Literature DB >> 27046996

Isolation of Canine parvovirus with a view to identify the prevalent serotype on the basis of partial sequence analysis.

Gurpreet Kaur1, Mudit Chandra1, P N Dwivedi1, N S Sharma1.   

Abstract

AIM: The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type.
MATERIALS AND METHODS: A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV.
RESULTS: Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type.
CONCLUSION: It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.

Entities:  

Keywords:  Canine parvovirus; VP2 gene; madin darby canine kidney cell line; nested polymerase chain reaction; polymerase chain reaction

Year:  2015        PMID: 27046996      PMCID: PMC4777811          DOI: 10.14202/vetworld.2015.52-56

Source DB:  PubMed          Journal:  Vet World        ISSN: 0972-8988


Introduction

Diarrhea is a very common condition in dogs caused by various viral and bacterial causative agents. It has economic implications when a large number of dogs are affected in quick succession [1]. It is multifactorial and the origin of Canine parvovirus (CPV) though is not absolutely clear but phylogenetically originated from feline panleukopenia virus or a very closely related carnivore parvovirus of feral canids like foxes and mink [2]. CPV was first identified in 1978 and was referred as CPV-2 after distinguishing it from CPV-1 [3]. CPV is prone to genetic evolution and has undergone several mutations that have led to various antigenic variants of CPV-2 that have replaced the original CPV-2 [4]. Currently, there are three main antigenic variants, i.e. 2a, 2b and 2c circulating in the dog population worldwide [5]. CPV-2a and CPV-2b use both canine and feline transferrin receptors for binding to cells both in vitro and in vivo [6,7] thus can infect both dogs and cats. In contrast, CPV-2 can infect both canine and feline cells in vitro but infects only dogs in vivo [2]. The genome of CPV is about 5.3 Kb and VP2 plays an important role in the determination of antigenicity and host range of CPV [8-10]. Thus, mutations affecting VP2 are mainly responsible for the evolution of different antigenic variants [4]. Thus, knowledge of genetic variations of VP2 could be of immense help in identifying emerging CPV strains in a particular geographical area, which could be used for the development of area specific appropriate vaccine strain. The present study was undertaken to isolate CPV from suspected dogs in madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates were amplified and sequenced to determine prevailing antigenic types.

Materials and Methods

Ethical approval

This study was conducted after approval by the departmental research committee and the Institutional Animal Ethics Committee

Sample collection

Rectal swabs (n=60) were collected in phosphate buffered saline (PBS, pH 7.2) from the dogs exhibiting signs of gastroenteritis and/or hemorrhagic gastroenteritis from small animal veterinary clinics, GADVASU, Ludhiana from January, 2013 to January, 2014.

Preparation of virus inoculum

Rectal swab in PBS was squeezed, and the tube was centrifuged at 2000 × g for 15 min to collect supernatant in which 400 µl of chloroform was added. It was vortexed and incubated for 10 min at 4°C and re-centrifuged at 2000 rpm for 15 min to collect the supernatant that was stored at −20°C for virus isolation.

Isolation of virus

For the virus isolation, MDCK cell line was used in Dulbecco’s Modified Eagle’s Medium (DMEM) growth medium with 10% fetal bovine serum (FBS). In the 12- well cell culture plates when the monolayer was almost complete they were infected with 0.1 ml of the viral inoculum and incubated at 37°C for one and a half hour for the adsorption of the virus and then after washing three times, 1 ml DMEM with 1% FBS was added and incubated at 37°C for 3-4 days to observe cytopathic effects (CPE).

Harvesting of the virus

Cell lines irrespective of the appearance of CPE was subjected to three cycles of alternative freezing and thawing and the cell culture fluid was collected in a microcentrifuge tube and stored at −20°C to be used for further passaging. The samples not exhibiting CPE in the first passage were further subjected to 2nd and 3rd passage following the above-indicated protocol.

PCR and NPCR

In the CPE positive samples cell culture fluid was subjected to PCR and NPCR for confirmation of CPV. The DNA from the samples was extracted [11] and subjected to PCR by adding 15 µl of the template DNA, 5.0 µl of 10X PCR buffer (with 15 mM MgCl2), 1.0 µl of forward and reverse primer (25 pm/µl) each, 1.0 µl of dNTPs mix (10 mM each), 0.5 µl of MgCl2 (50mM), 1 U Taq DNA polymerase to make the final reaction of 50 µl using nuclease free water [12]. The reaction was put in a thermocycler (Veriti®, Life Technologies, USA) with 35 cycles of denaturation at 94°C for 60s, annealing at 55°C for 60 s, elongation at 72°C for 150 s and a final elongation at 72°C for 10 min. For the NPCR, primers used were as per Mizak and Rzezutka [12] following the same conditions as of PCR. NPCR reaction was set up by adding 5 µl of the PCR product, 2.5 µl of 10X PCR buffer (with 15 mM MgCl2), 1.0 µl each of forward and reverse primer (25 pm/µl), 1.0 µl of dNTPs (10 mM each), 0.5µl MgCl2 (50 mM), 1 U Taq DNA polymerase and the final volume was made up to 25 µl by adding nuclease-free water. PCR and NPCR products (10 µl) were run using 1% agarose with ethidium bromide at 5 volts/cm with Gene Ruler ladder plus 100bp (New England Biolabs, USA). The gel was visualized and photographed using Gel documentation system (AlphaImager, USA).

Amplification of VP2 gene

DNA from five samples exhibiting CPE in MDCK cell lines and two vaccines (Nobivac DHPPi and Megavac-6) was extracted as per Sambrook and Russell [11]. Primer pairs for the amplification of VP2 gene were designed de novo using Primer3 [13] and used in the PCR. For the amplification of VP2 gene primers were designed from the whole genome of CPV (Accession no. M19296.1) The forward primer (5’- GGTCAACCTGCTGTCAGAAA -3’) had position 2816-2835 in the genome and the reverse primer (5’- AGGTGCTAGTTGAGATTTTTCAT -3’) had position 4525-4503 in the genome. The PCR was set up by adding 1µl of the template DNA, 10µl of 5X longAmp reaction buffer (with 2 mM MgSO4), 1.0 µl of forward and reverse primer (25 pm/µl) each, 1.0 µl of dNTPs mix (10 mM each), 0.5µl of MgCl2 (50 mM), 2.5 U LongAmp Hot start Taq DNA polymerase and the reaction was made up to 50 µl using nuclease-free water. The reaction was subjected to 35 cycles at 94°C for 60 s, 58°C for 60 s, 72°C for 150 s and a finally a single elongation at 72°C for 10 min. DNA from the vaccine was considered as positive and rectal swab from a healthy dog as a negative control. PCR product was run on 1% agarose with ethidium bromide at 5 volts/cm with Gene Ruler ladder 1Kb (New England Biolabs, USA) and was visualized and photographed using Gel documentation system (AlphaImager, USA).

Sequence analysis

For the sequencing PCR products were purified using Ultra Clean PCR cleanUp kit (MoBio Labs., Inc., USA) and the cleaned PCR products was sequenced from University of Delhi South Campus (UDSC), New Delhi. It was analyzed and compared with the available CPV sequences in the gene bank using NCBI BLAST http://blast.ncbi.nlm.nih.gov/blast.cgi [14] and Clustal Omega www.ebi.ac.uk/tools/msa/clustalo/[15].

Results

A total of 60 rectal swabs collected from January, 13-January 14 were processed for isolation in MDCK cell line when the monolayer was 80-90% complete. Out of 60 samples five exhibited CPE in the form of rounding within 24 h, clumping within 48 h and detachment within 72 h (Figure-1) of incubation.
Figure-1

Detachment of cells 72 h post-infection of madin darby canine kidney cell line at 10X magnification

Out of the five, four samples (P14, P41, P44, and P45) showed CPE in the first passage whereas P89 showed CPE in the 2nd passage. All the remaining samples did not exhibit any CPE even after the 3rd passage and were indicated negative. Detachment of cells 72 h post-infection of madin darby canine kidney cell line at 10X magnification Casewise analysis revealed that three CPE positive samples were from the dogs having hemorrhagic gastroenteritis; three CPE positive samples were from vaccinated dogs and three CPE positive samples were in the age group of 1-3 months (Table-1).
Table-1

Description of samples exhibiting cytopathic effects in MDCK cell line

SampleAge (months)SexBreedGastroenteritisVaccination statusType of vaccineBooster vaccination
P142.5MaleGerman shepherdNon-hemorrhagicDoneDHPPiNo
P415FemaleSaint bernardNon-hemorrhagicNot done--
P446FemaleLabredorHemorrhagicDoneDHPPiYes
P453MaleLabredorHemorrhagicNot done--
P893MaleGerman shepherdHemorrhagicDoneDHPPiNo

MDCK=Madin darby canine kidney

Description of samples exhibiting cytopathic effects in MDCK cell line MDCK=Madin darby canine kidney The DNA extracted from the samples was subjected to PCR and NPCR confirmed CPV by amplifying a 1198 bp product in PCR and 548 bp product in NPCR. For the sequence analysis, complete VP2 gene was amplified from all the five positive samples using PCR. All the positive samples amplified a 1710 bp product indicative of VP2 gene (Figure-2). The PCR products were cleaned using UltraClean PCR Clean-Up kit and send to the University of Delhi South Campus (UDSC), New Delhi for sequencing and were analyzed using NCBI BLAST and multiple sequence alignment software Clustal Omega. Based on the BLAST analysis four samples (P14, P44, P45 and P89) and vaccine strains had 100% homology with CPV whereas due to some problem sample P41 could not be sequenced, so it could not be analyzed.
Figure-2

PCR for the amplification of VP2 gene of canine parvovirus. Lane M- gene ruler 1Kb, lane 1- positive control, lane 2, 3, 5, 6, 7- samples and lane 4- negative control

PCR for the amplification of VP2 gene of canine parvovirus. Lane M- gene ruler 1Kb, lane 1- positive control, lane 2, 3, 5, 6, 7- samples and lane 4- negative control In the multiple sequence alignment, nucleotide sequences of the samples and the two vaccines were compared and aligned with already submitted VP2 nucleotide sequences viz., EU659116.1 (CPV-2), EU310373.2 (CPV-2a), JQ743893.1 (CPV-2b) and JF414822.1 (CPV-2c) revealed that there was a difference at the nucleotide position 2773, 2816, 2817, 2885, and 3189 in the samples and two vaccines with that of published sequences mentioned above depicted in the Table-2. From the multiple sequence alignment, it could be deduced that the two vaccines belonged to CPV-2 type and the samples were related to CPV-2b type.
Table-2

Sequence analysis of samples, vaccines and published VP2 sequences

Nucleotide position samples27732816281728853189CPV type
EU659116.1ATTGTCPV-2
EU310373.2TCTATCPV-2a
JQ743893.1TCCGTCPV-2b
JF414822.1TCTGCCPV-2c
V1 (DHPPi)ATTGTCPV-2
V2 (Megavac-6)ATTGCPV-2
Sample P14TCCGTCPV-2b
Sample P44TCCGTCPV-2b
Sample P45TCCGTCPV-2b
Sample P89TCCG-CPV-2b

CPV=Canine parvovirus

Sequence analysis of samples, vaccines and published VP2 sequences CPV=Canine parvovirus

Discussion

CPV causes acute hemorrhagic gastroenteritis in dogs and is prone to genetic evolution mainly due to the mutations in VP2 gene [4]. It spreads rapidly in the domestic as well as in the wild population of canines. The replication of virus takes place in the villus epithelium of the small intestine that are rapidly dividing and the virus is shed in large quantity in the feces particularly 4-7 days post infection [16] and infected feces serve as a source of infection thus, rectal swabs were collected from dogs exhibiting signs of gastroenteritis both for the isolation of virus and also for the amplification of VP2 gene in the present study. There are a number of methods that are used to diagnose CPV viz., virus isolation using cell culture, hemagglutination, hemagglutination inhibition, electron microscopy, indirect fluorescent test, enzyme-linked immunosorbent assay etc. [17] but PCR and NPCR are very handy and can be used for its detection as these have high sensitivity and specificity [18,19]. Rectal swabs (n=60) were collected, processed and subjected to isolation in MDCK cell line and the CPE was observed in five samples. Out of these five samples, 4 samples (P14, P41, P44 and P45) showed CPE in the first passage, but in one sample (P89) CPE was observed after the second passage. Parvoviruses are fastidious which are difficult to isolate in cell culture. Parvovirus replication is host-cell dependent and takes place only in actively dividing S-phase cells where cellular DNA polymerase is synthesized abundantly [20,21]. In an earlier study Kumar et al. [22] subjected 25 samples for isolation of the virus using MDCK cell line and showed that 9 samples had CPE. In another study, Nandi et al. [23] reported that out of a total of 13 samples 5 samples were positive by PCR but only two produced CPE in MDCK. Similarly, MohanRaj et al. [4] screened 77 samples by PCR and reported 51 positive using PCR but only 16 were positive when subjected to isolation in CRFK cell line. The genome of CPV is about 5.3 Kb and VP2 gene is the immunodominant protein. VP1/VP2 gene sequence is important in the determination of antigenic types based on the epitopes located on the VP2 capsid protein. The mutations affecting VP2 are mainly responsible for the evolution of different antigenic variants [4] since this gene is under positive selection in CPV, resulting in a significantly elevated rate of molecular evolution [16]. Thus, VP2 gene was amplified, sequenced and analyzed to study the prevailing antigenic types of CPV in dogs in Punjab. Many earlier workers too have studied VP2 gene of CPV to analyze the prevailing CPV strains [23-28]. In a study, it was also reported that there is a high genetic similarity among the CPV strains, and there is substantial variation from its original strain [26]. Sequence analysis from the samples and vaccine strains revealed that all these were having 100% homology with CPV. The two vaccines were related to CPV-2 type whereas samples were related to CPV-2b type. CPV-2b has been reported as the main sub-type followed by a smaller proportion belonging to CPV-2a in India [29], which is in alignment with our study. Further, Nandi et al. [23] sequenced and analyzed VP1/VP2 genes of two vaccines and a field strain, revealing that the isolate belonged to CPV-2b and the vaccine strains to be of CPV-2, which is in complete agreement with the results of this study.

Conclusion

It can be concluded from the above study that out of a total of sixty samples five samples exhibited CPE as observed in MDCK. Sequence analysis of the VP2 gene among the samples and vaccine strain revealed that samples belonged to CPV-2b type and vaccine belonging to CPV-2.

Authors’ Contributions

GK, MC and PND designed the study. GK conducted the experiment. GK and MC analysed the data and drafted the manuscript. NSS and PND helped in providing facility to conduct the research work. All authors read and approved the final manuscript.
  19 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  Phylogenetic analysis of canine parvovirus CPV-2 strains and its variants isolated in Poland.

Authors:  B Majer-Dziedzic; A Jakubczak; J Zietek
Journal:  Pol J Vet Sci       Date:  2011       Impact factor: 0.821

3.  Isolation, molecular characterization and phylogenetic analysis of canine parvovirus.

Authors:  J Mohan Raj; H K Mukhopadhyay; J Thanislass; P X Antony; R M Pillai
Journal:  Infect Genet Evol       Date:  2010-08-17       Impact factor: 3.342

4.  Replication of the parvovirus MVM. I. Dependence of virus multiplication and plaque formation on cell growth.

Authors:  P Tattersall
Journal:  J Virol       Date:  1972-10       Impact factor: 5.103

5.  A simple touch-down polymerase chain reaction for the detection of canine parvovirus and feline panleukopenia virus in feces.

Authors:  B Schunck; W Kraft; U Truyen
Journal:  J Virol Methods       Date:  1995-11       Impact factor: 2.014

6.  Canine and feline parvoviruses can use human or feline transferrin receptors to bind, enter, and infect cells.

Authors:  J S Parker; W J Murphy; D Wang; S J O'Brien; C R Parrish
Journal:  J Virol       Date:  2001-04       Impact factor: 5.103

7.  Recombination between vaccine and field strains of canine parvovirus is revealed by isolation of virus in canine and feline cell cultures.

Authors:  Masami Mochizuki; Takahisa Ohshima; Yumi Une; Akiko Yachi
Journal:  J Vet Med Sci       Date:  2008-12       Impact factor: 1.267

8.  The natural host range shift and subsequent evolution of canine parvovirus resulted from virus-specific binding to the canine transferrin receptor.

Authors:  Karsten Hueffer; John S L Parker; Wendy S Weichert; Rachel E Geisel; Jean-Yves Sgro; Colin R Parrish
Journal:  J Virol       Date:  2003-02       Impact factor: 5.103

9.  Genetic characterization of type 2a canine parvoviruses from Taiwan reveals the emergence of an Ile324 mutation in VP2.

Authors:  Chao-Nan Lin; Chi-Hsien Chien; Ming-Tang Chiou; Ling-Ling Chueh; Meng-Yu Hung; Han-Siang Hsu
Journal:  Virol J       Date:  2014-02-25       Impact factor: 4.099

10.  A minor groove binder probe real-time PCR assay for discrimination between type 2-based vaccines and field strains of canine parvovirus.

Authors:  Nicola Decaro; Gabriella Elia; Costantina Desario; Sante Roperto; Vito Martella; Marco Campolo; Alessio Lorusso; Alessandra Cavalli; Canio Buonavoglia
Journal:  J Virol Methods       Date:  2006-05-06       Impact factor: 2.014

View more
  1 in total

1.  Molecular characterization of canine parvovirus variants (CPV-2a, CPV-2b, and CPV-2c) based on the VP2 gene in affected domestic dogs in Ecuador.

Authors:  David De la Torre; Eulalia Mafla; Byron Puga; Linda Erazo; Claudete Astolfi-Ferreira; Antonio Piantino Ferreira
Journal:  Vet World       Date:  2018-04-16
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.