Literature DB >> 27036230

Characteristics of gliomas in patients with somatic IDH mosaicism.

Charlotte Bonnet1,2,3, Laure Thomas1, Dimitri Psimaras4, Franck Bielle5,6,7,8, Elodie Vauléon9, Hugues Loiseau10, Stéphanie Cartalat-Carel1, David Meyronet2,3,11, Caroline Dehais3, Jérôme Honnorat1,2,12, Marc Sanson4,6,7,8, François Ducray13,14,15.   

Abstract

IDH mutations are found in the majority of adult, diffuse, low-grade and anaplastic gliomas and are also frequently found in cartilaginous tumors. Ollier disease and Maffucci syndrome are two enchondromatosis syndromes characterized by the development of multiple benign cartilaginous tumors due to post-zygotic acquisition of IDH mutations. In addition to skeletal tumors, enchondromatosis patients sometimes develop gliomas. The aim of the present study was to determine whether gliomas in enchondromatosis patients might also result from somatic IDH mosaicism and whether their characteristics are similar to those of sporadic IDH-mutated gliomas. For this purpose, we analyzed the characteristics of 6 newly diagnosed and 32 previously reported cases of enchondromatosis patients who developed gliomas and compared them to those of a consecutive series of 159 patients with sporadic IDH-mutated gliomas. As was the case with sporadic IDH mutated gliomas, enchondromatosis gliomas were frequently located in the frontal lobe (54 %) and consisted of diffuse low-grade (73 %) or anaplastic gliomas (21 %). However, they were diagnosed at an earlier age (25.6 years versus 44 years, p < 0.001) and were more frequently multicentric (32 % versus 1 %, p < 0.001) and more frequently located within the brainstem than sporadic IDH mutated gliomas (21 % versus 1 %, p < 0.001). Their molecular profile was characterized by IDH mutations and loss of ATRX expression. In two patients, the same IDH mutation was demonstrated in the glioma and in a cartilaginous tumor. In contrast to sporadic IDH mutated gliomas, no enchondromatosis glioma harbored a 1p/19q co-deletion (0/6 versus 59/123, p = 0.03). The characteristics of gliomas in patients with enchondromatosis suggest that these tumors, as cartilaginous tumors, result from somatic IDH mosaicism and that the timing of IDH mutation acquisition might affect the location and molecular characteristics of gliomas. Early acquisition of IDH mutations could shift gliomagenesis towards the brainstem thereby mimicking the regional preference of histone mutated gliomas.

Entities:  

Keywords:  Glioma; IDH mutation; Maffucci; Ollier; Somatic mosaicism

Mesh:

Substances:

Year:  2016        PMID: 27036230      PMCID: PMC4818526          DOI: 10.1186/s40478-016-0302-y

Source DB:  PubMed          Journal:  Acta Neuropathol Commun        ISSN: 2051-5960            Impact factor:   7.578


Introduction

Mutations in the IDH1 or IDH2 genes are found in the majority of adult diffuse grade II and grade III gliomas and are considered as the earliest oncogenic event in these tumors [50]. These mutations result in the abnormal production of 2-hydroxyglutarate (2-HG) which is structurally similar to alpha-ketoglutarate. 2-HG competitively inhibits multiple alpha-ketoglutarate enzymes leading to histone and DNA hypermethylation, altered cell differentiation, activation of enzymes implicated in HIF degradation and PDGFRA overexpression [14, 26, 30, 47]. In addition to gliomas, IDH mutations are particularly frequent in cartilaginous tumors [2, 50]. Ollier disease and Maffucci syndrome are two rare non-hereditary enchondromatosis syndromes characterized by the development of multiple benign cartilaginous tumors (enchondromas). Enchondromas appear during childhood and may progress to chondrosarcomas in up to 30 % of cases [3, 36]. In Maffucci syndrome, enchondromas are associated with soft tissue hemangiomas. The analysis of IDH mutations in multiple cartilaginous tumors and non-neoplastic tissues from enchondromatosis patients led to the conclusion that these pathologies are due to early post-zygotic acquisition of IDH mutations, resulting in somatic mosaic mutations of IDH1 or IDH2 [3, 36]. In addition to skeletal tumors, enchondromatosis patients may develop other neoplasm including juvenile granulosa tumors, cholangiocarcinomas, pituitary adenomas, acute myeloid leukemia and gliomas. The aim of the present study was to determine whether gliomas in enchondromatosis patients might also result from somatic IDH mosaicism and whether their characteristics are similar to those of sporadic IDH-mutated gliomas. For this purpose, we analyzed the characteristics of 6 newly diagnosed and 32 previously reported cases of enchondromatosis patients who developed gliomas, and compared them to those of a consecutive series of 159 patients with sporadic IDH-mutated gliomas.

Materials and methods

We retrospectively reviewed the medical and radiological records of 6 patients with Ollier disease (n = 5) or Maffucci syndrome (n = 1) who were referred to our neuro-oncology departments (Pitié-Salpêtière Hospital in Paris, Hospices Civils of Lyon, CHU of Bordeaux and Rennes) for the diagnosis of glioma, as well as 159 consecutive patients who were diagnosed with an IDH1 or IDH2 mutated sporadic glioma between 2010 and 2014 (Hospices Civils of Lyon). Multicentric gliomas were defined as multiple gliomas without connecting T2/FLAIR signal abnormality and distinguished from multifocal gliomas (i.e. multiple gliomas with connecting T2/FLAIR signal abnormality) [1]. IDH mutations and 1p/19q co-deletion status were determined based on DNA extracted from blood and FFPE tumor using a standard protocol (Qiagen, QIAmp DNA mini Kit). IDH1 codon 132 and IDH2 codon 172 were sequenced using the Sanger method with the following primers: IDH1-Forward: TGTGTTGAGATGGACGCCTATTTG; IDH1-Reverse: TGCCACCAACGACCAAGTC; IDH2-Forward: GCCCGGTCTGCCACAAAGTC and IDH2-Reverse: TTGGCAGACTCCAGAGCCCA, as previously reported [21]. The 1p/19q co-deletion was determined based on the loss of heterozygosity technique (LOH) using microsatellite polymorphism markers as previously described [18]. In 3 patients, 1.5 μg of DNA extracted from frozen tumor tissue was outsourced to Integragen Company for the determination of the genomic profile based on Illumina SNP arrays [22]. In enchondromatosis gliomas, immunohistochemistry was performed on 4 μm thick sections of formalin-fixed paraffin embedded blocks with a Ventana Benchmark XT Device. The following antibodies were used after antigen retrieval to assess the expression of ATRX (anti-ATRX, Sigma, polyclonal, dilution 1/400), IDH1R132H (anti-IDH1R132H, Dianova, clone H09, dilution 1/50) and TP53 (clone DO.7, Dako, dilution 1/200). Previously reported cases of patients with Ollier disease or Maffucci syndrome who developed gliomas were identified through PubMed searches from January 1970 until September 2015 using the terms “Ollier disease”, “Maffucci syndrome”, “glioma” and “brain tumor”. We retrieved all relevant articles and checked additional references quoted in these articles. Categorical comparisons were performed using Fisher’s exact test and a t-test was used for quantitative variables. The threshold for statistical significance was p = 0.05.

Results

The characteristics of our 6 patients are presented in Table 1 and those of the 32 previously published patients are shown in Additional file 1: Table S1 [5–8, 11, 12, 15, 16, 19, 20, 23–25, 31–35, 37–40, 43–46, 48, 49]. The characteristics of all of the patients are summarized in Table 2.
Table 1

Clinical, histological and molecular characteristics of our 6 patients with enchondromatosis who developed glioma

Age at glioma diagnosis (years)SexHistology IDH mutation1p19q co-deletionATRX loss of expressionLocationMulti-centricHistory of chondrosarcomaSurvival (years)
Ollier disease
128FOAII IDH1 R132HNoYesT (n = 1),Fr (n = 1)YesNo2.5+
226M----Fr (n = 2)YesYes1+
330FOII IDH1 R132HNoYesFr (n = 1),T (n = 1)YesNo4
431MGBM IDH1 R132HNoYesFr (n = 2),P (n = 1)YesNo0.75
531FOAIII IDH1 R132HNoYesFrNoYes1.5+
Maffucci syndrome
630MOAII IDH2 R132SNoYesBNoNo3+

M male, F female, OAII/III grade II/III oligo-astrocytoma, OII grade II oligodendroglioma, GBM glioblastoma, −: data not available, T temporal, P parietal, Fr frontal, B brainstem, +: alive at last news

Table 2

Summary of the clinical, histological and molecular characteristics of Ollier disease (OD), Maffucci syndrome (MS), enchondromatosis (OD + MS) -present series and literature- and sporadic IDH mutated glioma patients

Ollier diseaseMaffucci syndromeEnchondro-matosisSporadic IDH mutated gliomasEnchondro-matosis versus sporadic IDH mutated glioma P-value
N281038159
N of gliomas451257161
Sex ratio (M/F)18/107/325/1391/680.4
Median age (years, range)24.7 (6–46)28.1 (17–39)25.6 (6–46)44 (6–81)<0.0001
Histology
Grade II68 % (17/25)87.5 % (7/8)72.7 % (24/33)47 % (75/159)0.01
Grade III24 % (6/25)12.5 % (1/8)21.2 % (7/33)39 % (62/159)0.05
Grade IV8 % (2/25)6.1 % (2/33)14 % (22/159)0.4
Location
Frontal53.4 % (24/45)58 % (7/12)54.1 % (31/57)67,1 % (108/161)0.1
Parietal4.4 % (2/45)3.6 % (2/57)7.5 % (12/161)0.4
Insular4.4 % (2/45)3.6 % (2/57)5,6 % (9/161)0.7
Temporal13.3 % (6/45)10.5 % (6/57)11.8 % (19/161)1
Occipital2.2 % (1/45)1.8 % (1/57)1.9 % (3/161)1
Brainstem15.7 % (7/45)42 % (5/12)21 % (12/57)0.6 % (1/161)<0.0001
Gliomatosis4.4 % (2/45)3.6 % (2/57)5 % (8/161)1
Thalamic2.2 % (1/45)1.8 % (1/57)0.6 % (1/161)1
Multicentric39.2 % (11/28)10 % (1/10)31.6 % (12/38)1.3 % (2/159)<0.0001
IDH mutation83 % (5/6)100 % (2/2)87.5 % (7/8)100 %-
1p/19q co-deletion0 % (0/5)0 % (0/1)0 % (0/6)48 % (59/123)0.03
Other intracranial Tumor25 % (7/21)43 % (3/7)36 % (10/28)1.9 % (3/159)<0.0001
History of chondrosarcoma12.5 % (3/24)42.8 % (3/7)19.3 % (6/31)0 %<0.0001

M male, F female

Clinical, histological and molecular characteristics of our 6 patients with enchondromatosis who developed glioma M male, F female, OAII/III grade II/III oligo-astrocytoma, OII grade II oligodendroglioma, GBM glioblastoma, −: data not available, T temporal, P parietal, Fr frontal, B brainstem, +: alive at last news Summary of the clinical, histological and molecular characteristics of Ollier disease (OD), Maffucci syndrome (MS), enchondromatosis (OD + MS) -present series and literature- and sporadic IDH mutated glioma patients M male, F female The diagnosis of Ollier disease (n = 28) or Maffucci syndrome (n = 10) was made during childhood based on the occurrence of multiple enchondromas predominating on the articulations of the knees, hands and toes. The median age at glioma diagnosis was 25.6 years. At this time, six patients (19 %) had a previous history of chondrosarcoma. Clinical presentation consisted of a variable association of seizures (38 %), progressive focal deficits (41 %) and intracranial hypertension (21 %). Radiological presentation was suggestive of diffuse glioma in all of the patients (Fig. 1). Tumors were most frequently located in the frontal lobe (54 %) and in the brainstem (21 %). Contrast enhancement was present in 27 % of cases. Twelve patients (32 %) had multicentric gliomas that were synchronous in eleven patients and metachronous in one patient. Multicentric gliomas were confined to the hemispheres in 8 patients and involved both the hemispheres and the brainstem in 4 patients. Two patients had gliomatosis cerebri. Ten patients (36 %) had another intracranial tumor at the time of glioma diagnosis (skull base enchondroma n = 7, pituitary adenoma n = 2, skull base chondrosarcoma n = 1).
Fig. 1

MRI characteristics of the diffuse gliomas in the 6 new enchondromatosis patients and double staining with anti-IDH1R132H and anti-ATRX antibodies. Top: MRI findings of patient 1 to patient 6 at diagnosis (axial T2/fluid-attenuated inversion recovery (FLAIR) sequences) demonstrating multicentric tumors in patients 1, 2, 3 and 4. Bottom: histological characteristics of the recurrent tumor of patient 3. a Hematoxylin eosin staining demonstrating an anaplastic glioma. b IDH1 R132H expression (brown signal). c Diffuse loss of ATRX expression in tumor cells and maintained expression (brown signal) in endothelial cells. d-g) Double staining demonstrating rare cells with a normal oligodendrocyte (black arrowheads) or astrocyte (black arrows) morphology expressing both IDH1 R132H (red signal) and ATRX (brown signal) (inserts showing same cells at higher magnification) and tumor cells with abnormal morphology and expressing IDH1 R132H but not ATRX (white arrows)

MRI characteristics of the diffuse gliomas in the 6 new enchondromatosis patients and double staining with anti-IDH1R132H and anti-ATRX antibodies. Top: MRI findings of patient 1 to patient 6 at diagnosis (axial T2/fluid-attenuated inversion recovery (FLAIR) sequences) demonstrating multicentric tumors in patients 1, 2, 3 and 4. Bottom: histological characteristics of the recurrent tumor of patient 3. a Hematoxylin eosin staining demonstrating an anaplastic glioma. b IDH1 R132H expression (brown signal). c Diffuse loss of ATRX expression in tumor cells and maintained expression (brown signal) in endothelial cells. d-g) Double staining demonstrating rare cells with a normal oligodendrocyte (black arrowheads) or astrocyte (black arrows) morphology expressing both IDH1 R132H (red signal) and ATRX (brown signal) (inserts showing same cells at higher magnification) and tumor cells with abnormal morphology and expressing IDH1 R132H but not ATRX (white arrows) The glioma was histologically proven in 33 patients. Among the 5 patients without histological diagnosis, 4 patients had a typical aspect of brainstem glioma consisting of an infiltrative intra-axial T2/FLAIR hypersignal without contrast-enhancement, and 1 patient had an aspect suggestive of hemispheric low-grade glioma that was managed with initial follow-up (patient 2, Fig. 1). Histology consisted of diffuse low-grade glioma in 24 patients (73 %), anaplastic glioma in 7 patients (21 %) and glioblastoma in 2 patients (6 %). An astrocytic (n = 22, 66 %) or oligo-astrocytic phenotype (n = 8, 25 %) was more frequently observed than a pure oligodendroglial phenotype (n = 3, 9 %). IDH mutations were assessed in 8 cases (based on sequencing in 6 patients and on immunohistochemistry only in 2 patients) and detected in the tumors of 7 patients (IDH1 R132H n = 5, IDH2 R172S n = 2). In the negative case, no expression of IDH1 R132H was detected on immunohistochemistry, but other IDH mutations were not assessed [38]. In two patients (patient 5 and a previously reported patient [34]) the presence of an IDH mutation could be analyzed in both the glioma and a skeletal tumor and the same mutation (IDH1 R132H in patient 5 and IDH2 R172S in [34]) was identified in these tumors. Since none of our patients underwent a biopsy of more than one glioma, the analysis of IDH mutations in different gliomas from the same patient could not be performed. No 1p/19q co-deletion was identified in the 6 cases in which it was assessed (oligo-astrocytoma n = 4, oligodendroglioma n = 1, glioblastoma n = 1). TP53 expression was studied in 6 patients and found to be expressed in 5 patients. In an additional patient, sequencing demonstrated missenses TP53 mutations [34]. ATRX expression was studied in 5 patients. A homogeneous loss of expression was observed in 4 patients and a heterogeneous loss of expression in 1 patient (patient 3). Genomic profiles of the tumors were obtained for 2 patients; one patient had an isolated LOH of the 17p region covering the TP53 locus (patient 3), and the other patient had a LOH of chromosome 9 associated with partial losses of chromosomes 14q and 15q and a partial gain of chromosome 11q (patient 5). In patient 3, double staining with anti-ATRX and anti-IDH1 R132H antibodies identified: (i) areas with maintained ATRX expression in tumor cells, and (ii) areas with diffuse loss of ATRX expression in tumors cells. In these last areas, some very rare IDH1 R132H and ATRX positive cells with a normal morphology were observed (Fig. 1). Treatment consisted of surgical resection (46 %), radiotherapy (80 %) and or chemotherapy (42 %). The median survival after glioma diagnosis was 5 years. Independent of histology and 1p/19q co-deletion status, gliomas in enchondromatosis patients were diagnosed at an earlier age than sporadic IDH mutated gliomas (25.6 years versus 44 years, p < 0.001, Fig. 2). In addition, they were more frequently multicentric (32 % versus 1 %, p < 0.001), more frequently involved the brainstem (21 % versus 1 %, p < 0.001) and were not associated with a 1p/19q co-deletion (0/6 versus 59/123, p = 0.03).
Fig. 2

Age at glioma in patients with enchondromatosis and sporadic IDH mutated gliomas according to grade and 1p/19q co-deletion. Y axis: age at glioma diagnosis (years). X axis: OD/MS: enchondromatosis patients with glioma, IDH: patients with sporadic IDH mutated gliomas without 1p/19q co-deletion, Codel: patients with sporadic IDH mutated gliomas with 1p/19q co-deletion. Median age at glioma diagnosis, was lower in OD/MS than in IDH patients (25.6 vs 41 years, p < 0.001) and in IDH than in Codel patients (41 years vs 50.8 years, p < 0.001). The difference remained significant when taking into account only LGG (OD/MS vs IDH patients: 26.9 vs 39 years, p < 0.001; IDH vs Codel patients: 39 vs 49 years, p = 0.01)

Age at glioma in patients with enchondromatosis and sporadic IDH mutated gliomas according to grade and 1p/19q co-deletion. Y axis: age at glioma diagnosis (years). X axis: OD/MS: enchondromatosis patients with glioma, IDH: patients with sporadic IDH mutated gliomas without 1p/19q co-deletion, Codel: patients with sporadic IDH mutated gliomas with 1p/19q co-deletion. Median age at glioma diagnosis, was lower in OD/MS than in IDH patients (25.6 vs 41 years, p < 0.001) and in IDH than in Codel patients (41 years vs 50.8 years, p < 0.001). The difference remained significant when taking into account only LGG (OD/MS vs IDH patients: 26.9 vs 39 years, p < 0.001; IDH vs Codel patients: 39 vs 49 years, p = 0.01)

Discussion

The high rate of multicentric gliomas, the identification of IDH mutations in all of the gliomas in which it could be fully assessed and the identical IDH mutations found in both the glioma and the skeletal tumor of two patients strongly suggest that, in most cases, similar to cartilaginous tumors, the development of gliomas in enchondromatosis patients results from somatic IDH mosaicism. The very rare IDH1 R132H and ATRX positive cells with a normal morphology found in patient 3 may further support this hypothesis. Consistent with the demonstration of occasional IDH mutated cells in the normal bone, blood and bone marrow of some enchondromatosis patients, we speculate that these cells may correspond to normal glial cells with IDH mutations [3, 36]. However, this observation must be taken with caution since morphology is subjective and ATRX expression can be heterogeneous [41]. IDH mutations are considered to be the earliest oncogenic events in the majority of lower grade gliomas [10]. In animal models, IDH mutations have been shown to be sufficient to induce enchondromas and chondrosarcomas [17, 29]. To our knowledge, this demonstration has not been previously reported for gliomas, but the occurrence of gliomas in enchondromatosis patients, in whom IDH mutations are thought to occur as an early post-zygotic event suggests that IDH mutations can initiate gliomagenesis [3, 36]. In addition, the median age at glioma diagnosis in these patients (25 years) suggests that IDH driven gliomagenesis is a very slow process. In contrast to enchondromas, however, IDH mutation alone is probably not sufficient to induce gliomas. Additional alterations, such as ATRX and TP53 mutations, are necessary [10]. Consistently, Moriya et al. identified a TP53 mutation in the glioma but not in an enchondroma of their patient, though both lesions shared the same IDH2 mutation [34]. This could explain why enchondromas appear much earlier than gliomas in enchondromatosis patients. It is unknown why only a small percentage of enchondromatosis patients (approximately 5 %) develop gliomas [45]. It could be related to a variable distribution and proportion of mutated cells within the brain, to the fact that only a small percentage of IDH mutated glial cells acquire additional alterations, or to the type of IDH mutation present. In cartilaginous tumors of enchondromatosis patients the IDH1 R132C mutation is more frequent than the IDH1 R132H mutation (70 and 15 %, respectively) [3, 36], while the IDH1 R132H mutation is the most frequent mutation (90 %) in sporadic IDH mutated gliomas [50]. Enchondromatosis patients with an IDH1 R132H mutation could have a higher risk of developing gliomas than patients with an IDH1 R132C mutation. In our series, an IDH1 R132H mutation was present in 5 out of the 7 enchondromatosis patients who developed diffuse glioma. Not surprisingly, like sporadic IDH mutated gliomas, enchondromatosis gliomas were frequently located in the frontal lobe and were more frequently diffuse low-grade or anaplastic gliomas than glioblastomas. However, they differed from sporadic IDH-mutated gliomas in several aspects. First, they were diagnosed at an earlier age. This difference could be explained by the fact that in sporadic IDH-mutated gliomas, the IDH mutation is acquired later than in enchondromatosis patients. Second, enchondromatosis gliomas, compared to sporadic IDH mutated gliomas, more frequently involved the brainstem, which may also be related to an earlier origin of enchondromatosis gliomas (i.e., during the first years of life, which is a period associated with the development of infratentorial gliomas). Since both H3-K27M mutations (which are present in most cases of children brainstem gliomas) and IDH mutations alter histone methylation, brainstem gliomas may therefore require histone modification of precursor cells at an early stage of development [9, 28, 30]. This particularity could help explaining why early acquisition of IDH mutations mimics the regional preference of H3-K27M mutated gliomas and why gliomas in that location are rare in adults. At last, none of the 6 enchondromatosis gliomas that could be tested were associated with a 1p/19q co-deletion. This observation needs confirmation in a larger series, however, again it could be related to a different timing of oncogenesis because the 1p/19q co-deletion is virtually absent in pediatric gliomas [42]. Consistently, in the present series, as in previously reported series, patients with 1p/19q co-deleted gliomas were older at diagnosis than those with IDH mutated non 1p/19q co-deleted gliomas [13]. Finally, multicentric gliomas were much more frequent in enchondromatosis than in sporadic IDH-mutated gliomas. Multicentric gliomas (i.e., with no apparent continuity between tumors) account for 2 to 5 % of sporadic gliomas [1]. Their oncogenesis is debated. In some cases, evidence has been provided that the multiple tumors actually originated from the same clone [1]. However, the multicentric presentation of gliomas reported in patients with inherited glioma predisposition and the high incidence of systemic cancers reported in patients with multicentric gliomas also suggest that multicentric gliomas may originate from different clones in patients who have inherited genetic alterations predisposing them to gliomas [4, 27]. Our study shows that somatic mosaicism might be another mechanism leading to the development of multicentric gliomas. It remains to be determined whether somatic IDH mosaicism might be responsible for the occurrence of multicentric gliomas in patients without enchondromatosis.

Conclusions

In addition to its retrospective design and its small sample-size, limitations of the present study include the limited number of patients in whom molecular characterization was possible, the absence of comprehensive molecular analysis and the absence of IDH mutation assessment in several gliomas from the same patient. Nevertheless, the analysis of glioma characteristics in patients with enchondromatosis sheds new light on IDH driven gliomagenesis. It provides evidence that the IDH mutation can initiate gliomagenesis and that the timing of IDH mutation acquisition might influence the location and molecular characteristics of gliomas.
  48 in total

Review 1.  A case of dyschondroplasia associated with brain stem glioma: diagnosis by stereotactic biopsy.

Authors:  S Patt; K Weigel; H M Mayer
Journal:  Neurosurgery       Date:  1990-09       Impact factor: 4.654

Review 2.  [Maffucci's syndrome associated with primary brain tumor: report of a case].

Authors:  H Goto; Y Ito; A Hirayama; T Sakamoto; M Kowada
Journal:  No Shinkei Geka       Date:  1987-09

3.  Neuro-ophthalmologic manifestations of Maffucci's syndrome and Ollier's disease.

Authors:  L J Balcer; S L Galetta; W T Cornblath; G T Liu
Journal:  J Neuroophthalmol       Date:  1999-03       Impact factor: 3.042

4.  Mutant IDH is sufficient to initiate enchondromatosis in mice.

Authors:  Makoto Hirata; Masato Sasaki; Rob A Cairns; Satoshi Inoue; Vijitha Puviindran; Wanda Y Li; Bryan E Snow; Lisa D Jones; Qingxia Wei; Shingo Sato; Yuning J Tang; Puviindran Nadesan; Jason Rockel; Heather Whetstone; Raymond Poon; Angela Weng; Stefan Gross; Kimberly Straley; Camelia Gliser; Yingxia Xu; Jay Wunder; Tak W Mak; Benjamin A Alman
Journal:  Proc Natl Acad Sci U S A       Date:  2015-02-17       Impact factor: 11.205

5.  ATRX and IDH1-R132H immunohistochemistry with subsequent copy number analysis and IDH sequencing as a basis for an "integrated" diagnostic approach for adult astrocytoma, oligodendroglioma and glioblastoma.

Authors:  David E Reuss; Felix Sahm; Daniel Schrimpf; Benedikt Wiestler; David Capper; Christian Koelsche; Leonille Schweizer; Andrey Korshunov; David T W Jones; Volker Hovestadt; Michel Mittelbronn; Jens Schittenhelm; Christel Herold-Mende; Andreas Unterberg; Michael Platten; Michael Weller; Wolfgang Wick; Stefan M Pfister; Andreas von Deimling
Journal:  Acta Neuropathol       Date:  2014-11-27       Impact factor: 17.088

6.  Multiple enchondromatosis Ollier's disease with two primary brain tumors.

Authors:  Waleed S Mahafza
Journal:  Saudi Med J       Date:  2004-09       Impact factor: 1.484

7.  Temozolomide as initial treatment for adults with low-grade oligodendrogliomas or oligoastrocytomas and correlation with chromosome 1p deletions.

Authors:  K Hoang-Xuan; L Capelle; M Kujas; S Taillibert; H Duffau; J Lejeune; M Polivka; E Crinière; Y Marie; K Mokhtari; A F Carpentier; F Laigle; J M Simon; P Cornu; P Broët; M Sanson; J Y Delattre
Journal:  J Clin Oncol       Date:  2004-08-01       Impact factor: 44.544

8.  [Dyschondroplasia with glioma of the brain. Third histologically verified case (author's transl)].

Authors:  W Becker; A Thron
Journal:  Arch Orthop Trauma Surg       Date:  1979-01-29

9.  Ollier disease and Maffucci syndrome are caused by somatic mosaic mutations of IDH1 and IDH2.

Authors:  M Fernanda Amary; Stephen Damato; Dina Halai; Malihe Eskandarpour; Fitim Berisha; Fiona Bonar; Stan McCarthy; Valeria R Fantin; Kimberly S Straley; Samira Lobo; Will Aston; Claire L Green; Rosemary E Gale; Roberto Tirabosco; Andrew Futreal; Peter Campbell; Nadège Presneau; Adrienne M Flanagan
Journal:  Nat Genet       Date:  2011-11-06       Impact factor: 41.307

10.  Insulator dysfunction and oncogene activation in IDH mutant gliomas.

Authors:  William A Flavahan; Yotam Drier; Brian B Liau; Shawn M Gillespie; Andrew S Venteicher; Anat O Stemmer-Rachamimov; Mario L Suvà; Bradley E Bernstein
Journal:  Nature       Date:  2015-12-23       Impact factor: 49.962

View more
  10 in total

1.  Long-term impact of temozolomide on 1p/19q-codeleted low-grade glioma growth kinetics.

Authors:  C Izquierdo; A Alentorn; A Idbaih; M Simó; G Kaloshi; D Ricard; M Barritault; D Meyronet; J Bruna; J Honnorat; J Y Delattre; F Ducray
Journal:  J Neurooncol       Date:  2017-11-15       Impact factor: 4.130

Review 2.  Molecular Pathogenesis of Low-Grade Glioma.

Authors:  Devin Bready; Dimitris G Placantonakis
Journal:  Neurosurg Clin N Am       Date:  2019-01       Impact factor: 2.509

3.  Low-Grade Astrocytoma Mutations in IDH1, P53, and ATRX Cooperate to Block Differentiation of Human Neural Stem Cells via Repression of SOX2.

Authors:  Aram S Modrek; Danielle Golub; Themasap Khan; Devin Bready; Jod Prado; Christopher Bowman; Jingjing Deng; Guoan Zhang; Pedro P Rocha; Ramya Raviram; Charalampos Lazaris; James M Stafford; Gary LeRoy; Michael Kader; Joravar Dhaliwal; N Sumru Bayin; Joshua D Frenster; Jonathan Serrano; Luis Chiriboga; Rabaa Baitalmal; Gouri Nanjangud; Andrew S Chi; John G Golfinos; Jing Wang; Matthias A Karajannis; Richard A Bonneau; Danny Reinberg; Aristotelis Tsirigos; David Zagzag; Matija Snuderl; Jane A Skok; Thomas A Neubert; Dimitris G Placantonakis
Journal:  Cell Rep       Date:  2017-10-31       Impact factor: 9.423

Review 4.  Cancer Predisposition Syndromes Associated With Pediatric High-Grade Gliomas.

Authors:  Giulia Ceglie; Giada Del Baldo; Emanuele Agolini; Martina Rinelli; Antonella Cacchione; Francesca Del Bufalo; Maria Vinci; Roberto Carta; Luigi Boccuto; Evelina Miele; Angela Mastronuzzi; Franco Locatelli; Andrea Carai
Journal:  Front Pediatr       Date:  2020-11-12       Impact factor: 3.418

Review 5.  Isocitrate dehydrogenase gene variants in cancer and their clinical significance.

Authors:  Thomas Cadoux-Hudson; Christopher J Schofield; James S O McCullagh
Journal:  Biochem Soc Trans       Date:  2021-12-17       Impact factor: 5.407

6.  Adult isocitrate dehydrogenase-mutant brainstem glioma: illustrative case.

Authors:  Vincent C Ye; Alexander P Landry; Teresa Purzner; Aristotelis Kalyvas; Nilesh Mohan; Philip J O'Halloran; Andrew Gao; Gelareh Zadeh
Journal:  J Neurosurg Case Lessons       Date:  2021-03-22

Review 7.  Brain Gliomas and Ollier Disease: Molecular Findings as Predictive Risk Factors?

Authors:  Sergio Corvino; Giuseppe Mariniello; Giuseppe Corazzelli; Raduan Ahmed Franca; Marialaura Del Basso De Caro; Rosa Della Monica; Lorenzo Chiariotti; Francesco Maiuri
Journal:  Cancers (Basel)       Date:  2022-07-16       Impact factor: 6.575

8.  Ollier's disease associated with ovarian juvenile granulosa cell tumor and triple X syndrome: A letter to the editor.

Authors:  Shamim Shafieyoon; Mohammad Ali Tahririan; Ali Hekmatnia; Andrew Parviz Zarei; Farzaneh Hekmatnia; Ghazaleh Jamalipour Soufi
Journal:  J Res Med Sci       Date:  2022-05-30       Impact factor: 1.985

9.  An activating germline IDH1 variant associated with a tumor entity characterized by unilateral and bilateral chondrosarcoma of the mastoid.

Authors:  Patrick R Blackburn; Jodi M Carter; Devin Oglesbee; Jennifer J Westendorf; Brian A Neff; Damian Stichel; David W Tsen; Ralitza H Gavrilova; Pieter Wesseling; Andreas von Deimling; Thomas R Caulfield; Eric W Klee; Stefan Pusch; Carrie Y Inwards
Journal:  HGG Adv       Date:  2020-08-24

10.  Educational Case: Histologic and Molecular Features of Diffuse Gliomas.

Authors:  Sarah Zhang; Christopher William
Journal:  Acad Pathol       Date:  2020-04-03
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.