Literature DB >> 27051186

Detection of Clostridium perfringens alpha toxin gene in lambs by loop mediated isothermal amplification.

B Radhika1, N Vinod Kumar2, D Sreenivasulu2.   

Abstract

AIM: The loop mediated isothermal amplification (LAMP) was standardized for rapid detection of Clostridium perfringens.
MATERIALS AND METHODS: A total of 120 fecal samples were collected from enterotoxemia suspected lambs were used for screening of C. perfringens cpa gene by LAMP. The specificity of the LAMP amplified products was tested by digesting with restriction enzyme XmnI for alpha toxin gene.
RESULTS: Out of 120 samples screened 112 (93.3%) samples were positive by both LAMP and polymerase chain reaction (PCR) for detection of cpa gene which indicated the equal sensitivity of both the tests. The enzyme produced single cut in 162 base pair amplified product of alpha toxin gene at 81 base pair resulting in a single band in gel electrophoresis.
CONCLUSION: Both LAMP and PCR for detection of cpa gene indicated the equal sensitivity of both the tests. Standardization of LAMP reaction for amplification of epsilon and beta toxin genes will help to identify the C. perfringens toxin types from the clinical samples. The test could be a suitable alternative to the PCR in detection of toxin types without the help of sophisticated machinery like thermal cycler. Considering its simplicity in operation and high sensitivity, there is the potential use of this technique in clinical diagnosis and surveillance of infectious diseases.

Entities:  

Keywords:  Clostridium perfringens; enterotoxemia; lambs; loop mediated isothermal amplification

Year:  2016        PMID: 27051186      PMCID: PMC4819352          DOI: 10.14202/vetworld.2016.60-64

Source DB:  PubMed          Journal:  Vet World        ISSN: 0972-8988


Introduction

The Clostridium perfringens is a Gram-positive anaerobic, spore forming, rod-shaped bacteria that commonly found in the gastrointestinal tract of both humans and animals [1]. The organism is classified into five toxinotypes (A to E) based on the production of four major toxins, namely alpha (cpa), beta (cpb), epsilon (etx), and iota (itx). C. perfringens Type A is implicated in ovine and caprine enterotoxemia in some parts of the world. The cpb2 producing C. perfringens Type A has also been linked to disease in several animal species, including sheep and goats and poultry [2,3]. Various polymerase chain reaction (PCR) protocols including multiplex PCR assays have been established to genotype C. perfringens isolates [4,5]. PCR got several intrinsic disadvantages, such as requirement of thermal cycling, time-consuming, post-PCR analysis, and high-risk for cross-contamination [6]. Loop mediated isothermal amplification (LAMP) is a novel nucleic acid amplification which relies on auto-cycling strand displacement DNA synthesis performed by the BstDNA polymerase large fragment [7-10]. Taking above factors into consideration, attempts were made in the present study to develop LAMP with ease of operation for amplification of cpa gene of C. perfringens.

Materials and Methods

Reference strain

C. perfringens Type D reference strain (Microbial Type Culture Collection [MTCC]No.49) was obtained from MTCC, Chandigarh was used for standardization of LAMP and as positive control for multiplex PCR reactions. The DNA was extracted from 24 h culture of C. perfringens reference strains by phenol-chloroform-isoamylalcohol method [11].

Collection and processing of samples

A total of 120 dung samples were collected from enterotoxemia suspected lambs of 1-3 months age group. The samples were collected aseptically with sterile swabs and transferred to the lab under ice within 1-2 h. Samples were suspended in sterile phosphate buffer saline and kept in the water bath at 80°C for 5-10 min to eliminate enteric contaminant. The supernatant was inoculated into Robertson’s cooked meat medium and incubated anaerobically with anaerobic gas pack (BD, USA) in anaerobic gas jar at 37°C for 24 h. The DNA was extracted from the 24 h broth culture by boiling method and the sample was preserved at −20°C.

Primer design

Toxin gene specific LAMP primers were designed on the basis of the published sequence of cpa gene of C. perfringens (GenBank accession number, JX091649) with the LAMP primer design software program Primer Explorer V4, from Ekin Chemical Company, Japan (http://primerexplorer.jp/elamp3.0.0/index.html). A set of four AT-rich primers comprising two outer and two inner primers were designed. The two outer primers were known as the forward outer primer (F3) and the backward outer primer (B3), which helps in strand displacement. The inner primers were known as the forward inner primer (FIP) and the backward inner primer (BIP), respectively. FIP contains F1C (complementary to F1), a TTTT spacer and the F2 sequence. BIP contains the B1C sequence (complementary to B1), a TTTT spacer and B2 sequence. The primer details and location were given in Table-1 and Figure-1. Theprimers were procured from Eurofins Genomics India Pvt. Ltd., Bengaluru.
Table-1

Primers used in LAMP for cpa gene amplification.

Oligoname5’position3’positionLengthTmGC content (%)Sequence
F33513752556.4532AGGAAAGTGTCTTTTAATAGTGTAG
B35375582257.3041GCATAGTCTTGGAATTCCTACA
FIP47GAGTTGGAACTTTTGCTTATGCAG-
TCAGCAAGACTTTTAAGATCCTC
BIP44AGCACCTTGTTCAAATTTTTCTCTT-
ACTAGAAGCCTTGCTGTAG
F23763982357.9439TCAGCAAGACTTTTAAGATCCTC
F1c4164392460.5942GAGTTGGAACTTTTGCTTATGCAG
B25185361955.4947ACTAGAAGCCTTGCTGTAG
B1c4714952560.1232AGCACCTTGTTCAAATTTTTCTCTT

LAMP=Loop mediated isothermal amplification, FIP=Forward inner primer, BIP=Backward inner primer

Figure-1

Loop mediated isothermal amplification primers location Clostridium perfringens plc gene.

Primers used in LAMP for cpa gene amplification. LAMP=Loop mediated isothermal amplification, FIP=Forward inner primer, BIP=Backward inner primer Loop mediated isothermal amplification primers location Clostridium perfringens plc gene.

Standardization of LAMP reaction

The enzyme Bsm DNA polymerase was procured from Thermo Scientific, Inc. The LAMP was standardized to determine optimum concentrations of primers, enzyme, temperature and time combinations for amplification of cpa gene. Total volume made up to 25 µl using nuclease free water with MgCl2 (25 mM)-1 µl; Bsm buffer (×10)-2.5 µl; dNTP mix (10 mM)-3.5 µl; Bsm DNA polymerase (8 U/µl) – 1 µl; temple (target DNA) – 2 µl; F3 (10 pmol/µl) – 1 µl; B3 (10 pmol/µl) – 1 µl; FIPα (40 pmol/µl) - 4 µl; BIP (40 pmol/µl) - 4 µl; nuclease-free water – 5 µl.

LAMP amplification

The LAMP amplification was done in hot water bath with thermostat by the following steps with negative controls added with nuclease free water in place of template DNA. In the initial reaction nuclease free water, Bsm buffer (×10), dNTP mix and template were added into ependorff tube with initial denaturation at 95°C for 5 min. After chilling the samples for 30 s to 1 min, outer primers, inner primers and enzyme were added. LAMP reaction was allowed for 60 min at 55°C followed by enzyme inactivation step for 10 min at 80°C. The amplified LAMP products were stored at −20°C. LAMP amplification reaction was carried out in hot water bath at 55°C for 60 min. Enzyme inactivation was carried out after completion of reaction at 80°C for 10 min. The amplified LAMP products were stored at−20°C.

Electrophoresis of LAMP products

LAMP products were subjected to agarose gel electrophoresis with 3.0% agarose in tris-borate-ethylenediaminetetraacetic acid buffer with ethidium bromide at 5 µg/ml in genie submerged gel apparatus at 35 mA and amplified products were visualized under ultraviolet (UV) transilluminator and photographed with gel documentation system (Alpha Innotech, Alphaimager, HP).

Testing the specificity of LAMP for cpa using restriction enzyme

To confirm that the amplification product had corresponding DNA sequences, the amplified product was digested with restriction enzyme Xmnl (New England Biolabs) with suitable controls. 9 µl of the LAMP product was treated with the restriction enzyme- 1µl; NE buffer (×10) – 1 µl and incubated at 37°C for 15 min. The product was subjected to electrophoresis for 1 h and visualized under UV transilluminator and photographed using gel documentation system.

LAMP amplification of clinical samples

The reaction mixture was prepared, and LAMP was run as described earlier, with DNA extracted described earlier and visualized under UV-transilluminator.

Screening of clinical samples by PCR

All the 24 h broth culture, samples were screened by PCR for the presence of cpa gene as per the standard protocol [5].

Comparison of diagnostic sensitivity of LAMP with PCR

Diagnostic sensitivity of LAMP was compared with PCR for detection of C. perfringens by testing 120 clinical samples by both the methods.

Results and Discussion

The enzyme Bsm polymerase large fragment with high functional similarity to Bst DNApolymerase, the large fragment was used successfully in the present study in place of Bst DNApolymerase. The enzyme concentration of 1.0 µl was found to be optimum for LAMP reaction in the present study (Figure-2). Same concentration of the Bst DNA polymerase enzyme was used by earlier workers for successful LAMP reaction for amplification of Bordetella pertussis, Capri poxviruses viral genome [6,12,13]. The outer primers concentration of 10 pmol/µl and 160 pmol/µl of inner primers (FIP and BIP) were found to be optimum for LAMP reaction in the present study (Figure-3). Similar combinations of outer and inner primers were successfully used previously for detection of enterotoxigenic C. perfringens from meat samples [14]. The double strandard DNA in LAMP reaction mixture will be in dynamic equilibrium at the temperature around 65°C and one of the LAMP primers could anneal to the complimentary sequence to initiate LAMP reaction. Hence, heat denaturation of the double strandard DNA into a single strand, like with PCR was not recommended in LAMP reaction [5]. However, initial denaturation step of template DNA was added in the present study to increase the reaction efficiency as recommended by several previous workers [6,12,13,15-17]. To confirm that the amplification product had corresponding DNA sequences in the present investigation, the amplified product was digested with restriction enzyme XmnI. The enzyme produced single cut at 81 bp within specific recognition sequences in the LAMP amplified product of size 162 bp (Figure-4). The product size was visualized as single band (Figure-5), similar methods were adopted by previous authors to test the specificity of the LAMP products during the amplification of west nile virus and coronovirus genome [6,10,17]. Out of 120 samples screened by LAMP for alpha toxin specific primers 112 (93.30%) samples showed amplification of alpha toxin gene in the samples. Similarly, PCR using 24 h broth culture of fecal samples collected from lambs revealed amplification of alpha toxins gene in all LAMP positive samples indicating similar sensitivity of LAMP and PCR. A similar type of comparison between reverse transcription (RT)-LAMP and RT-PCR was made and it was shown that RT-LAMP was more sensitive than RT-PCR for detection of SARS corona virus from the clinical sample [17]. Though LAMP was said to be having advantages over PCR, the inability of multiplexing in LAMP for simultaneous amplification of more than one gene which is possible with multiplex PCR cannot be over ruled [18]. Moreover, PCR is a basic technique of DNA amplification with several variants and potential applications in molecular biology apart from its use as a simple diagnostic tool.
Figure-2

Agarose gel electrophoresis of amplicons of alpha toxin gene of Clostridium perfringens with different enzyme concentration. L1: 0.5 µl/25 µl of reaction mixture, L2: 1.0 µl/25 µl of reaction mixture, L3: 1.5 µl/25 µl of reaction of mixture.

Figure-3

Agarose gel electrophoresis of amplicons alpha toxin gene of Clostridium perfringens with different primer concentration. L1: 10 pmol/µl (outer primers) and 40 pmol/µl (inner primer), L2: 10 pmol/µl (outer primers) and 80 pmol/µl (inner primers), L3: 10 pmol/µl (outer primers) and 160 pmol/µl (inner primers).

Figure-4

Restriction enzyme map for loop mediated isothermal amplification product of alpha toxin gene of Clostridium perfringens (BioEdit version 7.25 [12/11/2013] restriction mapping utility(c) 1998, Tom Hall, 162 base pairs).

Figure-5

Agarose gel electrophoresis of alpha toxin gene of Clostridium perfringens with restriction enzyme (Xmnl) treatment. M: 100 bp DNA ladder, L1: 81 bp band (positive), L2: Loop mediated isothermal amplification ladder pattern (untreated).

Agarose gel electrophoresis of amplicons of alpha toxin gene of Clostridium perfringens with different enzyme concentration. L1: 0.5 µl/25 µl of reaction mixture, L2: 1.0 µl/25 µl of reaction mixture, L3: 1.5 µl/25 µl of reaction of mixture. Agarose gel electrophoresis of amplicons alpha toxin gene of Clostridium perfringens with different primer concentration. L1: 10 pmol/µl (outer primers) and 40 pmol/µl (inner primer), L2: 10 pmol/µl (outer primers) and 80 pmol/µl (inner primers), L3: 10 pmol/µl (outer primers) and 160 pmol/µl (inner primers). Restriction enzyme map for loop mediated isothermal amplification product of alpha toxin gene of Clostridium perfringens (BioEdit version 7.25 [12/11/2013] restriction mapping utility(c) 1998, Tom Hall, 162 base pairs). Agarose gel electrophoresis of alpha toxin gene of Clostridium perfringens with restriction enzyme (Xmnl) treatment. M: 100 bp DNA ladder, L1: 81 bp band (positive), L2: Loop mediated isothermal amplification ladder pattern (untreated). Hence, comparison of LAMP with PCR should be limited only to diagnostic applications in clinical laboratories in the developing counties. Further, standardization of LAMP reaction for amplification of etx and cpb genes will help to identify the C. perfringens toxin types from the clinical samples. The test could be a suitable alternative to the PCR in detection of toxin types without help of sophisticated machinery like thermal cycler. Considering LAMPs simplicity in operation and high sensitivity, the test can be used for clinical diagnosis and surveillance of infectious diseases. To achieve these levels in resource-poor endemic areas, specimen processing methods, and a closed amplification and detection system need to be developed. This will facilitate the provision of a same-day testing strategy in even the most remote rural health facilities.

Conclusion

Based on the present study we conclude that 24 h broth cultures of the fecal samples collected from enterotoxemia suspected lambs could be used for amplification of C. perfringenscpa gene by LAMP and PCR. Further the study reveals the efficacy of toxin genotyping from the clinical samples, compared with the conventional isolation, in vitro and in vivo toxin detection methods. Identification of the prevailing C. perfringens toxin types in the region will help to understand the epidemiology of enterotoxemia in sheep, particularly in lambs which helps in developing suitable control measures.

Authors’ Contributions

BR is the student worked for MVSc thesis. NVK as a major guide designed and supervised the research work and prepared the manuscript. DS as a minor guide helped in work supervision and preparation of the manuscript.
  15 in total

1.  Loop-mediated isothermal amplification of DNA.

Authors:  T Notomi; H Okayama; H Masubuchi; T Yonekawa; K Watanabe; N Amino; T Hase
Journal:  Nucleic Acids Res       Date:  2000-06-15       Impact factor: 16.971

2.  Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation.

Authors:  Y Mori; K Nagamine; N Tomita; T Notomi
Journal:  Biochem Biophys Res Commun       Date:  2001-11-23       Impact factor: 3.575

3.  Loop-mediated isothermal amplification reaction using a nondenatured template.

Authors:  K Nagamine; K Watanabe; K Ohtsuka; T Hase; T Notomi
Journal:  Clin Chem       Date:  2001-09       Impact factor: 8.327

4.  Accelerated reaction by loop-mediated isothermal amplification using loop primers.

Authors:  K Nagamine; T Hase; T Notomi
Journal:  Mol Cell Probes       Date:  2002-06       Impact factor: 2.365

5.  Multiplex polymerase chain reaction assay for genotyping Clostridium perfringens.

Authors:  R R Meer; J G Songer
Journal:  Am J Vet Res       Date:  1997-07       Impact factor: 1.156

6.  Loop-mediated isothermal amplification for the rapid detection of Salmonella.

Authors:  Yukiko Hara-Kudo; Manabu Yoshino; Tadashi Kojima; Masanari Ikedo
Journal:  FEMS Microbiol Lett       Date:  2005-10-07       Impact factor: 2.742

7.  Detection by polymerase chain reaction of Clostridium perfringens producing epsilon toxin in faeces and in gastrointestinal contents of goats.

Authors:  F A Uzal; J J Plumb; L L Blackall; D O'Boyle; W R Kelly
Journal:  Lett Appl Microbiol       Date:  1996-07       Impact factor: 2.858

8.  Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.

Authors:  Ikuko Kaneko; Kazuaki Miyamoto; Kanako Mimura; Natsuko Yumine; Hirotoshi Utsunomiya; Shigeru Akimoto; Bruce A McClane
Journal:  Appl Environ Microbiol       Date:  2011-09-02       Impact factor: 4.792

9.  Development and evaluation of a novel loop-mediated isothermal amplification method for rapid detection of severe acute respiratory syndrome coronavirus.

Authors:  Thi Cam Thai Hong; Quynh Le Mai; Duc Vuong Cuong; Manmohan Parida; Harumi Minekawa; Tsugunori Notomi; Futoshi Hasebe; Kouichi Morita
Journal:  J Clin Microbiol       Date:  2004-05       Impact factor: 5.948

Review 10.  Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases.

Authors:  Manmohan Parida; Santhosh Sannarangaiah; Paban Kumar Dash; P V L Rao; Kouichi Morita
Journal:  Rev Med Virol       Date:  2008 Nov-Dec       Impact factor: 6.989

View more
  3 in total

Review 1.  Loop-mediated isothermal amplification (LAMP): a versatile technique for detection of micro-organisms.

Authors:  Y-P Wong; S Othman; Y-L Lau; S Radu; H-Y Chee
Journal:  J Appl Microbiol       Date:  2018-02-12       Impact factor: 3.772

2.  Rapid detection of Clostridium perfringens in food by loop-mediated isothermal amplification combined with a lateral flow biosensor.

Authors:  Thanawat Sridapan; Wanida Tangkawsakul; Tavan Janvilisri; Wansika Kiatpathomchai; Sirintip Dangtip; Natharin Ngamwongsatit; Duangjai Nacapricha; Puey Ounjai; Surang Chankhamhaengdecha
Journal:  PLoS One       Date:  2021-01-07       Impact factor: 3.240

3.  Immunogenicity of a newly developed vaccine against Clostridium perfringens alpha-toxin in rabbits and cattle.

Authors:  Mohamed J Saadh; Feras F Lafi; Adnan A Dahadha; Mohamed S Albannan
Journal:  Vet World       Date:  2022-07-07
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.