| Literature DB >> 27034934 |
Monika Heisig1, Łukasz Łaczmański2, Adam Reich1, Felicja Lwow3, Jacek C Szepietowski1.
Abstract
Uremic pruritus (UP) is a frequent and bothersome symptom in hemodialysis patients. Its etiology is not fully understood and that is why there is no specific treatment. The endocannabinoid system plays a role in many pathological conditions. There is reliable evidence on the association between cannabinoid system and pruritus. In our study, we aimed to evaluate whether genetic variations in the endocannabinoid receptor 1 (CNR1) gene can affect UP. The rs12720071, rs806368, rs1049353, rs806381, rs10485170, rs6454674, and rs2023239 polymorphisms of the CNR1 gene were genotyped in 159 hemodialysis patients and 150 healthy controls using two multiplex polymerase chain reactions and the minisequencing technique. No statistically significant relationship was found in any of the evaluated genotypes between patients with and without UP, even after excluding patients with diabetes and dyslipidemia. There were no differences between patients with UP and the control group. However, in the group of all HD patients, a significantly higher incidence of GA genotype and lower incidence in GG genotype in the polymorphism rs806381s were revealed versus the control group (p = 0.04). It seems that polymorphisms of the CNR1 gene are not associated with uremic pruritus.Entities:
Mesh:
Substances:
Year: 2016 PMID: 27034934 PMCID: PMC4789377 DOI: 10.1155/2016/3567527
Source DB: PubMed Journal: Biomed Res Int Impact factor: 3.411
Sequences of CNR1 primers.
| Polymorphism | Forward primer (3′-5′) | Reverse primer (3′-5′) |
|---|---|---|
| rs12720071 | GATGAAGGCTCAGGGTGCTAGAGG | TAGTGCTGTCAGCCCCATTGTCCC |
| rs806368 | GAGACCACCCATATCATGCACACA | AACTCTGATCCCCAGTAGGCCTAG |
| rs1049353 | CCTGCGACACGCTTTCCGGA | CTGCCAGGGAGGCATCAGGC |
| rs806381 | CATGAGCCATGAGGTTTTCT | CATTTGAAGGCCTGTAACTT |
| rs10485170 | TTAACCAATGGTTCATCGTC | ATGTGGTTCTCAGGCATCAG |
| rs6454674 | ATGGAGCCTGTCCTTTAGGT | TATCCAGGAATGCTGCAAAA |
| rs2023239 | CATGAGCCATGAGGTTTTCT | CATTTGAAGGCCTGTAACTT |
Correlation between CNR1 genotype frequencies in patients with and without uremic pruritus.
| Polymorphism | Patients without uremic pruritus | Patient with uremic pruritus |
| ||||
|---|---|---|---|---|---|---|---|
| rs12720071 | AA | AG | GG | AA | AG | GG | 0.64 |
| 65 (78.3%) | 15 (18.1%) | 3 (3.6%) | 62 (81.6%) | 13 (17.1%) | 1 (1.3%) | ||
|
| |||||||
| rs806368 | TT | CT | CC | TT | CT | CC | 0.85 |
| 52 (62.7%) | 26 (31.3%) | 5 (6.0%) | 45 (59.2%) | 27 (35.5%) | 4 (5.3%) | ||
|
| |||||||
| rs1049353 | AA | AG | GG | AA | AG | GG | 0.63 |
| 2 (2.4%) | 35 (42.2%) | 46 (55.4%) | 4 (5.3%) | 30 (39.5%) | 42 (55.3%) | ||
|
| |||||||
| rs806381 | AA | AG | GG | AA | AG | GG | 0.93 |
| 33 (39.8%) | 38 (45.8%) | 12 (14.5%) | 29 (38.2%) | 37 (48.7%) | 10 (13.2%) | ||
|
| |||||||
| rs10485170 | AA | AG | GG | AA | AG | GG | 0.2 |
| 76 (91.6%) | 7 (8.4%) | 0 (0%) | 63 (82.9%) | 12 (15.8%) | 1 (1.3%) | ||
|
| |||||||
| rs6454674 | TT | GT | GG | TT | GT | GG | 0.22 |
| 34 (41.0%) | 36 (43.4%) | 13 (15.6%) | 29 (38.2%) | 41 (53.9%) | 6 (7.9%) | ||
|
| |||||||
| rs2023239 | TT | CT | CC | TT | CT | CC | 0.31 |
| 70 (84.3%) | 11 (13.3%) | 2 (2.4%) | 57 (75.0%) | 17 (22.4%) | 2 (2.6%) | ||
Differences between CNR1 genotype frequencies in all hemodialysis (HD) patients and the control group.
| Polymorphism | HD patients | Control group |
| ||||
|---|---|---|---|---|---|---|---|
| rs12720071 | AA | AG | GG | AA | AG | GG | 0.09 |
| 127 (79.9%) | 28 (17.6%) | 4 (2.5%) | 104 (69.3%) | 38 (25.3%) | 8 (5.3%) | ||
|
| |||||||
| rs806368 | TT | CT | CC | TT | CT | CC | 0.75 |
| 97 (61.0%) | 53 (33.3%) | 9 (5.7%) | 91 (60.7%) | 51 (35%) | 7 (4.7%) | ||
|
| |||||||
| rs1049353 | AA | AG | GG | AA | AG | GG | 0.12 |
| 6 (3.8%) | 65 (40.9%) | 88 (55.3%) | 4 (2.7%) | 46 (30.7%) | 100 (66.7%) | ||
|
| |||||||
| rs806381 | AA | AG | GG | AA | AG | GG |
|
| 62 (39.0%) | 75 (47.2%) | 22 (13.8%) | 53 (35.3%) | 59 (39.3%) | 38 (25.3%) | ||
|
| |||||||
| rs10485170 | AA | AG | GG | AA | AG | GG | 0.26 |
| 139 (87.4%) | 19 (12.0%) | 1 (0.6%) | 124 (82.7%) | 26 (17.3%) | 0 (0%) | ||
|
| |||||||
| rs6454674 | TT | GT | GG | TT | GT | GG | 0.22 |
| 63 (39.0%) | 77 (48.4%) | 19 (12.0%) | 54 (36.0%) | 66 (44.0%) | 29 (19.3%) | ||
|
| |||||||
| rs2023239 | TT | CT | CC | TT | CT | CC | 0.09 |
| 127 (79.9%) | 28 (17.6%) | 4 (2.5%) | 103 (68.7%) | 43 (28.7%) | 3 (2.0%) | ||