Literature DB >> 27070907

Genetic Diversity in the Major Capsid L1 Protein of HPV-16 and HPV-18 in the Netherlands.

Audrey J King1, Jan A Sonsma1, Henrike J Vriend1, Marianne A B van der Sande1,2, Mariet C Feltkamp3, Hein J Boot1, Marion P G Koopmans1.   

Abstract

OBJECTIVES: Intratypic molecular variants of human papillomavirus (HPV) type-16 and -18 exist. In the Netherlands, a bivalent vaccine, composed of recombinant L1 proteins from HPV-16 and -18, is used to prevent cervical cancer since 2009. Long-term vaccination could lead to changes in HPV-16 and -18 virus population, thereby hampering vaccination strategies. We determined the genetic diversity of the L1 gene in HPV-16 and -18 viral strains circulating in the Netherlands at the start of vaccination in order to understand the baseline genetic diversity in the Dutch population.
METHODS: DNA sequences of the L1 gene were determined in HPV-16 (n = 241) and HPV-18 (n = 108) positive anogenital samples collected in 2009 and 2011 among Dutch 16- to 24-year old female and male attendees of the sexually transmitted infection (STI) clinics. Phylogenetic analysis was performed and sequences were compared to reference sequences HPV-16 (AF536179) and HPV-18 (X05015) using BioNumerics 7.1.
RESULTS: For HPV-16, ninety-five single nucleotide polymorphism (SNPs) were identified, twenty-seven (28%) were non-synonymous variations. For HPV-18, seventy-one SNPs were identified, twenty-nine (41%) were non-synonymous. The majority of the non-silent variations were located in sequences encoding alpha helix, beta sheet or surface loops, in particular in the immunodominant FG loop, and may influence the protein secondary structure and immune recognition.
CONCLUSIONS: This study provides unique pre-vaccination/baseline data on the genetic L1 diversity of HPV-16 and -18 viruses circulating in the Netherlands among adolescents and young adults.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27070907      PMCID: PMC4829201          DOI: 10.1371/journal.pone.0152782

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Human papillomaviruses (HPVs) are small double stranded DNA viruses that have the potential to infect mucosal and cutaneous human epithelial cells. Over 160 HPV types have been identified based on the DNA sequence of the L1 open reading frame of which about 60 types infect the human anogenital tract [1] and are sexually transmitted. A persistent infection with any of at least 12 high-risk HPV types is associated with the development of human cervical cancer [2]. Of these high-risk types, HPV-16 and HPV-18 are responsible for about 70% of cervical cancers [3]. Naturally occurring intratypic molecular variants of HPV-16 and -18 are known to occur and have been shown to be specific or more prevalent in certain parts of the world [4]. Intratypic molecular variants of HPV-16 and -18 are characterized as isolates of the same HPV type that differ in the nucleotide sequence of L1 for less than 10%. Despite phylogenetic relatedness HPV intratypic variants can differ in pathogenicity and in oncogenic potential [5-10]. For HPV-16 phylogenetic analyses revealed 4 major intratypic variant lineages:1. European (E/A), 2. Asian-American (AA/D), 3. African-1 (Af-1/B) and 4. African-2 (Af-2/C)[1]. These variants have been shown to differ in persistence and progression to cancer. Intratypic variants for HPV-18 are also described but the evidence for differences in persistence or progression to (pre)cancer is less clear [1]. HPV vaccination of sexually naïve girls has been introduced in many countries in order to prevent cervical cancers caused by persistent infection with HPV-16 or -18. To what extent HPV vaccination will affect the distribution of HPV types and variants in a (partially) vaccinated population is not yet known. Therefore, monitoring of type-specific HPV prevalence before and after the start of HPV vaccination is of great importance. Previous HPV monitoring studies have shown that the three most prevalent high-risk HPV types (among women) at the introduction of HPV vaccination in the Netherlands were HPV-16, HPV-51 and HPV-52 [11-13]. Since 2009, a bivalent vaccine, containing virus-like particles (VLPs) composed of pentamers of recombinant major capsid protein L1 from HPV-16 and -18, is used for vaccination of young girls in the Netherlands. This HPV vaccine is known to elicit high-titre neutralizing antibodies directed against the L1 protein and confer type-specific and long-lasting protection against a persistent infection and cervical abnormalities caused by HPV-16 and -18 [14]. An additional protective vaccine efficacy against infections associated with HPV-31, -33 and -45 have been shown [15]. On the surface of the pentamers, specific loop structures of the L1 protein containing hypervariable immunodominant regions are exposed [16]. Polymorphism within these loops is likely to result in the generation of neutralizing antibodies of different binding affinities [17]. At present, it is not known if immunity elicited against one HPV-16 or -18 variant can protect against infection from another variant with equal efficiency. Long-term vaccination with one HPV-16 or -18 variant of the L1 proteins could therefore lead to changes in HPV-16 and -18 virus population induced by selective pressures. In order to detect a long-term effect of L1 vaccination on the HPV-16 and/or -18 virus population, knowledge of the genetic diversity of L1 gene in HPV-16 and -18 viruses circulating in the Netherlands at the start of vaccination is required. The aim of this study was to determine the genetic diversity in the L1 protein and HPV variant distribution of circulating HPV-16 and -18 viral isolates found in young adolescents before the start of HPV-16/-18 vaccination, at baseline.

Material and Methods

Study population and design

Between February and April 2009, a cross-sectional study was started in 12 sexually transmitted infection (STI) clinics spread throughout the Netherlands prior to the introduction of vaccination. Follow-up surveys in this setting have been conducted every two years since 2009. For the results presented here only samples obtained in 2009 and 2011 were analyzed. The study population and methods have been described in detail previously [12, 13]. The study was approved by the Medical Ethical Committee of the University of Utrecht, the Netherlands. This committee has confirmed in writing that they have waived the need for separate ethical approval and the need for written consent.

Clinical specimens, HPV DNA detection and Sample selection

Samples were obtained from anogenital (i.e.vaginal/penile/anal) swabs collected in 2009 and the follow up year 2011 within the PASSYON (PApillomavirus Surveillance among Sti clinic YOungsters Netherlands) study among Dutch 16- to 24-year old male and female attendees of STI clinics. Details of the PASSYON study were described elsewhere [12, 13]. All swabs were suspended in 1 ml universal transport medium buffer and stored at -20°C until processing. After thawing, swabs were vortexed and 200 μl of the sample was spiked with phocine herpes virus-1. DNA was subsequently extracted using the MagnaPure platform (Total Nucleic Acid Isolation Kit, Roche) and eluted in 100 μl elution buffer. HPV-DNA was amplified using the SPF10 primer set according to the manufacturer’s instructions (DDL Diagnostic Laboratory, the Netherlands). HPV-specific amplicons were detected using the DNA enzyme-linked immunoassay (HPV-DEIA, DDL Diagnostic Laboratory, the Netherlands). Amplicons of HPV-positive samples were subsequently analyzed in the Line probe assay (HPV-LiPA, DDL Diagnostic Laboratory, the Netherlands) in order to determine the specific HPV type present in the sample. HPV isolates for sequencing were selected from a large set of samples previously typed for HPV based on successful L1 gene PCR results. These samples were analyzed further, in order to determine the genetic diversity in the L1 gene.

PCR sequencing

HPV-16 (n = 241) and HPV-18 (n = 108) positive samples were selected for further molecular characterization of the L1 gene (1596 bp for HPV-16 and 1707 bp for HPV-18) by sequence analysis. The entire L1 gene of HPV-16 and HPV-18 was amplified in three overlapping fragments using the primers listed in S1 Table [18]. The GenBank reference sequences used for primer design for HPV-16 were (AF536179, AF402678, AF536180, AF472509, K02718, FJ006723) and for HPV-18 (X05015, EF202147, EF202152). PCR amplification of the fragments was performed in 50 μl containing 3 μl extracted DNA, 1.25 Units Amplitaq Gold (Applied Biosystems), PCR II buffer (Applied Biosystems), 2 mM MgCl2, 0.2 mM dNTPs (Roche) and 10 pmol of each primer. The cycling conditions were as follows: 15 min 95°C denaturation; 15 sec 95°C, 30 sec 55°C, 90 sec 72°C for 35 cycles; 10 min 72°C final extension. Amplicons were visualized on 2.2% agarose gels. PCR products were treated with ExoSAP-IT® and sequenced by automated DNA sequencing using Big Dye Terminator 3.1.

Molecular characterization and phylogenetic analysis

All sequences from a given sample were combined and used to construct a contig. Contig sequences were aligned using Bionumerics version 7.1 and compared with HPV-16 European German reference sequence AF536179 (sublineage A2), or HPV-18 reference sequence X05015 (lineage A/European). For clustering of HPV-16 the L1 gene, GenBank reference sequences from K02718 = NC001526 (sublineage A1/European), HQ644236 (sublineage A3/ European), AF534061 (sublineage A4/European-Asian), AF536180 (sublineage B1/African-1a), HQ644298 (sublineage B2/African-1b) and AF472509 (sublineage C, African-2), HQ644257 (sublineage D1-North American), AY686579-(sublineage D2, Asian-American), AF402678 (sublineage D3, Asian-american) and AF043286 (vaccine variant) were included in the analyses. For clustering of HPV-18 the L1 gene, GenBank reference sequences from X05015 (lineage A/European), AY262282 (sublineage A1, European-1), EF202146 (sublineage A2, European-1), EF202151 (sublineage A4, European-2), GQ180787 (sublineage A5/ European) were used. HPV-16 and -18 L1 sequences sequenced here were deposited into the NCBI GenBank database (accession numbers KU70477-KU707717 for HPV-16 L1 sequences and KU707718-KU707825 for HPV-18 L1 sequences). The presence of the variations found infrequently, in one, two or three strains were confirmed by resequencing at least 2 additional times. To estimate selection pressure acting on HPV-16 and HPV-18 L1 sequences, codon-specific, non-synonymous (dN) and synomymous (dS) substitutions rates were inferred by using Nei- Gojobori method [19] and Jukes- Cantor Model with the program SNAP v2.11 (http://www.hiv.lanl.gov) [20]. Non-synonymous (dN) and synomymous (dS) substitutions rates were calculated and compared, the ratio of dN/dS was calculated.

Results

HPV-16 L1 genetic diversity

L1 HPV-16 sequences were determined and analyzed by aligning the entire L1 gene from 241 HPV-16 positive samples collected in the PASSYON study rounds 1 (2009) and 2 (2011) [13]. Forty-six percent (46%) of all HPV-16 positive samples in these two rounds (Table 1), which are considered as pre-vaccination samples, were sequenced in the present study. The characteristics of the total study population and the strains selected for sequencing are shown in Table 1. Phylogenetic analysis of all L1 sequences clustered the HPV-16 variants in two groups. The majority of the HPV-16 strains 223/241 (93%) had high similarity to the HPV-16 European reference (GenBank reference AF536179, lineage E/A) and other lineage A reference strains (Fig 1). A small subset 18/241 (7%) clustered with the African types (GenBank references AF472508 (Af-1/B), AF472509 (Af-2/C)) and Asian-American type D3 (AF402678). Non-European HPV-16 variants were collected from persons who self-reported to belong to the Surinam or Antillean population group, Dutch population and from unknown population group respectively, in 11%, 50% and 33% of 18 non-European variants (not shown). The most common lineage E/A variant was detected in 31% (75/241, Fig 1) of the samples and differed from the HPV-16 European reference (GenBank reference AF536179) by 2 silent variations and from the HPV-16 vaccine strain (GenBank reference AF043286) by 3 silent variations.
Table 1

Characteristics of study population.

HPV-16 positive sequencedHPV-18 positive sequenced
N = 241 of 524N = 108 of 311
n seq/n total%n seq/n total%
Year of participation
200997/2494042/12739
2011144/2756066/18461
Age
16–1822/4595/175
19–2192/2033847/12543
22–24127/2765356/16952
Gender
Female214/4218987/21881
Male27*/1031121*/9319
Population group
Dutch207/4448592/26985
Non-Dutch27/731015/4114
unknown7/751/11

Differences in sequenced (= n seq) and total group (= n total) were tested with Chi- square test, all were non-significantly different except for gender.

* Indicates significant difference between the number of HPV-16 and -18 sequenced samples from males compared to male present in the total group (P<0.05). The number of HPV-16 and -18 sequenced samples from males was lower.

Fig 1

Maximum parsimony tree based on nucleotide sequences of L1 HPV-16 gene.

Study sequences of 241 HPV-16 positive samples collected in 2009 and 2011 are shown in blue. Reference sequences of European/A lineages (GenBank reference AF536179 K02718 = NC001526, HQ644236, AF534061) are shown in green, African/B lineages (GenBank references AF472508, HQ644298 and AF536180) in brown. African-2/C lineage GenBank reference AF472509 is shown in pink. References sequences from lineage D are shown in purple HQ644257 (sublineage D1-North American), AY686579-(sublineage D2, Asian-American) AF402678 (sublineage D3, Asian-American). HPV-16 variant used in the vaccine (GenBank reference AF043286) is shown in red. The number given in each circle indicates the number of viral strains with the same sequence.

Maximum parsimony tree based on nucleotide sequences of L1 HPV-16 gene.

Study sequences of 241 HPV-16 positive samples collected in 2009 and 2011 are shown in blue. Reference sequences of European/A lineages (GenBank reference AF536179 K02718 = NC001526, HQ644236, AF534061) are shown in green, African/B lineages (GenBank references AF472508, HQ644298 and AF536180) in brown. African-2/C lineage GenBank reference AF472509 is shown in pink. References sequences from lineage D are shown in purple HQ644257 (sublineage D1-North American), AY686579-(sublineage D2, Asian-American) AF402678 (sublineage D3, Asian-American). HPV-16 variant used in the vaccine (GenBank reference AF043286) is shown in red. The number given in each circle indicates the number of viral strains with the same sequence. Differences in sequenced (= n seq) and total group (= n total) were tested with Chi- square test, all were non-significantly different except for gender. * Indicates significant difference between the number of HPV-16 and -18 sequenced samples from males compared to male present in the total group (P<0.05). The number of HPV-16 and -18 sequenced samples from males was lower. In total we identified ninety-five single nucleotide polymorphisms (SNPs) among the observed Dutch HPV-16 strains compared to the reference strain AF536179. Of these SNPs, 68/95 (72%) were synonymous variations and 27/95 (28%) were non-synonymous variations. The majority of the non-synonymous variations 21/27 (78%) was located in the L1 region encoding alpha helix, beta sheets, surface loops or connecting loops, in particular in the immunodominant FG loop, and therefore may influence the protein secondary structure. The position of the non-synonymous variations is shown in Table 2. Twelve of these non-synonymous variations were located in structured areas of the L1 protein and were, to our knowledge, not described previously. Ten of these twelve variations were identified each in one strain only, eight were found in strains similar to European strains and two in those more similar to the non-European lineages. Resequencing confirmed the presence of the variations found infrequently (in one, two or three strains) as was indicated in Table 2.
Table 2

Non-synonymous nucleotide sequence variations of HPV-16 L1.

Nucleotide position from start Ref55625629586259206018616361666178621664326443644564456480
AF536179CTCCGCAAGGAAAT
Variation-frequency (n)182*191*1*181*72*541*1*1*8
Variation-frequency (%)7.50.87.90.40.47.50.42.90.422.40.40.40.43.3
Change to nucleotideGCTGAACCAACCGC
Secondary structure β-Cβ-DDE-loopEF-loopEF-loopEF-loopEF-loopFG-loopFG-loopFG-loopFG-loopFG-loop
NUCL POS from start L1 ML-W-74-7226284382527530542580796807809809844
AA pos L1 from M-LW-24-27695128176177181194266269270270282
AA TRIPLETCAGTTTCATACAGACACCAATAATGTTGCTGAAAATAATTCT
AA SWITCH  H>Y76T>R95D>N128T>N176N>T177N>T181V>I194A>T266E>D269N>T270N>S270S>P282
            AA-Coding region

Nucleotide positions of the reference sequence AF536179 are shown on the top of the figure. The sequence of the reference is shown below the positions. Variation frequencies are shown. Secondary structured areas and connecting loops are indicated. Variations in boxed areas were newly found in this study. The nucleotide position from start of L1 and the AA position of L1 is given below the secondary structure. The AA-triplet sequence encoding the amino acid sequence in the reference is shown. Amino acid switches are shown at the bottom of the figure.

* Indicates variation frequencies of 3 or less, these variations/changes were confirmed by resequencing.

Nucleotide positions of the reference sequence AF536179 are shown on the top of the figure. The sequence of the reference is shown below the positions. Variation frequencies are shown. Secondary structured areas and connecting loops are indicated. Variations in boxed areas were newly found in this study. The nucleotide position from start of L1 and the AA position of L1 is given below the secondary structure. The AA-triplet sequence encoding the amino acid sequence in the reference is shown. Amino acid switches are shown at the bottom of the figure. * Indicates variation frequencies of 3 or less, these variations/changes were confirmed by resequencing. We calculated the non-synonymous/synonymous substitution rates for HPV-16 L1 amino acid residues. Based on the HPV-16 sequences analyzed here the dN/dS ratio was 0.176 suggesting that for the entire L1 protein no evidence for positive selection was found (P<0.01).

HPV-18 L1 genetic diversity

L1 HPV-18 sequences were determined and analyzed by aligning the L1 contigs for in total 108 HPV-18 positive samples from the PASSYON study, which is 35% of the HPV-18 positive samples (Table 1). Table 1 shows the characteristics of the total study population and the strains selected for sequencing. Phylogenetic analysis of all L1 sequences showed that the majority 93/108 (86%) of the HPV-18 viral strains have similarity to the HPV-18 European reference (GenBank reference X05015 lineage E/A) (Fig 2). A smaller subset (15/108 (14%)) clustered with the African types (GenBank references EF202154, EF202153 lineage Af/B). Fifteen non-European variants were found, 73% of these were isolated in persons with self-reported non-Dutch origin mostly with a self-reported Surinam or Antillean origin, 27% persons reported to be Dutch and for 0.3% the origin was unknown (not shown). The most common L1 sequence type was detected in 31/108 (29%) of the samples and differed from the HPV-18 European reference (GenBank reference X05015) by 8 (2 silent and 6 non-silent) variations and by 4 (1 silent and 3 non-silent) variations from the vaccine strain (GenBank reference AY863161).
Fig 2

Maximum parsimony tree based on nucleotide sequences of L1 HPV-18 gene.

Study sequences of 108 HPV-18 positive samples collected in 2009 and 2011 are shown in blue. Reference sequences of European/A lineages (GenBank reference X05015, AY262282 (sublineage A1), EF202146 (sublineage A2), EF202147 (sublineage A3), EF202151 (sublineage A4), CQ180787 (sublineage A5)), African/B lineages (GenBank references EF202153, EF202154, EF202155 (sublineage B1)) KC470225 (sublineage B2) EF202152 (sublineage B3), and reference for lineage C (KC47229) are shown in green, brown and pink respectively. HPV-18 variant used in the vaccine (GenBank reference AY863161) is shown in red. The number given in each circle indicates the number of viral strains with the same sequence.

Maximum parsimony tree based on nucleotide sequences of L1 HPV-18 gene.

Study sequences of 108 HPV-18 positive samples collected in 2009 and 2011 are shown in blue. Reference sequences of European/A lineages (GenBank reference X05015, AY262282 (sublineage A1), EF202146 (sublineage A2), EF202147 (sublineage A3), EF202151 (sublineage A4), CQ180787 (sublineage A5)), African/B lineages (GenBank references EF202153, EF202154, EF202155 (sublineage B1)) KC470225 (sublineage B2) EF202152 (sublineage B3), and reference for lineage C (KC47229) are shown in green, brown and pink respectively. HPV-18 variant used in the vaccine (GenBank reference AY863161) is shown in red. The number given in each circle indicates the number of viral strains with the same sequence. Seventy-one (71) single nucleotide polymorphism (SNPs) were identified among the 108 Dutch HPV-18 strains related to the reference strain X05015. Forty-two of seventy-one (42/71) (59%) were synonymous variations and 29/71 (41%) were non-synonymous variations. For HPV-18 fourteen of the non-synonymous variations 14/29 (48%) were located in sequences encoding the alpha helix, beta sheet, surface loops or connecting loops. The position of the non-synonymous variations is shown in Table 3. To our knowledge only 6 of the 29 non-synonymous variations were described before. Novel variations were mostly found in multiple viral strains (Table 3) and both in strains similar to European and non-European lineages. All variations found in one, two or three strains were confirmed by resequencing.
Table 3

Non-synonymous nucleotide sequence variations of HPV-18 L1.

Nucleotide position from start Ref54585467549654975503550555215560556355735581558456195701
X05015TACAGCGAAAGATC
Variation frequency (n)3*1*1*6107101*1*2*9171559108
Variation frequency (%)2.80.90.95.599.19.20.90.91.88.315.713.954.6100
Change to nucleotideCCTCAAAGGCAGAG
Secondary structure             β-B1
NUCL POS start from L1 at M-LW-154-145-116-115-109-107-91-52-49-39-31-28789
AA pos L1 from M-LW-52-49-39-39-37-36-31-18-17-14-11-10330
AA TRIPLETTTACATCACCACCGGCCCAGTCATTATTTAAGAAACTTGCCC
AA SWITCH            L> M3P>R30
               

Nucleotide positions of the reference sequence X05015 are shown on the top of the figure. The sequence of the reference is shown below the positions. Variation frequencies are shown. Secondary structured areas and connecting loops are indicated. Variations in boxed areas were newly found in this study. The nucleotide position from start of L1 and the AA position of L1 is given below the secondary structure. The AA-triplet sequence encoding the amino acid sequence in the reference is shown. Amino acid switches are shown at the bottom of the figure.

* Indicates variation frequencies of 3 or less, these changes were confirmed by resequencing.

Nucleotide positions of the reference sequence X05015 are shown on the top of the figure. The sequence of the reference is shown below the positions. Variation frequencies are shown. Secondary structured areas and connecting loops are indicated. Variations in boxed areas were newly found in this study. The nucleotide position from start of L1 and the AA position of L1 is given below the secondary structure. The AA-triplet sequence encoding the amino acid sequence in the reference is shown. Amino acid switches are shown at the bottom of the figure. * Indicates variation frequencies of 3 or less, these changes were confirmed by resequencing. Non-synonymous and synonymous substitution rates for HPV-18 L1 amino acid residues were calculated based on the HPV-18 L1 gene sequences analyzed here and shown be significantly different (P<001). No evidence for positive selection was found for the entire L1 gene since the dN/dS ratio was 0.172 suggesting that it was subject to purifying selection.

Discussion

Human papillomavirus (HPV) vaccination using VLPs composed of the L1 protein has been widely implemented in many countries, with vaccines targeting high-risk HPV-16 and -18 alone, or additional HPV types. While type-specific protection is expected, genotypic and phenotypic variants within HPV types have been recognized, with some evidence for geographic association of this diversity and differences in progression to cervical intraepithelial neoplasia grade 3 (CIN3). At present it is not known if immunity to viruses within an HPV-type is equally efficient for all variants, with some evidence that this may not be the case: although studies have suggested that immunization with L1 VLPs of an European variant induces antibodies able to neutralize different HPV-16 variants [21]. Other studies have shown evidence for variant specific neutralizing epitopes [22]. Understanding such diversity is important as the selective immunological pressure in a (fully) vaccinated population could lead to selective displacement of variants within the HPV types covered by the vaccines. Here we demonstrated the presence of HPV-16 and -18 L1 genetic diversity (at the introduction of vaccination), which is important as baseline for the post vaccination surveillance. In the past, several studies have addressed the intratypic variation of the major capsid protein from HPV-16 and/or HPV-18 [23-26]. Most of these studies were focused on small fragments of the L1 gene or were performed with limited sample numbers collected in Europe. Furthermore, in this regard no isolates collected in the Netherlands have been described previously. In this study we have evaluated the HPV-16 and HPV-18 L1 diversity based on 241 and 108 full-length HPV-16 and -18 L1 sequences, respectively, obtained from HPV isolates collected in the Netherlands around the introduction of HPV vaccination. The sequenced strains were representative for the total group in the PASSYON study, since the characteristics were non-significantly different from the total group, except for gender. A relatively low number of male sample were sequenced, but we expect no gender specific sequences. To our knowledge this is the largest study where the genetic diversity of the L1 gene in HPV-16 and -18 in HPV isolates collected in Europe is studied. As HPV variants have been shown to differ in geographic origins [4] it was to be expected that European HPV-16 and -18 variants (lineage E/A) were identified most frequently in the Dutch isolates. Indeed, only a minority of our isolates concerned variant lineages, 7% and 14% for HPV-16 and -18 respectively, similar to the non-European variants from (sub)lineages B1, B2 (African1a and 1b), C (African 2a), D1 (North-American) and D2 and D3. Here we have found that all persons with a self-reported Surinam or Antillean origin of whom HPV-18 variant was analyzed carried a non-European HPV-18 variant. An earlier study had described that the distribution and persistence of HPV-16 and -18 variants may be related to the racial composition of individuals [27]. The present study supports this observation although the number of isolates from non-European variants was very small and the information on population group is based fully on self-reported data, the distribution of HPV-18 variants in the Netherlands seems to be ethnicity related. For HPV-16 variants this ethnicity-related distribution of variants in our Dutch isolates is not seen. It is not known if the ethnicity-associated variant distribution is caused by (long-term) mixing patterns in the population or if genetic factors which preferentially predispose persons are involved [27]. Our study identified known and new variants of HPV-16 and -18, with amino-acid variations in or close to epitopes. The new variants of HPV-16 and -18 were found both in European and non-European group of viral strains. Whether these changed L1 proteins are less susceptible to the vaccine induced immunity is unclear at this time. In general, human papillomaviruses mutate slowly [28] because they are double-stranded DNA viruses and use the proofreading DNA polymerase from their host. Nevertheless, nucleotide polymorphism can occur and become established in the population. Based on what is known about the evolution of the HPV genome, it is considered unlikely that HPV will show significant change in response to the human vaccination [29]. Accordingly, in our study population where HPV isolates collected around the introduction of HPV vaccination were studied, we found no evidence for selective pressure on the HPV-16 L1 gene (dN/dS ratio 0.176) or on the HPV-18 L1 gene (dN/dS ratio 0.172). Both ratios were less than one indicating that these sequences are under purifying selective pressure in the pre-vaccination period. Some study limitations should be noted. First, we have sequenced a relative small number of HPV strains, especially strains sequenced from males and persons from the non-Dutch population group were low in number. Specific variants are not expected in males but have been seen in persons from non-Dutch population group. A second limitation is that we have selected swabs collected in 2009 and 2011 for studying the pre-vaccination genetic diversity. However, vaccination was introduced in the Netherlands in 2009 in a catch-up campaign in girls aged 14- to 16-years old before introduction in 12-year old girls in 2010. Therefore it is possible that samples collected in 2011 from 16–18 year old girls were from vaccinated girls. Since the number of strains collected in 2011 from 16 to 18 years girls is very low and the vaccination uptake at that time was about 50% we believe that no (or very little) dilution of vaccination effects have been introduced the pre-vaccination genetic diversity. Whether in the future we will observe the emergence or expansion of (new) HPV-16- and or HPV-18 variants caused by the selective pressure induced by mass vaccination will remain unclear until investigated. Knowledge of the genetic diversity of HPV-16 and -18 at the start of vaccination (baseline), as is presented in this study is essential in order to understand the genetic variability of these proteins over time.

Primers used for the molecular characterization of HPV-16 and HPV-18 L1 gene.

(XLSX) Click here for additional data file.
  28 in total

1.  NHPV16 VLP vaccine induces human antibodies that neutralize divergent variants of HPV16.

Authors:  D V Pastrana; W C Vass; D R Lowy; J T Schiller
Journal:  Virology       Date:  2001-01-05       Impact factor: 3.616

2.  Characterization of a human papillomavirus type 16 variant-dependent neutralizing epitope.

Authors:  R B Roden; A Armstrong; P Haderer; N D Christensen; N L Hubbert; D R Lowy; J T Schiller; R Kirnbauer
Journal:  J Virol       Date:  1997-08       Impact factor: 5.103

3.  From human papillomavirus to cervical cancer.

Authors:  Mark Schiffman; Nicolas Wentzensen
Journal:  Obstet Gynecol       Date:  2010-07       Impact factor: 7.661

4.  Polymorphism of the L1 capsid gene and persistence of human papillomavirus type 52 infection in women at high risk or infected by HIV.

Authors:  Simon Gagnon; Catherine Hankins; Deborah Money; Karina Pourreaux; Eduardo Franco; François Coutlée
Journal:  J Acquir Immune Defic Syndr       Date:  2007-01-01       Impact factor: 3.731

5.  Intratype variation in 12 human papillomavirus types: a worldwide perspective.

Authors:  A C Stewart; A M Eriksson; M M Manos; N Muñoz; F X Bosch; J Peto; C M Wheeler
Journal:  J Virol       Date:  1996-05       Impact factor: 5.103

6.  Human papillomavirus type 16 and 18 variants: race-related distribution and persistence.

Authors:  Long Fu Xi; Nancy B Kiviat; Allan Hildesheim; Denise A Galloway; Cosette M Wheeler; Jesse Ho; Laura A Koutsky
Journal:  J Natl Cancer Inst       Date:  2006-08-02       Impact factor: 13.506

7.  Polymorphism of the capsid L1 gene of human papillomavirus types 31, 33, and 35.

Authors:  Gilbert Cornut; Simon Gagnon; Catherine Hankins; Deborah Money; Karina Pourreaux; Eduardo L Franco; François Coutlée
Journal:  J Med Virol       Date:  2010-07       Impact factor: 2.327

8.  Human papillomavirus genotype attribution in invasive cervical cancer: a retrospective cross-sectional worldwide study.

Authors:  Silvia de Sanjose; Wim Gv Quint; Laia Alemany; Daan T Geraets; Jo Ellen Klaustermeier; Belen Lloveras; Sara Tous; Ana Felix; Luis Eduardo Bravo; Hai-Rim Shin; Carlos S Vallejos; Patricia Alonso de Ruiz; Marcus Aurelho Lima; Nuria Guimera; Omar Clavero; Maria Alejo; Antonio Llombart-Bosch; Chou Cheng-Yang; Silvio Alejandro Tatti; Elena Kasamatsu; Ermina Iljazovic; Michael Odida; Rodrigo Prado; Muhieddine Seoud; Magdalena Grce; Alp Usubutun; Asha Jain; Gustavo Adolfo Hernandez Suarez; Luis Estuardo Lombardi; Aekunbiola Banjo; Clara Menéndez; Efrén Javier Domingo; Julio Velasco; Ashrafun Nessa; Saibua C Bunnag Chichareon; You Lin Qiao; Enrique Lerma; Suzanne M Garland; Toshiyuki Sasagawa; Annabelle Ferrera; Doudja Hammouda; Luciano Mariani; Adela Pelayo; Ivo Steiner; Esther Oliva; Chris Jlm Meijer; Waleed Fahad Al-Jassar; Eugenia Cruz; Thomas C Wright; Ana Puras; Cecilia Ladines Llave; Maria Tzardi; Theodoros Agorastos; Victoria Garcia-Barriola; Christine Clavel; Jaume Ordi; Miguel Andújar; Xavier Castellsagué; Gloria I Sánchez; Andrzej Marcin Nowakowski; Jacob Bornstein; Nubia Muñoz; F Xavier Bosch
Journal:  Lancet Oncol       Date:  2010-10-15       Impact factor: 41.316

9.  The genetic drift of human papillomavirus type 16 is a means of reconstructing prehistoric viral spread and the movement of ancient human populations.

Authors:  L Ho; S Y Chan; R D Burk; B C Das; K Fujinaga; J P Icenogle; T Kahn; N Kiviat; W Lancaster; P Mavromara-Nazos
Journal:  J Virol       Date:  1993-11       Impact factor: 5.103

10.  Genetic variability in L1 and L2 genes of HPV-16 and HPV-58 in Southwest China.

Authors:  Yaofei Yue; Hongying Yang; Kun Wu; Lijuan Yang; Junying Chen; Xinwei Huang; Yue Pan; Youqing Ruan; Yujiao Zhao; Xinan Shi; Qiangming Sun; Qihan Li
Journal:  PLoS One       Date:  2013-01-25       Impact factor: 3.240

View more
  8 in total

1.  Correction: Genetic Diversity in the Major Capsid L1 Protein of HPV-16 and HPV-18 in the Netherlands.

Authors:  Audrey J King; Jan A Sonsma; Henrike J Vriend; Marianne A B van der Sande; Mariet C Feltkamp; Hein J Boot; Marion P G Koopmans
Journal:  PLoS One       Date:  2016-04-28       Impact factor: 3.240

2.  Naturally occurring capsid protein variants L1 of human papillomavirus genotype 16 in Morocco.

Authors:  Aissam El-Aliani; My Abdelaziz El Alaoui; Imane Chaoui; My Mustapha Ennaji; Mohammed Attaleb; Mohammed El Mzibri
Journal:  Bioinformation       Date:  2017-08-31

3.  Genetic diversity and phylogenetic analysis of HPV 16 & 18 variants isolated from cervical specimens of women in Saudi Arabia.

Authors:  Khalid Sait; Rola Turki; Adel Mohammed Abuzenadah; Osama H Jiffiri; Abdulbaset Bohmaidah; Sayed Sartaj Sohrab
Journal:  Saudi J Biol Sci       Date:  2018-05-03       Impact factor: 4.219

4.  Evidence for Missing Positive Results for Human Papilloma Virus 45 (HPV-45) and HPV-59 with the SPF10-DEIA-LiPA25 (Version 1) Platform Compared to Type-Specific Real-Time Quantitative PCR Assays and Impact on Vaccine Effectiveness Estimates.

Authors:  Kahren van Eer; Suzan Leussink; Tim T Severs; Naomi van Marm-Wattimena; Petra J Woestenberg; Johannes A Bogaards; Audrey J King
Journal:  J Clin Microbiol       Date:  2020-10-21       Impact factor: 5.948

Review 5.  Epidemiology and Burden of Human Papillomavirus and Related Diseases, Molecular Pathogenesis, and Vaccine Evaluation.

Authors:  Arnaud John Kombe Kombe; Bofeng Li; Ayesha Zahid; Hylemariam Mihiretie Mengist; Guy-Armel Bounda; Ying Zhou; Tengchuan Jin
Journal:  Front Public Health       Date:  2021-01-20

6.  High Whole-Genome Sequence Diversity of Human Papillomavirus Type 18 Isolates.

Authors:  Pascal van der Weele; Chris J L M Meijer; Audrey J King
Journal:  Viruses       Date:  2018-02-07       Impact factor: 5.048

7.  Higher baseline viral diversity correlates with lower HBsAg decline following PEGylated interferon-alpha therapy in patients with HBeAg-positive chronic hepatitis B.

Authors:  Hu Li; Li Zhang; Hong Ren; Peng Hu
Journal:  Infect Drug Resist       Date:  2018-05-03       Impact factor: 4.003

8.  An economical Nanopore sequencing assay for human papillomavirus (HPV) genotyping.

Authors:  Wai Sing Chan; Tsun Leung Chan; Chun Hang Au; Chin Pang Leung; Man Yan To; Man Kin Ng; Sau Man Leung; May Kwok Mei Chan; Edmond Shiu Kwan Ma; Bone Siu Fai Tang
Journal:  Diagn Pathol       Date:  2020-05-06       Impact factor: 2.644

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.