A) AGS GC cells transfected with an miR-145-5p mimic exhibited a significant reduction in ZEB2 expression, compared to those transfected with the miR-145-5p mimic negative control. (B) SGC-7901 GC cells transfected with an miR-145-5p inhibitor showed a significant increase in ZEB2 expression, compared to those transfected with the miR-145-5p inhibitor negative control. (C) AGS GC cells transfected with an miR-145-5p mimic exhibited a significant increase in E-cadherin expression, compared to those transfected with the miR-145-5p mimic NC. (D) SGC-7901 gastric cancer cells transfected with an miR-145-5p inhibitor showed a significant reduction in E-cadherin expression, compared to those transfected with the miR-145-5p inhibitor negative control. (E) AGS GC cells transfected with an miR-145-5p mimic exhibited a significant reduction in N-cadherin expression, compared to those transfected with the miR-145-5p mimic negative control. (F) SGC-7901 GC cells transfected with an miR-145-5p inhibitor showed a significant increase in N-cadherin expression, compared to those transfected with the miR-145-5p inhibitor negative control (*P<0.05). Each sample was analyzed in triplicate and normalized to the endogenous control GAPDH. Data represent the mean ± SD of three individual experiments.
Notes: ZEB2 expression was downregulated in AGS cells transfected with an miR-145-5p mimic and upregulated in SGC-7901 cells transfected with an miR-145-5p inhibitor. E-cadherin expression was upregulated in AGS cells transfected with an miR-145-5p mimic and downregulated in SGC-7901 cells transfected with an miR-145-5p inhibitor. N-cadherin expression was downregulated in AGS cells transfected with an miR-145-5p mimic and upregulated in SGC-7901 cells transfected with an miR-145-5p inhibitor.
In this study, qRT-PCR and Western blot analyses confirmed that ZEB2 expression was significantly decreased, while E-cadherin expression was significantly increased in AGS cells transfected with the miR-145-5p mimic, compared to those transfected with the corresponding negative control (NC) (Figures 4 and 5). Opposite patterns of ZEB2 and E-cadherin were detected in SGC-7901 cells transfected with the miR-145-5p inhibitor (Figures 4 and 5). These data indicated that miR-145-5p is an important regulator of the candidate target gene ZEB2, leading to regulation of E-cadherin expression.
Discussion
miRNAs have been reported to function as oncogene or cancer suppressors in many tumors.5 Approximately one-third of human genes may be regulated by miRNAs, and each miRNA can act on hundreds of target genes.20 Recent studies have indicated that many miRNAs influence GC invasion and metastasis by targeting specific genes and signaling pathways.21 For example, miR-199-5p is upregulated in GC and promotes cell migration and invasion by targeting klotho.22 miR-10b promotes migration and invasion through Hoxd10 in human GC.23 Low miR-145-5p has been reported in many cancer types such as colon,7,8 breast,9 prostate,17 and ovarian.24 In addition, many miR-145-5p target genes have been reported, such as p70S6K1 and IRS-1 in colon cancer,8,25 ER-α and RTKN in breast cancer,9,26 ZEB2 and DAB2 in prostate cancer,17,27 and p70S6K1 and MUC1 in ovarian cancer.28 miR-145-5p also acts as a suppressor in GC by targeting genes such as IRS-1, FSCN-1, N-cadherin, and Ets-1.11,14,29–31 For example, Zheng et al31 showed that miR-145-5p targets the 3′-untranslated region of Ets-1 directly, and Ets-1 further regulates the expression of multiple genes, such as MMP1, MMP9, and u-PA, to suppress the invasive and metastatic capacity of GC cells.32 In this study, we confirmed that miR-145-5p is downregulated in GC tissues, compared with that in adjacent normal tissues. miR-145-5p is significantly related to Lauren classification, depth of tumor invasion, lymph node metastasis, lymphatic invasion, and TNM stage. Thus, further elucidation of the molecular mechanisms by which miR-145-5p affects GC invasion and migration is important.Increasing attention is now focused on the signaling pathways involved in tumor progression. miRNAs are also known to be involved in regulation of the signaling pathways that influence the invasion and migration of tumor cells. For example, Zhang et al33 found that miR-199 overexpression inhibits SMAD4 gene expression in GC cells, which, in turn, influences cell proliferation and metastasis via the transforming growth factor-beta signaling pathway. Invasion and metastasis are important factors that influence the progression of advanced GC and recurrence after surgery. EMT has an important role in invasion and migration of GC cells, processes which involve multiple molecular mechanisms and levels of gene regulation.34 Loss of epithelial cell polarity and the acquisition of mesenchymal characteristics are important features of EMT, which are accompanied by changes in epithelial cell and mesenchymal cell markers.13 Recent studies have confirmed the close relationship between miRNAs and the EMT signaling pathway in regulating the invasive and metastatic ability of tumor cells.17 Using luciferase assays and Western blot analysis, Gao et al14 showed that the N-cadherin gene is a direct target of miR-145-5p. In the present study, miR-145-5p upregulation in GC cells also reduced N-cadherin expression, while miR-145-5p downregulation in GC cells had the opposite effect, which is consistent with previous research. However, immunohistochemistry studies by Kamikihara et al35 showed only a 21% N-cadherin positive expression rate in GC tissues, indicating the existence of other molecular mechanisms by which miR-145-5p regulates the EMT signaling pathway in GC.Ren et al17 identified ZEB2 as a target gene of miR-145-5p in prostate cancer, and showed that ZEB2 regulates E-cadherin to influence EMT. E-cadherin, which is the key epithelial cell marker, plays an important role in cancer cell EMT17,36,37 and represents a candidate biomarker in evaluating the metastatic potential of GC.38,39 ZEB2 acts as transcriptional repressor of E-cadherin through binding the E-BOX sequence in the E-cadherin promoter, leading to downregulation of E-cadherin expression, thereby inducing EMT.16,40 Genetic screening indicates that ZEB2 is the candidate target gene of miR-145-5p in relation to E-cadherin–induced GC cell invasion and migration. In our study, qRT-PCR and Western blot analyses confirmed that ZEB2 expression was significantly decreased and E-cadherin expression was increased in GC cells transfected with miR-145-5p mimic, compared to those transfected with the corresponding negative control. In contrast, the opposite pattern of expression was observed following transfection with miR-145-5p inhibitor in GC cells. These observations indicate a significant inverse relationship between miR-145-5p levels and ZEB2 expression, as well as a positive correlation between miR-145-5p levels and E-cadherin.A number of limitations of this study should be noted. The sample size is small, and no statistically significant correlation was identified between miR-145-5p expression and patient survival. Our findings indicate that miR-145-5p regulates EMT by direct suppression of N-cadherin and indirect induction of E-cadherin expression through ZEB2. The proposed relationships between miR-145-5p and ZEB2, E-cadherin, and N-cadherin during the regulation of EMT are shown in Figure 6. However, our findings also indicate the existence of other pathways that regulate EMT. Further research into the molecular mechanisms of GC invasion and migration will aid in early prediction, prognostic analysis, and the guidance of treatment. Furthermore, miR-145-5p and its downstream EMT signaling pathways are implicated as new targets for the prevention and treatment of GC.
Figure 6
Schematic representation of the interconnections between miR-145-5p, ZEB2, E-cadherin, and N-cadherin in the regulation of epithelial-to-mesenchymal transition.
In the present study, we confirmed that miR-145-5p inhibits GC cell invasion and metastasis through directly targeting N-cadherin and ZEB2 to suppress EMT. As a suppressor gene in primary GC, miR-145-5p was associated with Lauren classification, depth of tumor invasion, lymph node metastasis, lymphatic invasion, and TNM stage.The expression of these genes was screened by qRT-PCR in GC cells transfected with an miR-145-5p mimic or inhibitor.Notes: The expression levels of these candidate genes were not correlated with miR-145-5p expression in GC lines (all P>0.05). Each sample was analyzed in triplicate and normalized to the endogenous control GAPDH. Data represent the mean ± SD of three individual experiments.Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GC, gastric cancer; miR, microRNA; qRT-PCR, quantitative real-time polymerase chain reaction; SD, standard deviation; NC, negative control.
Authors: E Batlle; E Sancho; C Francí; D Domínguez; M Monfar; J Baulida; A García De Herreros Journal: Nat Cell Biol Date: 2000-02 Impact factor: 28.824
Authors: Jun Lu; Gad Getz; Eric A Miska; Ezequiel Alvarez-Saavedra; Justin Lamb; David Peck; Alejandro Sweet-Cordero; Benjamin L Ebert; Raymond H Mak; Adolfo A Ferrando; James R Downing; Tyler Jacks; H Robert Horvitz; Todd R Golub Journal: Nature Date: 2005-06-09 Impact factor: 49.962
Authors: Michael Z Michael; Susan M O' Connor; Nicholas G van Holst Pellekaan; Graeme P Young; Robert J James Journal: Mol Cancer Res Date: 2003-10 Impact factor: 5.852
Authors: Jung Won Lee; Nayoung Kim; Ji Hyun Park; Hee Jin Kim; Hyun Chang; Jung Min Kim; Jin-Wook Kim; Dong Ho Lee Journal: J Cancer Prev Date: 2017-03-30