| Literature DB >> 27064269 |
Shufen Liu1, Jianhua Huang2, Jing Wang1, Yongjian Zhao1, Sheng Lu1, Yongjun Wang1, Qin Bian1.
Abstract
We studied the bone mesenchymal stem cells (bMSCs) and gene profiles regulated by Er-Xian Decoction (EXD), a traditional Chinese herbal formula widely used for postmenopausal <span class="Disease">osteoporosis treatment. Six-month-old female Imprinting Control Region <span class="Species">mice that underwent ovariectomy were treated with EXD. After 3 months, bone mass was evaluated by μCT and histological and immunohistochemical detection. The self-renewal and differentiation capacities of bMSCs were evaluated by colony-forming unit-fibroblastic, colony-forming unit-adipocyte, and alkaline phosphatase staining. In addition, the expression of 26991 genes of bMSCs ex vivo at 2 weeks after EXD-treatment or of bMSCs in vitro after exposure to conditioned serum from EXD-treated rats was measured and analyzed using NimbleGen Gene Expression Profiling and Cluster and pathway analysis. EXD treatment increased bone mass, elevating osteocalcin protein levels in vivo and facilitating the self-renewal and osteoblastic differentiation of bMSCs ex vivo. EXD rescued several gene expressions that were dysregulated by OVX. These genes overlapped and their functions were involved in ten pathways between ex vivo and in vitro experiments. EXD exerts an osteogenic effect on bMSCs in OVX induced osteoporotic mice. Our results contribute to further study of its molecular mechanism and traditional use in the treatment of postmenopausal osteoporosis.Entities:
Year: 2016 PMID: 27064269 PMCID: PMC4811212 DOI: 10.1155/2016/4079210
Source DB: PubMed Journal: Stem Cells Int Impact factor: 5.443
Primer information.
| Gene | GenBank | Forward primer | Reverse primer | Product length |
|---|---|---|---|---|
| Postn | BC031449.1 | ACGTCGTGGACAAACTCCTC | TGTTTCTCCACCTCCTGTGG | 371 |
| Col11a1 |
| CGTCCCTTCTCTGCTAACCG | ACACAAGAGTGAATTGCAACCTG | 900 |
| Igfals |
| GCTCTGTACAAGGAACAATGGC | CCTGATACGATTGTGGCCGA | 998 |
| Cthrc1 |
| CCAGGTCGGGATGGATTCAA | GGCAGGGACTGAAATCGTCA | 518 |
Figure 1EXD treatment prevents OVX-induced bone loss by μCT analyses. (a) 3D image of mouse L4 vertebra in Sham, OVX, and EXD group analyzed by μCT. (b) Morphometric data of (a) indicates a bone loss by a significant decrease in BMD, BV/TV, Tb.N, Tb.Th and an increase in Tb.Sp. of OVX mice compared to those of Sham mice. Four of them were significantly rescued by EXD treatment. In addition, EXD markedly increased the Conn.D. degree after OVX surgery. The columns represent the means ± SE n = 6 per group. p < 0.05, p < 0.01 versus sham, # p < 0.05, ## p < 0.01 versus OVX.
Figure 2The effect of EXD treatment on activities of osteoblasts and osteoclasts in OVX mice. (a) Representative images of H & E staining demonstrated that OVX induced a loss of the number of bone trabeculae, which was reduced by EXD (×100). (b) Morphometric data displayed a great decrease of N.Ob/T.Ar and N.Ob/B.pm in OVX mice compared to Sham mice, which was partially rescued in EXD mice with 3-mon treatment. (c, d) Representative images of Trap staining showed EXD inhibited the elevated activity of osteoclasts induced by OVX as evaluated by N.Oc/B.pm (×200). (e) Immunostaining of L4 vertebrae with antibody against OC. Positive staining was indicated in brown (×200). (f) Quantitative data of (e). The columns represent the means ± SE n = 3 per group. p < 0.01 versus sham, ## p < 0.01 versus OVX.
Figure 3EXD treatment promotes self-renewal and osteoblastic differentiation of bMSCs from OVX mice. (a, b) BMSCs were harvested from mice of Sham, OVX and EXD groups and cultured for 4 or 7 days ex vivo. The results demonstrated that OVX reduced the number of spontaneously formed CFU-F but increased that of CFU-Adipo, indicating OVX induced adipogenic differentiation of bMSCs. EXD maintained the number of both CFU-F and CFU-Adipo as the similar level of sham mice (×120). (c, d) At the 7th day of culture, the ALP-positive staining of OVX bMSCs was decreased versus bMSCs from sham group. EXD dramatically increased the level of ALP-positive staining as compared to OVX group. The columns represent the means ± SE from three dishes (six mice) per group. p < 0.01 versus sham, # p < 0.05, ## p < 0.01 versus OVX.
Figure 4EXD treatment rescues 389 gene expressions involving in ten pathways both in ex vivo and in vitro. (a) Total 26991 genes were detected by microarray. Among them, 389 genes (a ratio of 1.44%) were fold changed > 1.5. These 389 genes were chosen for the hierarchical clustering and principal component analysis (PCA). The samples fell into three major classes, indicating the reliable qualities of microarray. The results showed EXD treatment in OVX mice shifted the gene expression profile toward the sham mice. (b) The pathways analysis demonstrated ten pathways overlapped between ex vivo and in vitro studies. (c) Quantification of qPCR results from ex vivo experiment. The columns represent the means ± SE (n = 3) per group. p < 0.05, p < 0.01 versus sham, # p < 0.05, ## p < 0.01 versus OVX.