Literature DB >> 27051652

Ethanol Extract of Cirsium japonicum var. ussuriense Kitamura Exhibits the Activation of Nuclear Factor Erythroid 2-Related Factor 2-dependent Antioxidant Response Element and Protects Human Keratinocyte HaCaT Cells Against Oxidative DNA Damage.

Ok-Kyung Yoo1, Bu Young Choi2, Jin-Oh Park3, Ji-Won Lee4, Byoung-Kwon Park4, Chul Gue Joo3, Hyo-Jung Heo4, Young-Sam Keum1.   

Abstract

Keratinocytes are constantly exposed to extracellular insults, such as ultraviolet B, toxic chemicals and mechanical stress, all of which can facilitate the aging of keratinocytes via the generation of intracellular reactive oxygen species (ROS). Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that plays a critical role in protecting keratinocytes against oxidants and xenobiotics by binding to the antioxidant response element (ARE), a cis-acting element existing in the promoter of most phase II cytoprotective genes. In the present study, we have attempted to find novel ethanol extract(s) of indigenous plants of Jeju island, Korea that can activate the Nrf2/ARE-dependent gene expression in human keratinocyte HaCaT cells. As a result, we identified that ethanol extract of Cirsium japonicum var. ussuriense Kitamura (ECJUK) elicited strong stimulatory effect on the ARE-dependent gene expression. Supporting this observation, we found that ECJUK induced the expression of Nrf2, hemoxygenase-1, and NAD(P)H: quinone oxidoreductase-1 and this event was correlated with Akt1 phosphorylation. We also found that ECJUK increased the intracellular reduced glutathione level and suppressed 12-O-tetradecanoylphorbol acetate-induced 8-hydroxyguanosine formation without affecting the overall viability. Collectively, our results provide evidence that ECJUK can protect against oxidative stress-mediated damages through the activation of Nrf2/ARE-dependent phase II cytoprotective gene expression.

Entities:  

Keywords:  Antioxidant response elements; Ethanol extract of Cirsium japonicum var. ussuriense Kitamura; Nuclear factor erythroid 2-related factor 2; Reactive oxygen species

Year:  2016        PMID: 27051652      PMCID: PMC4819669          DOI: 10.15430/JCP.2016.21.1.66

Source DB:  PubMed          Journal:  J Cancer Prev        ISSN: 2288-3649


INTRODUCTION

Oxidative stress, caused by an imbalance between the production and destruction of reactive oxygen species (ROS), is responsible for various pathological disorders in human.1 Efficient ROS detoxification is particularly considered important in keratinocytes because they are constantly challenged by extracellular oxidants and electrophiles.2 To combat against these insults, keratinocytes possess diverse antioxidants, such as ascorbic acid (vitamin C), tocopherol (vitamin E), and reduced glutathione (GSH).3 In addition, keratinocytes are equipped with a number of phase II cytoprotective enzymes as well, such as hemoxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO1) and glutamate- cysteine ligases (GCLs), all of which contribute to maintaining the redox balance in keratinocytes through diverse mechanisms of action.4 Transcription of phase II cytoprotective enzymes are under the control of a single transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2).5 Under normal condition, Kelch-like ECH-associated protein 1 (Keap1) retains Nrf2 in the cytoplasm and constantly targets it for poly-ubiquitination and proteasomal degradation.6 In response to oxidative or electrophilic stress, however, Nrf2 is released from Keap1 and translocates into the nucleus, where it binds to and activates the antioxidant response element (ARE), a cis-acting DNA element located in the promoter of most phase II cytoprotective enzymes.7 Follow- up mechanism-based studies have demonstrated that the Nrf2/ARE-dependent phase II cytoprotective gene activation can occur via two ways: (1) a direct conjugation and subsequent inactivation of Keap1 by oxidants or electrophiles or (2) phosphorylation of intracellular signaling pathways leading to Nrf2 transactivation.8 Plants are the most utilized natural resources due to their abundance and accessibility.9 Therefore, exploring novel plant ingredients or extracts that can activate the Nrf2/ ARE-dependent gene expression has been recently proposed as an efficient strategy to inhibit or delay the rate of aging and carcinogenesis progression. In the present study, we have acquired 100 ethanol extracts of indigenous plants of Jeju island, Korea and attempted to find new ethanol extract(s) that can stimulate the Nrf2/ARE-dependent gene expression.

MATERIALS AND METHODS

Cell culture, chemicals and reagents

Ethanol extracts of 100 indigenous plants of Jeju island (Table 1) were directly purchased from Jeju Technopark (Jeju, Korea). RPMI-1640 medium, heat-inactivated FBS, PBS, and 100× penicillin/streptomycin (Pen/Strep) were purchased from Welgene (Daegu, Korea). Human keratinocyte HaCaT cells were cultured in RPMI-1640 medium, containing 10% heat-inactivated FBS and 1× Pen/Strep at 37°C in humidified 5% CO2 incubator. Polyclonal antibodies against HO-1 and NQO1 were purchased from Enzo Life Sciences (Farmingdale, NY, USA) and Abcam (Cambridge, MA, USA), respectively. Primary antibody against Nrf2 and horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Bovine serum albumin (BSA), MTT and primary antibodies against 8’-hydroxyguanosine (8-OH-G) and actin were purchased from Sigma (St. Louis, MO, USA). Total and phospho-specific Akt1 antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). Fluorescein isothiocyanate (FITC)-conjugated secondary antibody was purchased from Jackson ImmunoResearch (West Grove, PA, USA). Paraformaldehyde, bicinchoninic acid (BCA) protein assay kit, and polyvinylidene fluoride (PVDF) membranes were purchased from Millipore (Billerica, MA, USA). pGreenFire reporter plasmid was purchased from System Biosciences (Mountain View, CA, USA). pMD2.G and psPAX.2 lentiviral helper plasmids were acquired from Addgene (Cambridge, MA, USA).
Table 1.

List of ethanol extract of indigenous plants from Jeju island, Korea No.

No.ExtractNo.Extract
1Euphorbia jolkini Boiss51Wistaria floribunda A.P. DC
2Raphanus sativus var. hortensis f. raphanistroides Makino52Paliurus ramosissimus (Lour)
3Korthalsella japonica Engl.53Hibiscus hamabo S. et Z
4Neolitsea sericea (BL.) Koidz.54Callicarpa japonica Thunb
5Cinnamomum japonicum Sieb.55Torreya nucifera S. et Z
6Lycopodium clavatum var. nipponicum Nakai56Sapindus mukorossi Gaertner
7Stauntonia hexaphylla (Thunb.) Decne.57Meliosma oldhamii Miq
8Pyrrosia lingua (Thunb.) Farwell58Rhus chinensis Mill.
9Cyrtomium falcatum (L.) Presl59Corylus sieboldiana Bl.
10Hedera rhombea (Miq.) Bean60Albizzia julibrissin Durazz
11Gleichenia japonica Spreng61Xylosma congestum (Lour.) Merr.
12Neolitsea aciculata (Bl.) Koidz.62Ulmus davidiana var. japonica (Rehder) Nakai
13Fatsia japonica Decne. et Planch.63Zanthoxylum ailanthoides S.
14Cyclosorus acuminatus (Houtt.) Nakai ex H.Ito64Actinodaphne lancifolia (S. et Z) Meisn
15Eribotrya japonica Lindl.65Celtis sinensis Pers
16Machilus thunbergii S. et Z.66Sapium sebiferum (L.) ROXB.
17Actinodaphne lancifolia (S. et Z.) Meisn67Securinega suffruticosa Rehder.
18Buxus microphylla var. koreana Nakai68Kalopanax pictus (Thunb.) Nakai
19Ternstroemia japonica Thunb.69Caragana sinica (Buchoz) Rehder
20Citrus junos Sieb. ex Tanaka70Oenothera odorata Jacq.
21Daphniphyllum macropodum D. glaucescens Blume71Platycodon grandiflorum (Jacq.) A. DC.
22Ilex crenata Thunb. var. convexa Makino72Ampelopsis brevipedunculata var. heterophylla (Thunb.) Hara
23Ligustrum lucidum Ait.73Cirsium japonicum var. ussuriense Kitamura
24Cinnamomum camphora Sieb.74Platanus orientalis L.
25Pittosporum tobira Ait.75Oenothera erythrosepala Borbas
26Ilex crenata var. microphylla Max.76Euphorbia supina Rafin.
27Citrus tangerina Hort.ex Tanaka77Plantago asiatica L.
28Vicia angustifolia var. segetilis K. Koch.78Aleurites fordii Hemsl.
29Brassica campestris subsp. napus var. nippo-oleifera Makino79Euphorbia humifusa Willd.
30Artemisia fukudo Makino80Vicia unijuga A. Br.
31Lathyrus japonica Willd.81Loranthus yadoriki Sieb.
32Sonchus oleraceus L.82Solanum nigrum L.
33Rosa multiflora Thunb.83Brassica juncea var. integrifolia Sinsk.
34Atremisia sp.84Daphniphyllum macropodum Miq.
35Asparagus cochinchinensis Merr.85Ligustrum lucidum Ait.
36Rumex acetocella L.86Cayratia japonica (Thunb.) Gagnepain
37Angelica japonica A. Gray87Broussonetia papyrifera (L.) L’ Heriter ex Ventenat
38Lindera erythrocarpa Makino88Sasa palmata (Bean) Nakai
39Acer mono Max.89Kadsura japonica (L.) Dunal
40Akebia quinata DECNE.90Vaccinium bracteatum Thunb.
41Saururus chinensis Baill.91Sedum bulbiferum Makino
42Acanthopanax koreanum Nakai92Persicaria sp.
43Pteridium aquilinum var. latiusculum (Desv.) Underw.93Eupatorium lindleyanum DC.
44Plantago lanceolata L.94Sapium japonicum (Sieb. et Zucc.) Pax et Hoffmann
45Cornus controversa Hemsl.95Maackia fauriei (Lev.) Takeda
46Cudrania tricuspidata (Carr.) Bureau ex Lavallee96Dendropanax morbiferum Leveille
47Actinidia arguta Planch.97Gleditsia japonica var. koraiensis (Nak.) Nakai
48Clerodendron trichotomum Thunb.98Euphorbia esula L.
49Boehmeria pannosa Nakai et Satake99Oenothera laciniata Hill.
50Eribotrya japonica Lindl.100Litsea japonica (Thunb.) Juss.

Generation of HaCaT-antioxidant response element-luciferase cells and measurement of luciferase activity

In order to generate HaCaT-ARE-luciferase reporter cells, we have subcloned 3× tandem ARE oligonucleotides (CACCGTGACTCAGGAATTCACCGTGACTCAGGAATT CACCGTGACTCAGGAATT with a core DNA sequence of ARE underlined) into pGreenFire reporter plasmid. 293T cells were then transfected with 3 μg pGreenFire-ARE plasmid together with 3 μg pMD2.G and 3 μg psPAX.2 plasmids, using JetPEI reagent (Polyplus-Transfection, New York, NY, USA). After 72 hours, lentiviral supernatant was collected and filtered, using a 0.45 μm syringe filter. HaCaT cells were transduced with lentiviral supernatant containing 10 μg/mL polybrene for 12 hours at 37°C and further selected with 3 μg/mL puromycin for 48 hours. Established HaCaT-ARE-luciferase cells were seeded on 70% confluence in six-well plate and exposed to individual plant ethanol extracts at the concentration of 200 μg/mL. After 24 hours, cells were lysed with luciferase lysis buffer (0.1 M potassium phosphate buffer at pH 7.8, 1% Triton X-100, 1 mM dithiothreitol, 2 mM EDTA) and the resulting luciferase activity was measured by GLOMAX Multi-system (Promega, Madison, WI, USA). The data is depicted as a fold ratio of the firefly luciferase activity, compared with the control after normalization with protein concentration and the statistical analysis was conducted by Student t-test with n = 6.

Western blot analysis

After appropriate treatment, HaCaT cells were collected by centrifugation and resuspended with 200 μL RIPA buffer (50 mM Tris-HCl at pH 8.0, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, protease inhibitors cocktail) and incubated on ice for 1 hour. After collection of cell lysates by centrifugation, protein concentration was measured by BCA Protein Assay Kit (Thermo Fisher, Pittsburgh, PA, USA). Equal amounts of cell lysates were resolved by SDS PAGE and transferred to PVDF membrane. The membrane was incubated in blocking buffer (5% skim milk in 1× PBS-0.1% Tween-20, PBST) for 1 hour and hybridized with the appropriate primary antibodies in 1× PBS containing 3% BSA (in the case of phospho-specific Akt1) or 3% skim milk (in the case of total proteins) overnight at 4°C. After washing three times with 1× PBST for 30 minutes, the membrane was hybridized with appropriate HRP-conjugated secondary antibody for 1 hour at room temperature and washed three times with 1× PBST solution for 30 minutes. The membrane was visualized by using an enhanced chemiluminescence detection system. Actin blot was used as control for an equal loading of samples.

Determination of intracellular reduced glutathione level

The intracellular GSH level was measured using reduced glutathione detection kit as recommended by the manufacturer (Enzo Life Sciences).

MTT assay

HaCaT cells (3 × 104 cells/100 μL/well) were plated in 96-well culture plates in quadruplicate. After appropriate treatment, cells were exposed to 50 μL MTT stock solution (2 mg/mL) for 4 hours. HaCaT cells were then washed with 1× PBS and lysed with 50 μL DMSO. Measurement using spectrophotometer was conducted at the wavelength of 540 nm and the percentage of viable cells was plotted in comparison with the control group.

Detection of intracellular 8-hydroxyguanosine level

In order to measure the changes in the intracellular 8-OH-G level, HaCaT cells grown on a slice glass were incubated with blocking serum (1% BSA) for 30 minutes. After washing with 1× PBS three times, cells were hybridized with primary antibody against 8-OH-G overnight at 4°C. After washing with 1× PBS three times, the slides were probed with FITC-conjugated rabbit secondary antibody and the fluorescent images were obtained with a C2 confocal microscope (Nikon Korea, Seoul, Korea).

RESULTS

Identification of ethanol extract of Cirsium japonicum var. ussuriense Kitamura as a novel inducer of antioxidant response element-dependent gene expression

To find out novel plant extracts that stimulate the ARE-dependent gene expression among ethanol extracts of 100 indigenous plants of Jeju island, Korea, we have exposed HaCaT ARE luciferase cells to individual natural extracts at the concentration 200 μg/mL for 24 hours and measured the resulting luciferase activity. While many extracts exhibited stimulatory or inhibitory effects on ARE-dependent luciferase activation, we observed that ethanol extract of C. japonicum var. ussuriense Kitamura (ECJUK; No. 73) exerted particularly strong stimulatory effect, whose ARE activation level was equivalent to that by 10 μM sulforaphane, a positive control in the experiment (Fig. 1A). Supporting this observation, an exposure to ethanol extract of ECJUK caused a concentration-dependent ARE-dependent gene activation in HaCaT ARE-luciferase cells (Fig. 1B). These results illustrate that ECJUK possesses strong stimulatory effect on ARE-dependent gene expression.
Figure 1.

Ethanol extract of Cirsium japonicum var. ussuriense Kitamura (ECJUK) induces antioxidant response element (ARE)-dependent gene expression in HaCaT cells. (A) Effects of ethanol extracts of 100 indigenous plants from Jeju island, Korea on the ARE-dependent luciferase activity in HaCaT ARE-luciferase cells. (B) Concentration-dependent increase in ARE-dependent luciferase activity in HaCaT-ARE-luciferase cells after ECJUK treatment. After an exposure of various concentrations of ECJUK to HaCaT-ARE-luciferase cells, the luciferase assay was conducted as described. Sulforaphane (SFN) was used as a positive control. The data is depicted as a fold ratio of the firefly luciferase activity, compared with the control group and statistical analysis was conducted by Student t-test with n = 6. Symbols indicate a statistically significance with **P < 0.01 and ***P < 0.001.

Cirsium japonicum var. ussuriense Kitamura induces the expression of phase II cytoprotective enzymes in HaCaT cells through nuclear factor erythroid 2-related factor 2-dependent transcriptional activation

We next examined whether ECJUK could induce the expression of Nrf2 and phase II cytoprotective enzymes in HaCaT cells. To this end, HaCaT cells were exposed to ECJUK at various times and Western blotting was conducted. As a result, we observed that ECJUK induced the expression of Nrf2 and phase II cytoprotective enzymes (HO-1 and NQO1). The induction of Nrf2, HO-1, and NQO1 was closely associated with phosphorylation of Akt1 (Fig. 2A), a putative kinase that positively regulates the ARE-dependent gene expression.10 Real-time RT-PCR analysis illustrated that ECJUK stimulated transcription of HO-1 and NQO1 in HaCaT cells. Together, these results suggest that ECJUK induces Nrf2-dependent HO-1 and NQO1 expression, possibly via Akt1 phosphorylation.
Figure 2.

Nuclear factor erythroid 2-related factor 2 (Nrf2) induction of phase II cytoprotective enzymes by Cirsium japonicum var. ussuriense Kitamura (ECJUK) is mediated at the transcription level. (A) After an exposure of ECJUK to HaCaT cells, cell lysates were collected and Western blot analysis was conducted using appropriate antibodies. (B) After an exposure of ECJUK to HaCaT cells, the real-time RT-PCR was performed to measure the resulting hemoxyge-nase-1 (HO-1) and NAD [P]H:quinone oxidoreductase-1 (NQO1) mRNA levels. The data is depicted as a fold ratio of mRNA level, compared with the control group and statistical analysis was conducted by Student t-test. Symbols indicate a statistically significance with **P < 0.01 and ***P < 0.001.

Cirsium japonicum var. ussuriense Kitamura increases the amount of intracellular reduced glutathione and protects against ultraviolet B-mediated DNA damage

In addition to HO-1 and NQO1, Nrf2 is also responsible for transcriptional activation of GCL that boosts up the intracellular GSH level in response to oxidative stress. Therefore, we examined whether ECJUK could increase the intracellular GSH level in HaCaT cells. As a result, we found that ECJUK did not affect the overall viability of HaCaT cells (Fig. 3A). However, it significantly increased the intracellular GSH level (Fig. 3B) and inhibited 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced 8-OH-G formation (Fig. 3C). Overall, our results imply that ECJUK can activate ARE and increase the expression of Nrf2-dependent phase II cytoprotective enzymes, thereby contributing to maintaining the genome integrity against oxidative DNA damages.
Figure 3.

Cirsium japonicum var. ussuriense Kitamura (ECJUK) increases the intracellular reduced glutathione (GSH) level and protects HaCaT cells against oxidative DNA damage. After an exposure of ECJUK to HaCaT cells, (A) MTT assay was conducted to measure the cell viability and (B) the intracellular GSH level was measured as described. Symbols indicate a statistically significance with ***P < 0.001. (C) After an exposure of ECJUK to HaCaT cells, the intracellular 8-hydroxyguanosine (8-OH-G) level was visualized by immunofluorescence (IF) assay, using 8-OH-G antibody. TPA, 12-O-tetradecanoylphorbol-13-acetate; DAPI, 4′,6-diamidino-2-phenylindole.

DISCUSSION

Because Nrf2 activation plays a key role in the protection against oxidative stress, it was surmised that finding out novel compounds that can boost up the Nrf2 activity might be useful for treatment of pro-inflammatory diseases. In this sense, two recent clinical trials showed a simultaneous failure and success of Nrf2 activators as potential drug candidates.11 Because the methyl ester derivative of the synthetic triterpenoid, 2-cyano-3, 12-dioxooleana-1,9(11)-dien-28-oic acid (CDDO-Me) induces Nrf2 at low nanomolar concentrations, it underwent an initial development as a promising drug candidate under the generic name, bardoxolone methyl for treatment of advanced chronic kidney disease and type-2 diabetes mellitus. However, this clinical trial was terminated in the phase III phase for safety concerns. On the other hand, dimethylfumarate, a synthetic Nrf2 activator, has been developed for treatment of multiple sclerosis (MS) and recently approved by the Food and Drug Administration under the trade name of Tecfidera. In the present study, we have identified ECJUK possesses significant stimulatory effect on the Nrf2/ARE-dependent gene expression in HaCaT-ARE-luciferase reporter cells (Fig. 1). We also showed that ECJUK increased the expression of Nrf2 and phase II cytoprotective enzymes, e.g., HO-1 and NQO1 (Fig. 2) and that it protected against TPA-induced oxidative DNA damage in HaCaT cells (Fig. 3). Previous studies have demonstrated that C. japonicum induced adipocyte differentiation12 and exhibited pro-apoptotic effects in MCF-7 cells.13 Although detailed mechanisms of action of C. japonicum extract are currently unknown, it is possible that the above-mentioned biological effects could be mediated by Nrf2/ARE-dependent molecular mechanisms. A recent activity-guided fractionatons by Lai et al.14 have identified phenylacrylic acid esters and new polyacetylenes existing in C. japonicum var. australe as major constituents. In another study, Zhang et al.15 have conducted LC–MS/MS determination and identified seven flavonoids, including pectolinarin, linarin, pectolinarigenin, hispidulin, diosmetin, acacetin, and apigenin in rat plasma after oral administration of C. japonicum DC. extract. At present, we are unaware which compounds primarily exist in ECJUK and the activity-guided fractionation is necessary to identify the lead compound(s) contributing to the Nrf2/ARE-dependent gene expression in ECJUK.
  15 in total

Review 1.  Nrf2 as a master redox switch in turning on the cellular signaling involved in the induction of cytoprotective genes by some chemopreventive phytochemicals.

Authors:  Young-Joon Surh; Joydeb Kumar Kundu; Hye-Kyung Na
Journal:  Planta Med       Date:  2008-10-20       Impact factor: 3.352

2.  Bioactive constituents of Cirsium japonicum var. australe.

Authors:  Wan-Chun Lai; Yang-Chang Wu; Balázs Dankó; Yuan-Bin Cheng; Tusty-Jiuan Hsieh; Chi-Ting Hsieh; Yu-Chi Tsai; Mohamed El-Shazly; Ana Martins; Judit Hohmann; Attila Hunyadi; Fang-Rong Chang
Journal:  J Nat Prod       Date:  2014-07-15       Impact factor: 4.050

Review 3.  Regulation of Nrf2-an update.

Authors:  Suryakant K Niture; Raju Khatri; Anil K Jaiswal
Journal:  Free Radic Biol Med       Date:  2013-02-19       Impact factor: 7.376

Review 4.  Stress-activated cap'n'collar transcription factors in aging and human disease.

Authors:  Gerasimos P Sykiotis; Dirk Bohmann
Journal:  Sci Signal       Date:  2010-03-09       Impact factor: 8.192

5.  LC-MS/MS determination and pharmacokinetic study of seven flavonoids in rat plasma after oral administration of Cirsium japonicum DC. extract.

Authors:  Zhiyong Zhang; Peipei Jia; Xiaoxu Zhang; Qiaoyue Zhang; Haotian Yang; He Shi; Lantong Zhang
Journal:  J Ethnopharmacol       Date:  2014-10-23       Impact factor: 4.360

6.  Cirsium japonicum flavones enhance adipocyte differentiation and glucose uptake in 3T3-L1 cells.

Authors:  Zhiyong Liao; Zhihua Wu; Mingjiang Wu
Journal:  Biol Pharm Bull       Date:  2012       Impact factor: 2.233

Review 7.  Regulation of the Keap1/Nrf2 system by chemopreventive sulforaphane: implications of posttranslational modifications.

Authors:  Young-Sam Keum
Journal:  Ann N Y Acad Sci       Date:  2011-07       Impact factor: 5.691

8.  Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain.

Authors:  K Itoh; N Wakabayashi; Y Katoh; T Ishii; K Igarashi; J D Engel; M Yamamoto
Journal:  Genes Dev       Date:  1999-01-01       Impact factor: 11.361

Review 9.  Reactive oxygen species, cellular redox systems, and apoptosis.

Authors:  Magdalena L Circu; Tak Yee Aw
Journal:  Free Radic Biol Med       Date:  2010-01-04       Impact factor: 7.376

Review 10.  Regulation of Nrf2-Mediated Phase II Detoxification and Anti-oxidant Genes.

Authors:  Young-Sam Keum
Journal:  Biomol Ther (Seoul)       Date:  2012-03       Impact factor: 4.634

View more
  6 in total

1.  Effects of Hypericum Scabrum extract on anxiety and oxidative stress biomarkers in rats fed a long-term high-fat diet.

Authors:  Ahmad Ganji; Iraj Salehi; Abdolrahman Sarihi; Siamak Shahidi; Alireza Komaki
Journal:  Metab Brain Dis       Date:  2016-12-15       Impact factor: 3.584

Review 2.  Research progress on skin photoaging and oxidative stress.

Authors:  Xi Chen; Chunsheng Yang; Guan Jiang
Journal:  Postepy Dermatol Alergol       Date:  2022-01-07       Impact factor: 1.664

3.  Hispidulin-7-O-Neohesperidoside from Cirsium japonicum var. ussuriense Attenuates the Production of Inflammatory Mediators in LPS-Induced Raw 264.7 Cells and HT-29 Cells.

Authors:  Jong Cheol Park; Hyunji Yoo; Cho Een Kim; Sun-Yup Shim; Mina Lee
Journal:  Pharmacogn Mag       Date:  2017-11-13       Impact factor: 1.085

4.  Comparison of the Hepatoprotective Effects of Four Endemic Cirsium Species Extracts from Taiwan on CCl₄-Induced Acute Liver Damage in C57BL/6 Mice.

Authors:  Zi-Wei Zhao; Jen-Chih Chang; Li-Wei Lin; Fan-Hsuan Tsai; Hung-Chi Chang; Chi-Rei Wu
Journal:  Int J Mol Sci       Date:  2018-04-30       Impact factor: 5.923

5.  E-p-Methoxycinnamoyl-α-l-rhamnopyranosyl Ester, a Phenylpropanoid Isolated from Scrophularia buergeriana, Increases Nuclear Factor Erythroid-Derived 2-Related Factor 2 Stability by Inhibiting Ubiquitination in Human Keratinocytes.

Authors:  Jiwon Jeong; Lilik Duwi Wahyudi; Young-Sam Keum; Heejung Yang; Jung-Hwan Kim
Journal:  Molecules       Date:  2018-03-27       Impact factor: 4.411

6.  Current evidence to support the therapeutic potential of flavonoids in oxidative stress-related dermatoses.

Authors:  Dehai Xian; Menglu Guo; Jixiang Xu; Yang Yang; Yangmeng Zhao; Jianqiao Zhong
Journal:  Redox Rep       Date:  2021-12       Impact factor: 4.412

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.