| Literature DB >> 27089479 |
Macarthur Charles, Sanchita Das, Rachel Daniels, Laura Kirkman, Glavdia G Delva, Rodney Destine, Ananias Escalante, Leopoldo Villegas, Noah M Daniels, Kristi Shigyo, Sarah K Volkman, Jean W Pape, Linnie M Golightly.
Abstract
Hispaniola is the only Caribbean island to which Plasmodium falciparum malaria remains endemic. Resistance to the antimalarial drug chloroquine has rarely been reported in Haiti, which is located on Hispaniola, but the K76T pfcrt (P. falciparum chloroquine resistance transporter) gene mutation that confers chloroquine resistance has been detected intermittently. We analyzed 901 patient samples collected during 2006-2009 and found 2 samples showed possible mixed parasite infections of genetically chloroquine-resistant and -sensitive parasites. Direct sequencing of the pfcrt resistance locus and single-nucleotide polymorphism barcoding did not definitively identify a resistant population, suggesting that sustained propagation of chloroquine-resistant parasites was not occurring in Haiti during the study period. Comparison of parasites from Haiti with those from Colombia, Panama, and Venezuela reveals a geographically distinct population with highly related parasites. Our findings indicate low genetic diversity in the parasite population and low levels of chloroquine resistance in Haiti, raising the possibility that reported cases may be of exogenous origin.Entities:
Keywords: CQR; CQS; Haiti; Hispaniola; Jeremie; K76T pfcrt; Les Cayes; Plasmodium falciparum; chloroquine; gene mutation; haplotype; malaria; parasites; vector-borne infections; vectorborne
Mesh:
Substances:
Year: 2016 PMID: 27089479 PMCID: PMC4861504 DOI: 10.3201/eid2205.150359
Source DB: PubMed Journal: Emerg Infect Dis ISSN: 1080-6040 Impact factor: 6.883
Evaluation of Plasmodium falciparum samples for chloroquine resistance by restriction-endonuclease digestion and sequencing, Haiti, 2006–2009*
| Source | No. samples | No. | No. | No. | No. |
|---|---|---|---|---|---|
| Jeremie | 308 | 73 | 1† | 234 | 1† |
| Jacmel | 36 | 14 | 0 | 22 | 0 |
| Les Cayes | 316 | 40 | 1‡ | 275 | 1‡ |
| Miragoane | 15 | 7 | 0 | 8 | 0 |
| Cap-Haitien | 4 | 2 | 0 | 2 | 0 |
| Deschappelles | 199 | 20 | 0 | 179 | 0 |
| Fort-Liberte | 13 | ND | NA | 13 | 0 |
| Port-de-Paix | 3 | ND | NA | 3 | 0 |
| Port-au-Prince | 7 | ND | NA | 7 | 0 |
| Total | 901 | 156 | 2 | 743 | 2 |
*Sequenced includes sequencing of the nested PCR product for pfcrt haplotypes where wild-type haplotype = CVMNK, and mutant haplotype = CVIET; ND, not determined; NA, not applicable; pfcrt, P. falciparum chloroquine resistance transporter. †Same sample from Jeremie. ‡Same sample from Les Cayes; pfcrt K76T ApoI includes endonuclease digestion and gel electrophoresis. Sensitive: K76; resistant: 76T; pfcrt K76T.
Figure 1Flowchart of blood specimen processing and analysis for study of presence of Plasmodium falciparum K76T pfcrt gene mutations, Haiti. Each sample was analyzed for the presence of pfcrt mutations associated with chloroquine drug resistance by only one method (restriction digest or sequencing) with the exception of 2 samples. pfcrt, P. falciparum chloroquine resistance transporter; CQR, chloroquine-resistant; SNP, single-nucleotide polymorphism.
Monogenic barcoding data of Plasmodium falciparum samples determined to assess genetic relatedness, Haiti, 2006 and 2007
| Sample | Location | Year | Molecular barcode* | Type | Category |
|---|---|---|---|---|---|
| 15 | Deschappelles | 2006 | TACTGCGGATTACCACCAAACTTG | A | Identical |
| 35 | Les Cayes | 2007 | TACTGCGGATTACCACCAAACTTG |
| Identical |
| 22 | Jeremie | 2007 | CACTCCGGATCXTCAACAAACTTG | B | Identical |
| 23 | Jeremie | 2007 | CACTCCGGATCXTCAACAAACTTG |
| Identical |
| 31 | Les Cayes | 2007 | TACTGGGGACTACACCCTAGCTTG | C | Identical |
| 33 | Les Cayes | 2007 | TACTGGGGACTACACCCTAGCTTG |
| Identical |
| 38 | Les Cayes | 2007 | TACTCCGGATCGTCCACAAGCTTG | D | Identical |
| 44 | Les Cayes | 2007 | TACTCCGGATCGTCCACAAGCTTG | Identical | |
| 27 | Les Cayes | 2007 | TACTCCGGATTXTCCACAAGCTTG |
| Related |
| 6 | Miragoane | 2006 | TACTCCAGACTXCCAACTCGATTG | E | Related |
| 36 | Les Cayes | 2007 | TACTCCAGACTACCAACTCGATTG |
| Related |
| 11 | Deschappelles | 2006 | TATCCCGGATTACCACCTAACCTG | F | Related |
| 16 | Deschappelles | 2007 | TATCCCGGATTAXCCCCTAACCTG |
| Related |
| 30 | Les Cayes | 2007 | TACTGCGGATXACACACTAGCCTG | G | Related |
| 43 | Les Cayes | 2007 | TACTGCGGATTXCACACAAGCCTX |
| Related |
| 5 | Miragoane | 2006 | XACTCCGGACTXCAACCAAACTTG | U | Unique |
| 7 | Miragoane | 2006 | TACTCCAGACTACCAACTCGACGG | U | Unique |
| 8 | Deschappelles | 2006 | TATTGCGGATTXCCCCCTAACTTG | U | Unique |
| 9 | Deschappelles | 2006 | CACTCCGGATTACACACAAACCTG | U | Unique |
| 10 | Deschappelles | 2006 | TATCCCGGATCATACCCTAACTTG | U | Unique |
| 12 | Deschappelles | 2006 | TACTGCAGATXXCACACTAAACTG | U | Unique |
| 13 | Deschappelles | 2006 | TATTGCAGATCGTCCCCTAGATTG | U | Unique |
| 14 | Deschappelles | 2006 | TACTCCAGATTGTCCCCTAGCTTG | U | Unique |
| 17 | Deschappelles | 2007 | TACTGCGGATCATAACCAAGCTTG | U | Unique |
| 18 | Jacmel | 2006 | TAXTCCGGATTGTCACCAAGCTTG | U | Unique |
| 19 | Jacmel | 2007 | TACTGCGGATCATAAACAAACTTG | U | Unique |
| 20† | Jeremie | 2007 | TACXCXAGATTXTCXXTACACTTG | U | Unique |
| 21 | Jeremie | 2007 | TATTGCGGATTACACCCTAGCCTG | U | Unique |
| 24 | Cap-Haitien | 2006 | TXCXCCGGAXTXCCCXCAAGXTTG | U | Unique |
| 25 | Les Cayes | 2006 | TACTGCAGATCGTACCTTAGCCTG | U | Unique |
| 26 | Les Cayes | 2006 | TACCCCGGACCGCAACCTAAATTG | U | Unique |
| 28 | Les Cayes | 2007 | TATTCCAGATCGTCCCTTAGACTG | U | Unique |
| 29 | Les Cayes | 2007 | TAXTGCGGATTGTCACCTAACTTG | U | Unique |
| 32 | Les Cayes | 2007 | TACCCCGGATTXCACCCAAACTTG | U | Unique |
| 34 | Les Cayes | 2007 | TACTCCGGACCGCACCCTAAATTG | U | Unique |
| 37 | Les Cayes | 2007 | TACTCCGGACTACCCCCTAACTTG | U | Unique |
| 39 | Les Cayes | 2007 | TATCGCAGATTACCAATAAGCCTG | U | Unique |
| 41 | Les Cayes | 2007 | TATTCCGGATXACCCACTAGCTTG | U | Unique |
| 42 | Les Cayes | 2007 | TATTCGGGATTATCCACTAGATTG | U | Unique |
| 45 | Les Cayes | 2007 | TACXGXAGATTXTCCCCACGCTTG | U | Unique |
| 46 | Les Cayes | 2007 | TACTGCGGACCGXCCCCTAACCTG | U | Unique |
| 47 | Les Cayes | 2007 | TACTGCAGACTXCCCCCACGCTTG | U | Unique |
| *X indicates missing data, where neither the major or minor allele could be detected. †Sample 20 from Jeremie revealed the possible presence of both alleles by mutation-specific restriction–endonuclease digestion and DNA sequencing. | |||||
Polygenomic barcodes of Plasmodium falciparum samples determined to assess genetic relatedness, Haiti, 2006–2007
| Sample | Location | Year | Molecular barcode* |
|---|---|---|---|
| 1 | Cap-Haitien | 2006 | TACTGCGGATTNNCCCNAAGCTTG |
| 2 | Deschappelles | 2006 | TATCCCGGATCANACCCTANCNTG |
| 3 | Deschappelles | 2007 | TATCCCNGATCATACCCTAACCTG |
| 4 | Deschappelles | 2007 | TACTNCNGATTNNNCNCAANCNTG |
| 5 | Jeremie | 2007 | TACTNCNGATCGTNACNTANNTTG |
| 6 | Les Cayes | 2006 | CACXGXGXATCXTAAXCTAGNCTG |
| 7 | Les Cayes | 2007 | TATXCXGGATNXCCCCCACGCNTG |
| 8 | Les Cayes | 2007 | TACTCCGGATCGTCCANAAGCTTG |
| *X indicates missing data, where neither the major or minor allele could be detected; N indicates both alleles detected. | |||
Figure 2Plasmodium falciparum parasite molecular barcode relatedness by site, Haiti. A total of 42 monogenomic samples were obtained from 6 sites (black dots). Circle sizes represent the number of samples from each site. Highly related samples, with either 24/24 or 23/24 identical single-nucleotide polymorphism positions (>96% barcode identity) are shown in gray circle sections; less related samples (<96% barcode identity) are shown in white circle sections.
Figure 3Visualization of 15 identical (same single-nucleotide polymorphism positions call at 24 of 24 positions) and nearly identical (23 of 24 identical positions) molecular barcodes from 42 monogenomic samples from patients in Haiti, 2006 and 2007. Each node (oval) represents an individual barcode. Samples with identical barcodes are included in the same nodes, and related barcodes (1 single-nucleotide polymorphism positions difference) are connected by lines. Gray nodes indicate that there is some point of ambiguity between barcodes, defined as either both alleles detected (N) or no data (X) at a specific position, indicating <100% confidence of a complete match between barcodes.
Figure 4Spatial principal components analysis (sPCA), performed in 2 dimensions (d = 2) comparing malarial parasite population structures based on monogenomic single-nucleotide polymorphism barcodes from Haiti (n = 42), Colombia (n = 7), Panama (n = 37), and Venezuela (n = 31). The x-axis represents the eigenvector associated with the first principal component, which differentiates between populations; the y axis represents the second principal component, which differentiates between samples within the same populations. Inset graph depicts the amount of variability described by the principal components: x-axis indicates individual principal components, y-axis their individual contribution to the observed variance. Black bars, displayed eigenvectors; gray bars, retained principal components; white bars, nonretained principal components.