Literature DB >> 27090402

Does typing of Chlamydia trachomatis using housekeeping multilocus sequence typing reveal different sexual networks among heterosexuals and men who have sex with men?

Bart Versteeg1, Sylvia M Bruisten1,2, Arie van der Ende2,3, Yvonne Pannekoek4,5.   

Abstract

BACKGROUND: Chlamydia trachomatis infections remain the most common bacterial sexually transmitted infection worldwide. To gain more insight into the epidemiology and transmission of C. trachomatis, several schemes of multilocus sequence typing (MLST) have been developed. We investigated the clustering of C. trachomatis strains derived from men who have sex with men (MSM) and heterosexuals using the MLST scheme based on 7 housekeeping genes (MLST-7) adapted for clinical specimens and a high-resolution MLST scheme based on 6 polymorphic genes, including ompA (hr-MLST-6).
METHODS: Specimens from 100 C. trachomatis infected men who have sex with men (MSM) and 100 heterosexual women were randomly selected from previous studies and sequenced. We adapted the MLST-7 scheme to a nested assay to be suitable for direct typing of clinical specimens. All selected specimens were typed using both the adapted MLST-7 scheme and the hr-MLST-6 scheme. Clustering of C. trachomatis strains derived from MSM and heterosexuals was assessed using minimum spanning tree analysis.
RESULTS: Sufficient chlamydial DNA was present in 188 of the 200 (94 %) selected samples. Using the adapted MLST-7 scheme, full MLST profiles were obtained for 187 of 188 tested specimens resulting in a high success rate of 99.5 %. Of these 187 specimens, 91 (48.7 %) were from MSM and 96 (51.3 %) from heterosexuals. We detected 21 sequence types (STs) using the adapted MLST-7 and 79 STs using the hr-MLST-6 scheme. Minimum spanning tree analyses was used to examine the clustering of MLST-7 data, which showed no reflection of separate transmission in MSM and heterosexual hosts. Moreover, typing using the hr-MLST-6 scheme identified genetically related clusters within each of clusters that were identified by using the MLST-7 scheme.
CONCLUSION: No distinct transmission of C. trachomatis could be observed in MSM and heterosexuals using the adapted MLST-7 scheme in contrast to using the hr-MLST-6. In addition, we compared clustering of both MLST schemes and demonstrated that typing using the hr-MLST-6 scheme is able to identify genetically related clusters of C. trachomatis strains within each of the clusters that were identified by using the MLST-7 scheme.

Entities:  

Keywords:  Chlamydia trachomatis; High-resolution genotyping; MLST; MSM; Multilocus sequence typing; Sexually transmitted infections

Mesh:

Substances:

Year:  2016        PMID: 27090402      PMCID: PMC4836166          DOI: 10.1186/s12879-016-1486-2

Source DB:  PubMed          Journal:  BMC Infect Dis        ISSN: 1471-2334            Impact factor:   3.090


Background

Despite intensive efforts to reduce the spread of chlamydial infections, Chlamydia trachomatis remains the primary cause of bacterial sexually transmitted diseases worldwide [1]. These C. trachomatis infections can result in serious sequelae including epididymitis and pelvic inflammatory disease, leading to infertility in women and possibly also in men [2-4]. Molecular epidemiological studies are essential to understand the genetic population structure and to gain insight into the transmission of C. trachomatis [5, 6]. Until recently, the epidemiology of C. trachomatis was based on serotyping of the major outer membrane protein (MOMP) or sequence analysis of its encoding gene ompA. However, typing based on the ompA-gene only is not recommended as typing method for C. trachomatis, as whole-genome-sequencing (WGS) data revealed that it is an unstable and unreliable target due to extensive recombination [7]. Numerous sets of WGS data have become available for a variety of bacterial isolates including C. trachomatis [7]. Unfortunately, due to the complex intracellular lifecycle of C. trachomatis it remains technically challenging to perform WGS directly on clinical specimens. Instead, several multilocus sequence typing (MLST) schemes were successfully developed and validated to gain insight into the epidemiology and transmission of C. trachomatis [8-11]. An advantage of using MLST schemes to type C. trachomatis strains, is that it is a standardized and portable method to index variation among strains, which can easily be used in different laboratories on a global basis since it yields robust data [12-14]. In previous studies a clear separation of C. trachomatis strain types was seen for specimens derived from men who have sex with men (MSM) and from heterosexuals as defined by a high-resolution MLST scheme based on 6 polymorphic genes, including ompA (herein referred to as hr-MLST-6) [11, 15–17]. The hr-MLST-6 scheme was specifically designed for short-term epidemiology and outbreak investigations and was intended to be highly discriminating. In contrast, another MLST scheme was designed based on 7 housekeeping genes (herein referred to as MLST-7) [9]. The slow rate of molecular evolution within these housekeeping genes makes the MLST-7 scheme useful to answer evolutionary questions and to investigate the epidemiology of C. trachomatis over a longer time-frame. A limitation of the published MLST-7 scheme is that it consists of single PCRs, which has a decreased sensitivity making it less suitable for typing of C. trachomatis strains from direct clinical specimens and is therefore not applicable for large population studies. Typing of C. trachomatis using the MLST-7 scheme is therefore often dependent on an additional culture step possibly leading to biased study outcomes. Moreover, it is unknown whether the clear separation in transmission of C. trachomatis strain types for specimens derived from MSM and from heterosexuals can also be seen using the MLST-7 scheme. The objective of this study was therefore to: (1) adapt the MLST-7 scheme to a nested assay to be suitable for direct typing of clinical specimens without the need for an additional cell culture step, (2) determine whether separate C. trachomatis transmission in MSM and from heterosexual hosts could also be seen using the MLST-7 scheme and (3) compare clustering of the C. trachomatis strain types according to both MLST schemes.

Methods

Clinical specimen selection

For this retrospective analysis, C. trachomatis-positive specimens and data were selected from a previous study [17]. All specimens and data were matched on sexgroup and a random selection was made using SPSS 21 (SPSS Inc., Chicago, IL, USA). In total, 100 specimens from MSM and 100 specimens from heterosexual women were selected. Rectal swab specimens from MSM were collected between July 2008 and August 2009. C. trachomatis-positive urogenital swab specimens from heterosexual women were collected between December 2011 and December 2012.

Ethics

The STI outpatient clinic of the Public Health Service of Amsterdam, the Netherlands uses an opting-out approach to recruit clients for scientific research. All clients of the STI clinic are notified that remainders of samples may be used for scientific research, after anonymisation and de-identification of client clinical data and samples. If clients objected, data and samples are discarded. Therefore, no additional informed consent was obtained for this study. This procedure was approved by the Medical Ethical Committee of the Academic Medical Center of the University of Amsterdam, the Netherlands (reference number W14-200 # 14.17.0247).

DNA Extraction and amplification

For DNA extraction 200 μl swab-containing transport medium of specimens that tested positive in a screening assay (Aptima combo TMA test, Hologic/Gen-Probe, San Diego, California, USA) was added to 500 μl lysis buffer (bioMérieux, Boxtel, the Netherlands), 1 μg glycogen (10 mg/ml; Roche Diagnostics, Almere, the Netherlands). DNA was subsequently precipitated by adding 700 μl of ice-cold isopropanol. The DNA precipitate was washed twice with 70 % ethanol and dissolved in 50 μl 10 mM Tris-buffer (pH 8.0). These DNA isolates were stored at −20 °C until further use. Extracted DNA was tested to indicate the load of chlamydial DNA using an in-house pmpH real time PCR [11, 16, 17]. For DNA specimens that tested pmpH negative, DNA was re-extracted from the original Aptima C. trachomatis positive specimens and retested. All specimens that repeatedly tested negative for the pmpH target were excluded.

Primer selection for adaptation of MLST-7

Primers were designed and a nested PCR assay was developed to enable direct testing of clinical samples. MLST-7 regions were analyzed in silico using the Chlamydiales MLST database (http://pubmlst.org/chlamydiales/) Comparison of all available C. trachomatis sequences from the MLST database demonstrated that shortening of the original amplicons for 5 out of the 7 genes (gatA, oppA_3, hflX, gidA and fumC) to perform nested PCR would not result in loss of resolution as no known polymorphic sites for C. trachomatis were found in these ‘deleted’ regions. Therefore, new ‘inner’ PCR primers were designed for these 5 genes (Table 1). For two other genes (hemN and enoA) the original amplicon was extended to prevent loss of resolution and known polymorphic sites. Therefore, new ‘outer’ PCR primers were designed, thus the same inner PCR product was obtained as published previously (Table 1) [9].
Table 1

Primers used for the MLST-7 scheme for Chlamydia trachomatisa

RegionLocus tagb FormatDirectionSequence (5′ to 3′)5′ positionc Fragment length (bp)d
gatA CT0003 Outer Forward GCTTTAGAATTARSARAWGCT 2123325
Outer Reverse GATCCTCCGGTATCYGATCC 2615
Inner + SeqForwardATGACGAACAGATTGGAGC2186
Inner + SeqReverseGGATTATTGGTAGGATGAA2532
oppA_3 CT0198 Outer Forward ATGCGCAAGATATCAGTGGG 222438480
Outer Reverse AAAGCTCCRSTWGMTATMGGWAG 223002
Inner + SeqForwardTCCTAGCATTAGCAACTTCT222469
Inner + SeqReverseTCTTTCCGTATCTGATGCTGCG222970
hflX CT0379 Outer Forward GCTTCTARAGTACTTTTAAATG 432737359
Outer Reverse TATTTRGAAATYTTTKCSAGYCG 432758
Inner + SeqForwardAAGTATGCGGAAGTTTGCG432768
Inner + SeqReverseAATCAGGAGGTAGTGGTGGAGG433106
gidA CT0498 Outer Forward GGAGTCWCTACWAAAGAAGG 577352389
Outer Reverse TCGTAYTGYACATCRAAAGG 577892
Inner + SeqForwardACTTCTCTGGGGGACGATT577449
Inner + SeqReverseGACCGTTCACATAAACTTCTTG577856
enoA CT0587OuterForwardGCAAATACTTTACAGAGACCTT662222388
OuterReverseCGTCACAAATAGGTCGTCTC662775
Inner + Seq Forward CCTATGATGAATCTKATCAATGG 662288
Inner + Seq Reverse TCTTCTTCGGCTAGCCCATCT 662698
hemN CT0746OuterForwardGAATCTTGCCTTTCACAGTTGC867674448
OuterReverseACTTCCACATCCCATTCTGC868584
Inner + Seq Forward AGATCTTCTTCWGGRGGWAGAGA 867799
Inner + Seq Reverse TTCYTTCAKAACSTAGGTTTT 868269
fumC CT0855 Outer Forward ATTAAAAAATGTGCTGCT 1004691451
Outer Reverse CCTTCAGGAACATTYAACCC 1005242
Inner + SeqForwardATTAAAAAATGTGCTGCT1004691
Inner + SeqReverseCCGCTCTAAACAATTATGCAACTG1005159

aThe primers given in boldface were the original MLST primers taken from Pannekoek et al. [9]. All other primers were newly designed. Nested PCRs were performed for each region. The primers used for the outer PCRs are indicated with Outer, those used for the inner PCRs are indicated with Inner, and those used for sequencing are indicated with Seq

bLocus tags are given relative to the sequence of reference strain D/UW-3/CX (GenBank accession no. AE001273)

cPositions are given in base pairs relative to the sequence of reference strain D/UW-3/CX (GenBank accession no. AE001273)

dFragment length is the number of base pairs sequenced with the primers excluded

Primers used for the MLST-7 scheme for Chlamydia trachomatisa aThe primers given in boldface were the original MLST primers taken from Pannekoek et al. [9]. All other primers were newly designed. Nested PCRs were performed for each region. The primers used for the outer PCRs are indicated with Outer, those used for the inner PCRs are indicated with Inner, and those used for sequencing are indicated with Seq bLocus tags are given relative to the sequence of reference strain D/UW-3/CX (GenBank accession no. AE001273) cPositions are given in base pairs relative to the sequence of reference strain D/UW-3/CX (GenBank accession no. AE001273) dFragment length is the number of base pairs sequenced with the primers excluded

Nested PCR of MLST regions

For MLST-7, DNA extracts were amplified by nested PCR for all regions using the oligonucleotide primers shown in Table 1. Full hr-MLST-6 data was already available for all specimens from previous studies [17]. Also for this typing method a nested PCR was used to amplify the regions ompA, CT046 (hctB), CT058, CT144, CT172, and CT682 (pbpB). For both MLST schemes the inner PCR was performed with M13-tagged primers, identical to the standard inner primers. This allowed sequencing using universal M13 primers for high throughput purposes [11, 16, 17].

Sequencing analysis

The obtained sequences were analysed, assembled and trimmed using BioNumerics 7.5 (Applied Maths, Sint-Martens-Latem, Belgium). For MLST-7, cleaned primer-to-primer sequences were checked against the Chlamydiales MLST database (http://pubmlst.org/chlamydiales/). For hr-MLST-6, analysis was performed as described previously [17]. In brief, cleaned primer-to-primer sequences were checked against the Chlamydia trachomatis hr-MLST database (http://mlstdb.bmc.uu.se/).

Minimum spanning tree analysis

BioNumerics software (version 7.5, Applied Maths, Sint-Martens-Latem, Belgium) was used to construct a minimum spanning tree of fully typed specimens using STs of each of the MLST schemes. As algorithm we used the predefined template ‘Minimum spanning tree for categorical data’ plugin to generate an minimum spanning tree under the categorical coefficient of similarity and the priority rule of the highest number of single-locus variants (SLV), which calculates a standard minimum spanning tree. A large cluster was defined as a group of genetically related STs differing by not more than 1 locus from another ST within that group (SLV) and it had to include at least 5 % of the total number of specimens. Clusters containing less then 5 % of the total number of specimens were defined as small clusters.

Results

C. trachomatis typing using the MLST-7 scheme

Although in 188 of 200 C. trachomatis-positive specimens (94.0 %), sufficient chlamydial DNA was present, as assessed by qPCR, no amplicons were obtained using the MLST scheme, primers and cycle conditions as were previously described [9], indicating relative low sensitivity of the method. We therefore adapted the MLST-7 scheme to a nested assay and, using this adapted MLST-7 scheme, for 187 (93.5 %) specimens full MLST-7 profiles were obtained. Of these 187 typed specimens, 91 (48.7 %) specimens were from MSM and 96 (51.3 %) specimens were from heterosexuals (Additional file 1: Table S1). For the 187 fully typed specimens, we found 7 novel allele sequences: 3 for oppA_3, 1 for gidA, 1 for enoA, and 2 for hemN. Among the 187 typed specimens, 21 unique MLST-7 STs could be assigned of which 18 (85.7 %) were novel to the Chlamydiales MLST database (http://pubmlst.org/chlamydiales/). Novel STs were found in 125 of 187 specimens (66.8 %). Of all identified STs, 8 (38.1 %) had multiple representatives (2 to 52 isolates) while 13 (61.9 %) were found in only a single isolate each (Table 2). Moreover, 4 STs (ST97, ST132, ST133, ST134; 19.0 %) were found in specimens from both MSM and heterosexuals and 6 STs (ST44, ST97 ST132, ST133, ST137, ST142; 28.6 %) were associated with multiple (2 to 5) ompA genovars (Table 2).
Table 2

Results of C. trachomatis using the MLST-7 scheme based on seven housekeeping genes in comparison with ompA-typing and sexgroup

Sequence typeNumber of strains gatA oppA_3 hflX gidA enoA hemN fumC Cluster ompA genovar (Number of strains)Sexgroupa (number of strains)
812112423BF (1)Hetero (1)
441813332219CL2 (1), L2b (17)MSM (18)
974233122423BD (24), E(1), F(17)Hetero (17), MSM (25)
10612325323AJ (1)Hetero (1)
1311332724323AG (1)MSM (1)
1325233324323AG (26), H (1), I (10), J (13), K(2)Hetero (13), MSM (39)
1332633112423BD (3), E (21), F (2)Hetero (20), MSM (6)
134233112323BF (2)Hetero (1), MSM (1)
1351933412423BE (19)Hetero (19)
1361133325323AB (1), D (2), G (4), J (4)Hetero (11)
1371333240323AG (1)Hetero (1)
1381332912423BE (1)Hetero (1)
1391331123223BE (1)Hetero (1)
140133324313AG (1)Hetero (1)
141433325313AD (3), I (1)Hetero (4)
1421334132423BE (1)Hetero (1)
1431333253253AK (1)Hetero (1)
1441333253243AG (1)Hetero (1)
1451333242423AH (1)Hetero (1)
14612412423BF (1)Hetero (1)
1471332824323AJ (1)MSM (1)

a Hetero heterosexual, MSM men who have sex with men

Results of C. trachomatis using the MLST-7 scheme based on seven housekeeping genes in comparison with ompA-typing and sexgroup a Hetero heterosexual, MSM men who have sex with men

C. trachomatis typing using hr-MLST-6 scheme

Full hr-MLST-6 profiles were available for the 187 C. trachomatis-positive specimens that were also successfully typed using the adapted MLST-7 scheme (Additional file 2: Table S2). The hr-MLST-6 data from the 187 C. trachomatis-positive specimens have been described before in more detail [11, 15–17]. In brief, among the 187 typed specimens, 79 unique hr-MLST-6 STs could be assigned of which 22 (27.8 %) had multiple representatives (2 to 18 isolates) while 57 (72.2 %) were found in only a single isolate each (Table 3). Of all identified STs, 3 (ST12d, ST56a, ST90; 3.8 %) were found in specimens from both MSM and heterosexuals (Table 3).
Table 3

Results of C. trachomatis typing using the hr-MLST-6 scheme based on six polymorphic genes in comparison with ompA-typing and sexgroup

Sequence typeNumber of strains ompA CT046CT058CT144CT172CT682Cluster ompA genovar (number of strains)Sexgroupa (number of strains)
310612622VIIE (10)Hetero (10)
11315197210D (3)MSM (3)
16167191421VIE (1)Hetero (1)
27191061016G (1)Hetero (1)
30112107138K (1)MSM (1)
32112107148K (1)Hetero (1)
3368108536IIG (6)MSM (6)
35321081417D (3)Hetero (3)
52178208536IIG (17)MSM (17)
5916719721VIE (1)Hetero (1)
6916519622E (1)Hetero (1)
74130881718B (1)Hetero (1)
90224519114IVF (2)Hetero (1), MSM (1)
10113638512718IIII (1)Hetero (1)
1091815205234VD (18)MSM (18)
11012412724IVF (1)Hetero (1)
137181082246G (1)Hetero (1)
1431284413171328VIIIL2b (1)MSM (1)
153263519721VIE (2)Hetero (2)
165135125198H (1)Hetero (1)
171264919721VIE (2)Hetero (2)
1721612722VIIE (1)Hetero (1)
19431565234VD (3)MSM (3)
2322205191418J (2)Hetero (2)
2401245191214IVF (1)Hetero (1)
265110104137G (1)Hetero (1)
270181051238G (1)Hetero (1)
272136105122418IIII (1)Hetero (1)
2881810822757G (1)Hetero (1)
30118208516IIG (1)MSM (1)
303182085334IIG (1)MSM (1)
30418208546IIG (1)MSM (1)
30516252622VIIE (1)Hetero (1)
3072532985358IJ (2)MSM (2)
3181145205234VD (1)MSM (1)
3241155205234VD (1)MSM (1)
338166727260E (1)Hetero (1)
341167057721E (1)Hetero (1)
345253748536IJ (2)MSM (2)
35318818536IIG (1)MSM (1)
395128341317D (1)Hetero (1)
43519861016G (1)Hetero (1)
44816121122VIIE (1)Hetero (1)
44916119111E (1)Hetero (1)
450124119724IVF (1)Hetero (1)
453161197211VIE (1)Hetero (1)
459165196212E (1)Hetero (1)
462165197256E (1)Hetero (1)
465165197142E (1)Hetero (1)
4661245197214IVF (1)Hetero (1)
482191061018G (1)Hetero (1)
484137107135I (1)Hetero (1)
4981624191421VIE (1)Hetero (1)
502164519612E (1)Hetero (1)
504164719721VIE (1)Hetero (1)
50916712122VIIE (1)Hetero (1)
51016712622VIIE (1)Hetero (1)
513267119721VIE (2)Hetero (2)
51616519522E (1)Hetero (1)
51723638512318IIII (2)Hetero (2)
100b33610512718IIII (3)Hetero (3)
100c13710512718IIII (1)Hetero (1)
108c953298536IJ (9)MSM (9)
12d1324519714IVF (13)Hetero (12), MSM (1)
135a12010512418IIIJ (1)Hetero (1)
135b23610512418IIII (2)Hetero (2)
13b1245191514IVF (1)Hetero (1)
148a224519724IVF (2)Hetero (1), MSM (1)
205b1201062248J (1)Hetero (1)
20a121041417D (1)Hetero (1)
220a112104138K (1)Hetero (1)
281a1201081418J (1)Hetero (1)
281b1631081418J (1)Hetero (1)
56a96119721VIE (9)Hetero (7), MSM (2)
58a1222713171328VIIIL2 (1)MSM (1)
58b16282713171328VIIIL2b (16)MSM (16)
77b1315197237D (1)Hetero (1)
91a124519524IVF (1)MSM (1)
97b1351251198H (1)Hetero (1)

a Hetero heterosexual, MSM men who have sex with men

Results of C. trachomatis typing using the hr-MLST-6 scheme based on six polymorphic genes in comparison with ompA-typing and sexgroup a Hetero heterosexual, MSM men who have sex with men

Minimum spanning tree analysis of the MLST-7 scheme and the hr-MLST-6 scheme

A minimum spanning tree was generated based on the MLST-7 STs and 3 large clusters (A-C) could be identified (Fig. 1a). The number of specimens in these clusters ranged from 18 to 94 and included all typed specimens so no single isolates (singletons) or small clusters were identified. The minimum spanning tree showed mixed clusters of specimens from MSM and heterosexual individuals and a low genetic diversity among the C. trachomatis population. Cluster A contained 41 specimens from MSM (54.7 %) that were associated with 3 STs (Table 2). Two of those STs (ST131, ST148) were found in one MSM specimen each, whereas the remaining ST (ST132) was found in specimens from 52 individuals of whom 39 (75.0 %) where MSM. Cluster B contained 32 specimens from MSM (34.0 %) that were associated with 3 STs (ST97, ST133, ST134). Of those, ST97 was found in 42 specimens from individuals of whom 25 (59.5 %) were MSM, ST133 was found in specimens from 26 individuals of whom 6 were MSM and ST134 was found in specimens from 2 individuals of whom 1 was MSM. Cluster C solely consisted of specimens from MSM which were all associated with the same ST (ST44).
Fig. 1

Minimum spanning tree showing the clustering of 187 Chlamydia trachomatis-positive specimens from MSM and heterosexuals. Each circle represents one ST. Size of the circles is proportional to the number of identical ST profiles. Bold lines connect types that differ for one single locus. Halos indicate the distinct clusters. a Minimum spanning tree showing the clustering of the C. trachomatis-positive specimens according to the MLST-7 scheme; b Minimum spanning tree showing the clustering of the C. trachomatis-positive specimens according to the hr-MLST-6 scheme. The colour coding is: red, men who have sex with men (n = 91); green, heterosexuals (n = 96)

Minimum spanning tree showing the clustering of 187 Chlamydia trachomatis-positive specimens from MSM and heterosexuals. Each circle represents one ST. Size of the circles is proportional to the number of identical ST profiles. Bold lines connect types that differ for one single locus. Halos indicate the distinct clusters. a Minimum spanning tree showing the clustering of the C. trachomatis-positive specimens according to the MLST-7 scheme; b Minimum spanning tree showing the clustering of the C. trachomatis-positive specimens according to the hr-MLST-6 scheme. The colour coding is: red, men who have sex with men (n = 91); green, heterosexuals (n = 96) A minimum spanning tree was also generated basted on the hr-MLST-6 STs and 8 large clusters (I-VIII) were identified (Fig. 1b). These clusters ranged from 13 to 27 specimens comprising 80.2 % of all specimens. The remaining 37 specimens were distributed over 20 singletons and 6 small clusters, ranging from 2 to 4 specimens. The minimum spanning tree showed a clear distinction between specimens from MSM and heterosexual individuals and high genetic diversity among the C. trachomatis population especially for strains from heterosexuals, as was also previously described by us [11, 15–17]. Of the 8 large clusters, 4 (III, IV, VI and VII) consisted predominantly of specimens from heterosexuals (82.6 to 100 %) whereas the other 4 large clusters (I, II, V and VIII) solely consisted of specimens from MSM (Table 3). Of the 4 clusters (III, IV, VI and VII) consisting predominantly of specimens from heterosexuals, only 2 clusters (IV and VI) contained MSM specimens. Cluster IV contained 4 specimens from MSM (17.4 %) that were associated with 4 STs (ST12d, ST90, ST91a). Of those 4 STs, ST12d was found in specimens from 13 individuals of whom 1 was MSM, ST90 was found in specimens from 2 individuals of whom 1 was MSM and ST91a was found in only one MSM specimen. Cluster VI contained 2 specimens from MSM which were associated with 1 ST (ST56a). This ST was found in specimens from 9 individuals of whom 2 were MSM. Comparison of the two minimum spanning trees in Fig. 1 shows that the hr-MLST-6 scheme further diversified each of the clusters generated by using the adapted MLST-7 scheme. For example cluster A (11 STs; Fig. 1a) is subdivided into clusters I, II, and III, using the hr-MLST-6 scheme, and also the majority of the singletons and small clusters (Fig. 2) comprising 37 STs. Cluster B (9 STs; Fig. 1a) is further subdivided into clusters IV, V, VI, VII and some remaining singletons and small clusters (Fig. 2) comprising 39 STs. Cluster C (1 ST; Fig. 1a) is identical to cluster VIII (Figs. 1b and 2) but included 3 STs.
Fig. 2

Minimum spanning tree showing the diversification by hr-MLST-6 of the clusters that were generated using the MLST-7 scheme. Each circle represents one ST. Size of the circles is proportional to the number of identical ST profiles. Bold lines connect types that differ for one single locus. Halos indicate the distinct clusters. Colours indicate the MLST-7 clusters from Fig. 1a: blue, cluster A (n = 75); orange, cluster B (n = 94); fuchsia, cluster C (n = 18)

Minimum spanning tree showing the diversification by hr-MLST-6 of the clusters that were generated using the MLST-7 scheme. Each circle represents one ST. Size of the circles is proportional to the number of identical ST profiles. Bold lines connect types that differ for one single locus. Halos indicate the distinct clusters. Colours indicate the MLST-7 clusters from Fig. 1a: blue, cluster A (n = 75); orange, cluster B (n = 94); fuchsia, cluster C (n = 18)

Discussion

In this study, we successfully adapted the MLST-7 scheme to a nested assay and applied it to direct clinical specimens. Moreover, we demonstrated that using this adapted MLST-7 scheme no reflection of separate transmission between MSM and heterosexual hosts was seen. In addition, we compared clustering of both typing methods and demonstrated that typing using the hr-MLST-6 scheme is able to identify small genetically related clusters of C. trachomatis strains within each of the clusters that were identified by using the modified MLST-7 scheme (Fig. 2). These clusters seem to represent biovars. We successfully modified the MLST-7 scheme that was previously published by us [9]. The sensitivity of the MLST-7 method was increased by modification into a nested PCR format. This nested PCR format allowed detection of many novel sequence types because we were now able to test direct clinical specimens without the need for an additional cell culture step. In total, 187 of 188 samples could be fully typed using the modified MLST-7 scheme resulting in a high success rate of 99.5 %. Failure to generate an MLST-7 profile for one out of 188 samples after repeated testing is most likely the result of an insufficient amount of chlamydial DNA in this sample as it produced the highest cycling threshold value in the pmpH real time PCR. The discriminatory capacity of the original MLST-7 scheme was maintained as no known polymorphic sites for C. trachomatis were lost due to shortening of some of the amplicons. Moreover for two genes (hemN and enoA) the amplicon was extended because new ‘outer’ PCR primers were designed which ensured that the same inner PCR product was obtained as published previously [9]. Designing ‘inner’ PCR primers for these two genes would have resulted in very short amplicons and loss of resolution as known polymorphic sites would have been lost. The maximum target length in our assay format was 480 bp, which allowed easy sequence analysis from single PCR fragments. It is unlikely that polymorphisms were missed by our adapted MLST-7 scheme. Even if there were so far unknown missed polymorphisms, we think that these would not dramatically increase the genetic diversity using the adapted MLST-7 scheme. The MLST-7 scheme was developed according to the original MLST principle [13, 18, 19], which aims to index the diversity of nucleotide sequences of fragments of housekeeping genes. Housekeeping genes are presumed to be under neutral or nearly neutral selection pressure making them stable over time, which makes this method useful to answer evolutionary questions and to investigate the epidemiology of C. trachomatis over a longer period in time [18]. In comparison, the hr-MLST-6 scheme uses non-housekeeping genes that are under immune pressure or have variable repeat regions and are thus more polymorphic [11, 16]. This enabled us to demonstrate detailed genetic differences between C. trachomatis strains that were involved in transmission chains in human hosts in a short time-frame of only a few years [11, 15–17]. However, using the adapted MLST-7 scheme no reflection of separate transmission networks between MSM and heterosexual hosts was seen. Minimum spanning tree analysis of the MLST-7 scheme showed mixed clusters of specimens from MSM and heterosexual individuals with the exception of one cluster (Fig. 1a; cluster C) which solely included specimens from MSM. All these cluster C C. trachomatis specimens belonged to the lymphogranuloma venereum (LGV) biovar, which is known to show major genetic differences compared to the urogenital biovar types [20-23]. These results suggest that separate transmission chains in human hosts can only be observed over a small time-frame using highly discriminating genetic typing methods. Transmission chains between MSM and heterosexuals were not totally separated in our previous studies with larger trees, including randomly chosen samples [15-17]. This overlap was expected since there will also be individuals who identify themselves as MSM, but have had contact with heterosexual women (Fig. 1b). Comparison of the clustering of both MLST schemes showed that both MLST schemes were able to resolve the C. trachomatis specimens in a number of STs and clusters. Minimum spanning tree analysis using data from the adapted MLST-7 scheme revealed 3 main groups of circulating C. trachomatis strains (Fig. 1), as was also previously described by us using the original MLST-7 scheme [9]. One group is composed solely of the LGV genovars. Another is composed of the clinically prevalent urogenital genovars, whereas the third contains the less frequently occurring urogenital genovars. Similar groupings are reported in previous studies using WGS analysis or MLST analysis based on housekeeping genes [7, 9, 10]. In comparison to MLST-7, minimum spanning tree analysis of the hr-MLST-6 scheme was able to further diversify each of these 3 main groups and clusters of circulating C. trachomatis strains in smaller genetically related clusters and thus allowed for more detailed analysis within these groups (Fig. 2). Using maximum likelihood analysis, we previously demonstrated that the hr-MLST-6 targets provided a tree similar to trees based on WGS, but with lower bootstrap support values [12]. Since we already observed clear differences in the diversification of strains between the MLST-7 and hr-MLST-6 scheme (Fig. 1), a similar tree based on the MLST-7 targets is expected to differ from a tree based on WGS by showing less genetic diversity.

Conclusions

We successfully adapted and applied the MLST-7 scheme to direct clinical specimens from MSM and heterosexuals. However, using this adapted MLST-7 scheme no distinct transmission of C. trachomatis could be observed in MSM and heterosexuals in comparison to the hr-MLST-6 scheme. In addition, we also compared clustering of both MLST schemes and demonstrated that typing using the hr-MLST-6 scheme is able to identify genetically related clusters of C. trachomatis strains within each of the clusters that were identified by using the MLST-7 scheme. Hr-MLST-6 may therefore also be a useful tool to for more detailed analysis of C. trachomatis strains within identified MLST-7 clusters.

Availability of data and materials

Data on all 187 samples typed with both the hr-MLST-6 en MLST-7 scheme are included in Additional file 1: Table S1 and Additional file 2: Table S2. Corresponding nucleotide sequences can be derived from the publicly available databases: http://mlstdb.bmc.uu.se/ (hr-MLST-6) and http://pubmlst.org/chlamydiales/ (MLST-7).
  22 in total

Review 1.  Risk of sequelae after Chlamydia trachomatis genital infection in women.

Authors:  Catherine L Haggerty; Sami L Gottlieb; Brandie D Taylor; Nicola Low; Fujie Xu; Roberta B Ness
Journal:  J Infect Dis       Date:  2010-06-15       Impact factor: 5.226

2.  Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms.

Authors:  M C Maiden; J A Bygraves; E Feil; G Morelli; J E Russell; R Urwin; Q Zhang; J Zhou; K Zurth; D A Caugant; I M Feavers; M Achtman; B G Spratt
Journal:  Proc Natl Acad Sci U S A       Date:  1998-03-17       Impact factor: 11.205

3.  Evaluation of high-resolution typing methods for Chlamydia trachomatis in samples from heterosexual couples.

Authors:  Reinier J M Bom; Linus Christerson; Maarten F Schim van der Loeff; Roel A Coutinho; Björn Herrmann; Sylvia M Bruisten
Journal:  J Clin Microbiol       Date:  2011-06-08       Impact factor: 5.948

4.  Characterisation of Chlamydia trachomatis by ompA sequencing and multilocus sequence typing in a Swedish county before and after identification of the new variant.

Authors:  Margaretha Jurstrand; Linus Christerson; Markus Klint; Hans Fredlund; Magnus Unemo; Björn Herrmann
Journal:  Sex Transm Infect       Date:  2009-10-16       Impact factor: 3.519

Review 5.  Epidemiology of Chlamydia trachomatis infection in women and the cost-effectiveness of screening.

Authors:  J A Land; J E A M Van Bergen; S A Morré; M J Postma
Journal:  Hum Reprod Update       Date:  2009-10-14       Impact factor: 15.610

6.  Chlamydia public health programs and the epidemiology of pelvic inflammatory disease and ectopic pregnancy.

Authors:  Michael L Rekart; Mark Gilbert; Rafael Meza; Paul H Kim; Michael Chang; Deborah M Money; Robert C Brunham
Journal:  J Infect Dis       Date:  2012-10-24       Impact factor: 5.226

7.  Whole-genome analysis of diverse Chlamydia trachomatis strains identifies phylogenetic relationships masked by current clinical typing.

Authors:  Simon R Harris; Ian N Clarke; Helena M B Seth-Smith; Anthony W Solomon; Lesley T Cutcliffe; Peter Marsh; Rachel J Skilton; Martin J Holland; David Mabey; Rosanna W Peeling; David A Lewis; Brian G Spratt; Magnus Unemo; Kenneth Persson; Carina Bjartling; Robert Brunham; Henry J C de Vries; Servaas A Morré; Arjen Speksnijder; Cécile M Bébéar; Maïté Clerc; Bertille de Barbeyrac; Julian Parkhill; Nicholas R Thomson
Journal:  Nat Genet       Date:  2012-03-11       Impact factor: 38.330

8.  Emergence and spread of Chlamydia trachomatis variant, Sweden.

Authors:  Björn Herrmann; Anna Törner; Nicola Low; Markus Klint; Anders Nilsson; Inga Velicko; Thomas Söderblom; Anders Blaxhult
Journal:  Emerg Infect Dis       Date:  2008-09       Impact factor: 6.883

9.  Predicting phenotype and emerging strains among Chlamydia trachomatis infections.

Authors:  Deborah Dean; William J Bruno; Raymond Wan; João P Gomes; Stéphanie Devignot; Tigist Mehari; Henry J C de Vries; Servaas A Morré; Garry Myers; Timothy D Read; Brian G Spratt
Journal:  Emerg Infect Dis       Date:  2009-09       Impact factor: 6.883

10.  Multi locus sequence typing of Chlamydiales: clonal groupings within the obligate intracellular bacteria Chlamydia trachomatis.

Authors:  Yvonne Pannekoek; Giovanna Morelli; Barica Kusecek; Servaas A Morré; Jacobus M Ossewaarde; Ankie A Langerak; Arie van der Ende
Journal:  BMC Microbiol       Date:  2008-02-28       Impact factor: 3.605

View more
  4 in total

1.  Distribution of Chlamydia trachomatis omp A genotypes in patients attending a sexually transmitted disease outpatient clinic in New Delhi, India.

Authors:  Jyoti Rawre; Benu Dhawan; Neena Khanna; Vishnubhatla Sreenivas; Shobha Broor; Rama Chaudhry
Journal:  Indian J Med Res       Date:  2019-05       Impact factor: 2.375

2.  Whole-genome sequencing of ocular Chlamydia trachomatis isolates from Gadarif State, Sudan.

Authors:  Abdulazeem Abdulsalam Ibrahim Alkhidir; Martin J Holland; Wafa Ibrahim Elhag; Charlotte A Williams; Judith Breuer; Abdah Elfatih Elemam; Khalid Mohamed Khalid El Hussain; Mohammed Elfatih Hussein Ournasseir; Harry Pickering
Journal:  Parasit Vectors       Date:  2019-11-04       Impact factor: 3.876

3.  Impact of a single round of mass drug administration with azithromycin on active trachoma and ocular Chlamydia trachomatis prevalence and circulating strains in The Gambia and Senegal.

Authors:  Emma M Harding-Esch; Martin J Holland; Jean-François Schémann; Ansumana Sillah; Boubacar Sarr; Linus Christerson; Harry Pickering; Sandra Molina-Gonzalez; Isatou Sarr; Aura A Andreasen; David Jeffries; Chris Grundy; David C W Mabey; Bjorn Herrmann; Robin L Bailey
Journal:  Parasit Vectors       Date:  2019-10-22       Impact factor: 3.876

4.  Unveiling the Multilocus Sequence Typing (MLST) Schemes and Core Genome Phylogenies for Genotyping Chlamydia trachomatis.

Authors:  Luz H Patiño; Milena Camargo; Marina Muñoz; Dora I Ríos-Chaparro; Manuel A Patarroyo; Juan D Ramírez
Journal:  Front Microbiol       Date:  2018-08-22       Impact factor: 5.640

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.