| Literature DB >> 27045402 |
Manoush Tohidirad1, Mehrdad Asghari Estiar, Azim Rezamand, Saeid Ghorbian, Sasan Andalib, Issa Jahanzad, Tayyeb Bahrami, Ebrahim Sakhinia.
Abstract
In the present study, our aim was to assess the incidence of BCL-1 gene rearrangements in formalin-fixed paraffin embedded (FFPE) tissue in patients with non-Hodgkin lymphomas (NHL). The BIOMED-2 protocol was applied to assess the BCL-1 gene rearrangements in NHL patients. PCR amplification was carried out on FFPE in 100 patients with B-cell lymphoma including 89 cases with diffused large B-cell lymphoma (DLBCL) (15 cases under 18 years old) and 11 cases with mantle cell lymphoma (MCL). Out of the 100 patients, 19 cases (19%) were identified to have concurrent translocation involving BCL-1. The significant association was seen between BCL-1 gene rearrangements and the lymphomas in patients older than 55 years (P<0.05). Out of 100 cases, 80 cases were positive and 20 cases were negative regarding CD20. No significant association was found between DLBCL lymphoma in patients under 18 years old and BCL-1 gene rearrangements (P>0.05). In addition, the positive and negative expressions of LCA/CD45 marker were 76% (76/100) and 26% (26/100), respectively. Our findings revealed that BCL-1 gene rearrangement assays using BIOMED-2 protocol can be considered as a valuable approach in detection of the lymphomas.Entities:
Year: 2016 PMID: 27045402 PMCID: PMC5016351 DOI: 10.5539/gjhs.v8n8p108
Source DB: PubMed Journal: Glob J Health Sci ISSN: 1916-9736
Primers used for the PCR amplification
| Name | Sequence |
|---|---|
| Bcl1/MTC | 5’ GGATAAAGGCGAGGAGCATAA 3’ |
| JH consensus | 3’ CCAGTGGCAGAGGAGTCCATTC 5’ |
Immunohistochemical and clinicopathological features of 19 patients with BCL-1 gene rearrangements
| ID | Age at Diagnosis | Sex | Histological Type | CD20 | LCA/CD45 |
|---|---|---|---|---|---|
| 61 | F | DLBCL | + | - | |
| 73 | F | MCL | + | + | |
| 59 | M | MCL | + | + | |
| 62 | M | DLBCL | + | - | |
| 74 | F | DLBCL | - | + | |
| 57 | F | MCL | + | + | |
| 70 | M | MCL | - | + | |
| 13 | M | DLBCL | + | + | |
| 70 | F | DLBCL | _ | + | |
| 45 | M | MCL | + | - | |
| 75 | F | DLBCL | _ | - | |
| 50 | M | MCL | _ | + | |
| 70 | M | MCL | + | - | |
| 71 | M | DLBCL | + | + | |
| 67 | M | DLBCL | + | - | |
| 62 | F | DLBCL | - | + | |
| 59 | F | DLBCL | - | + | |
| 22 | F | DLBCL | + | + | |
| 48 | M | DLBCL | - | - |