Literature DB >> 27029527

The autoimmunity-associated gene RGS1 affects the frequency of T follicular helper cells.

C Caballero-Franco1, S Kissler1.   

Abstract

RGS1 (regulator of G-protein signaling 1) has been associated with multiple autoimmune disorders including type I diabetes. RGS1 desensitizes the chemokine receptors CCR7 and CXCR4 that are critical to the localization of T and B cells in lymphoid organs. To explore how RGS1 variation contributes to autoimmunity, we generated Rgs1 knockdown (KD) mice in the nonobese diabetic (NOD) model for type I diabetes. We found that Rgs1 KD increased the size of germinal centers, but decreased the frequency of T follicular helper (TFH) cells. We show that loss of Rgs1 in T cells had both a T cell-intrinsic effect on migration and TFH cell frequency, and an indirect effect on B-cell migration and germinal center formation. Notably, several recent publications described an increase in circulating TFH cells in patients with type I diabetes, suggesting this cell population is involved in pathogenesis. Though Rgs1 KD was insufficient to alter diabetes frequency in the NOD model, our findings raise the possibility that RGS1 plays a role in autoimmunity owing to its function in TFH cells. This mechanistic link, although speculative at this time, would lend support to the notion that TFH cells are key participants in autoimmunity and could explain the association of RGS1 with several immune-mediated diseases.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27029527      PMCID: PMC4892947          DOI: 10.1038/gene.2016.16

Source DB:  PubMed          Journal:  Genes Immun        ISSN: 1466-4879            Impact factor:   2.676


INTRODUCTION

RGS1, a member of the regulator of G-protein signaling (RGS) family[1], has been associated with multiple immune mediated diseases[2-5]. Data from genome wide association studies show a significant association of SNPs in the RGS1 region with multiple sclerosis and celiac disease[2,3] (P < 10−17), and a suggestive association with type 1 diabetes[4,5]. RGS proteins are GTPase activating proteins that modulate chemokine receptor signaling[1]. Chemokine receptors depend on heterotrimeric G-proteins to activate downstream effectors[6]. Upon ligand activation, the G-protein alpha subunit (Gα) exchanges GTP for GDP, resulting in dissociation from the Gβγ heterodimer[7] and initiating signaling cascades that lead to cytoskeletal rearrangements and cell migration. Hydrolysis of GTP by Gα’s intrinsic GTPase activity causes signal termination. This enzymatic activity is accelerated by RGS-family proteins[1]. RGS1 is highly expressed in lymphoid organs and serves as a negative regulator of chemokine receptor signaling in lymphocytes[1,8]. Ablation of Rgs1 in mice was shown to modify B cell trafficking[9]. In addition, Rgs1 deficiency leads to aberrant architecture of germinal centers[9-11]. Although the phenotype described for Rgs1 knockout (KO) mice was largely attributed to B cell dysfunction, a subsequent study found that Rgs1 also participates in chemotactic signaling in T cells[12]. Rgs1 thus affects the migratory behavior of multiple cell types, and it is as yet unclear how RGS1 gene variation modifies the risk of autoimmunity, and of type 1 diabetes in particular. T follicular helper cells (TFH) reside in the follicular areas of secondary lymphoid organs where they promote B cells expansion and antibody affinity maturation within germinal centers[13]. TFH maturation is a multistep process that begins in the T cell zone with the activation of naive CD4+ T lymphocytes and leads to expression of the transcription factor Bcl6. Bcl6 drives the expression of the chemokine receptor CXCR5 that promotes migration from the T cell zone towards the B cell follicle[14]. This migration also requires downregulation of CCR7 signaling[15]. Of interest, Rgs1 expression is markedly up-regulated in TFH cells[16], and this likely contributes to desensitizing migrating cells to CCR7 ligands. Notably, several studies have recently implicated TFH cells in type 1 diabetes[17-19]. The frequency of TFH cells was found to be elevated in patients with type 1 diabetes. A similar increase in TFH cells was observed in a mouse model for autoimmune diabetes[19]. To investigate a possible role for RGS1 in autoimmunity, we developed inducible Rgs1 knockdown (KD) mice within the nonobese diabetic (NOD) mouse model for type 1 diabetes[20]. Rgs1 silencing recapitulated key phenotypes described for Rgs1 KO mice[9], including increased lymphocyte chemotaxis and enlarged germinal centers. While we found that Rgs1 KD did not alter the risk of diabetes in NOD mice, we observed that loss of Rgs1 reduced the frequency of TFH cells. Furthermore, Rgs1 KD in T cells was sufficient to modify the migration of B cells. These findings suggest that the effects of Rgs1 KO on germinal center formation described previously may be caused in part by changes in TFH cell function. In addition, our data suggest that Rgs1 upregulation is a critical step in the migration of TFH cells that enables cells to downregulate CCR7 signals and to migrate into the follicular area. A link between Rgs1 expression and TFH cell frequency, a T cell subset implicated in type 1 diabetes, could explain the association of RGS1 variants with autoimmunity.

RESULTS

Generation of Rgs1 knockdown NOD mice

To study the role of Rgs1 in autoimmune diabetes, we generated transgenic nonobese diabetic (NOD) mice in which Rgs1 gene expression can be silenced by RNAi in a doxycycline-dependent manner[21]. We first validated lentiviral constructs for Rgs1 KD in vitro. Candidate shRNA sequences were cloned into the lentiviral vector pUTG[21,22] in which shRNA expression is under the control of a doxycycline-inducible promoter. The vector also contains a constitutively expressed tetracycline-repressor and a green-fluorescent protein (GFP) reporter. We generated an Rgs1 luciferase reporter where Rgs1 cDNA is incorporated into the 3’ UTR of the Renilla luciferase gene. We transfected the Rgs1 luciferase reporter into HEK293 cells transduced with lentivirus encoding different shRNA sequences against Rgs1, and quantified Renilla luciferase activity as a measure of gene knockdown. We identified two shRNA sequences that potently inhibited the Rgs1 luciferase reporter (Fig. 1a). These shRNA sequences were further validated for their ability to silence expression of a FLAG-tagged Rgs1 construct, as measured by quantitative PCR (Fig. 1b) and western blotting (Fig. 1c and 1d). The selected shRNA sequences were then used to generate two distinct Rgs1 KD NOD lines by lentiviral transgenesis (Fig. 1e and supplementary Fig. S1). Finally, we confirmed that doxycycline treatment (100 µg/ml in the drinking water for two weeks) induced Rgs1 KD in vivo (Fig. 1f–1h, and supplementary Fig. S1).
Figure 1

Generation and validation of NOD Rgs1 KD mice. (a–d): HEK293 cells were transduced with lentivirus encoding Rgs1 shRNA sequence #1 or #3 under the control of a doxycycline-inducible promoter. Rgs1 KD or control cells were transfected with the Rgs1 luciferase reporter (a) or with an expression vector containing a FLAG-tagged version of the RGS1 protein (b–d). Rgs1 knockdown efficiency was then analyzed by luminescence measurement (a), quantitative PCR (b) or western blotting (c,d). Results in a through d are representative of three experiments.

(e) GFP expression in blood samples from Rgs1 KD mice. Representative histograms for Rgs1 KD (white histogram) and WT mice (black histogram) are shown. (f–h): Validation of Rgs1 silencing in vivo. Quantitative PCR (f) or western blotting (g,h) was performed with spleen mRNA or protein, respectively, from individual Rgs1 KD (white bars) and WT mice (black bars). Rgs1 protein levels were compared in mice treated or not with doxycycline. Results in f through h derive from 3–5 biological replicates and are representative of two experiments. All results show mean values +/− SEM.

Rgs1 silencing sensitizes T cells to CCR7 ligation

Rgs1 modulates CCR7 signaling by promoting the conversion of the GTP-activated Gα subunit to a GDP-quiescent form that results in re-assembly of the heterotrimeric G-protein complex[1], thus terminating chemokine receptor signaling. Accordingly, Rgs1 KO was shown to sensitize lymphocytes to CCR7 stimuli[11,12]. We tested the response of Rgs1 KD T lymphocytes to CCR7 chemokine ligands in a transwell assay. Consistent with a role for Rgs1 in diminishing CCR7 signaling, Rgs1 KD increased T cell migration toward CCL19 (Fig. 2a) and CCL21 (Fig. 2b). The chemotactic response to the CXCR4 ligand CXCL12 was also affected, though only modestly (Fig. 2c). Similar results were obtained with Rgs1 KD B cells (Figure 2d). These data are consistent with a previous report showing that Rgs1 KO sensitized T cells to CCR7 and CXCR4 ligation[12]. We concluded that Rgs1 KD modifies lymphocyte chemotaxis in vitro in a manner consistent with observations made with Rgs1 KO cells.
Figure 2

Rgs1 KD sensitizes T cells to CCR7 and CXCR4 stimulation. Migration of T cells from the spleen or lymph nodes (a–c) or splenic B cells (d) from WT (black) and Rgs1 KD in response to CCL19 (a), CCL21 (b,d) or CXCL12 (c,d). Data represents means ± SEM of 3 biological replicates. * p < 0.05, ** p < 0.01 (unpaired t-test).

Rgs1 KD protects against colitis, but does not change the risk of autoimmune diabetes

A study by Hayday and colleagues reported that T cells derived from Rgs1 KO mice were less pathogenic than their WT counterparts in an experimental colitis model based on the transfer of CD4+CD45RBhigh T cells into immunodeficient mice[12]. The authors speculated that the absence of Rgs1 increases the propensity of CD4+ T cells to home to secondary lymphoid organs, reducing their dwell time in the gastrointestinal tract and diminishing colitis severity. To test if Rgs1 KD would recapitulate this phenotype, we transferred sorted CD4+CD45RBhigh T cells from Rgs1 KD or WT mice into NOD.SCID recipient mice. The results of this experiment suggested that Rgs1 KD T cells were less colitogenic than WT cells. Colons were lighter and longer, and histological scores lower in mice transplanted with Rgs1 KD cells (supplementary Fig. S2). With an indication that Rgs1 KD was able to alter T cell function in vivo, we proceeded to ask if Rgs1 silencing would affect the development of autoimmune diabetes in NOD mice. However, we found no difference in the frequency of spontaneous diabetes between WT and Rgs1 KD mice, whether treated or not with doxycycline (Fig. 3a). Additionally, diabetes onset was tested by two alternative approaches: by administering cyclophosphamide (Fig. 3b) which is thought to disproportionally deplete the regulatory T cell population, leading to a breakdown in immune regulation[23], and by transfer of splenocytes from overtly diabetic Rgs1 KD mice into immunodeficient NOD.SCID mice (Fig. 3c). Both approaches indicated again that Rgs1 silencing was insufficient to alter the risk of diabetes in the NOD model.
Figure 3

Rgs1 KD does not change the risk of autoimmune diabetes in the NOD model. (a) Spontaneous diabetes incidence in WT and Rgs1 KD mice treated (bottom panel, P=0.26) or not (top panel, P=0.42) with doxycycline continuously from birth (n = 22 mice per group). None of the differences between genotypes or between treated and untreated groups were statistically significant. (b) Cyclophosphamide-accelerated diabetes in WT and Rgs1 KD mice treated with doxycycline for the duration of the experiment (n = 7 mice per group, P=0.18). (c) Diabetes in NOD.SCID mice (n = 5 per group, P=0.17) treated or not with doxycycline following transfer of splenocytes from an overtly diabetic Rgs1 KD NOD mouse not treated with doxycycline.

Rgs1 silencing impacts the differentiation of T follicular helper cells

To further dissect the role of Rgs1, we explored its function within secondary lymphoid organs where Rgs1 may fine-tune local migratory signals. Reports from Rgs1 KO mice previously linked loss of Rgs1 to aberrant splenic architecture, characterized by enlarged germinal centers[9,10]. This observation was replicated in Rgs1 KD mice: transgenic mice treated with doxycycline had significantly larger germinal centers after immunization (Fig. 4a and 4b). Accordingly, both the frequency and absolute number of IgDlo B cells was increased by Rgs1 silencing (Fig. 4c). Although the proportion of proliferating (Ki-67+) IgDlo cells was not affected by Rgs1 KD, transgenic mice harbored more proliferating B cells overall (Fig. 4d and 4e). When we analyzed different T cell populations in lymph nodes collected from immunized mice, we found that the frequency of TFH cells, characterized as CD4+PD1highCXCR5high cells, was diminished in Rgs1 KD mice (Fig. 5a–c). Further analysis of the TFR population, the regulatory subpopulation of follicular T cells that expresses the transcription factor Foxp3[16], suggested that the frequency of TFR cells may be elevated (Fig. 5d), though this difference did not reach statistical significance (p=0.07) and the absolute number of TFR cells was instead decreased by Rgs1 KD (Fig. 5e) similarly to the number of TFH cells. Although Rgs1 KD TFH cells were reduced in numbers, they resembled WT TFH cells in their expression of ICOS (Fig. 5f) and Bcl6 (Fig. 5g). Immunohistochemical staining further confirmed that the number of CD4+ T cells within germinal centers was reduced in Rgs1 KD animals (Fig. 5h). Collectively, these data show that Rgs1 KD modifies germinal center formation, as shown previously, and indicate that loss of Rgs1 reduces the frequency of follicular T cells.
Figure 4

Rgs1 KD alters germinal center formation. WT and Rgs1 KD mice were treated with doxycycline and immunized subcutaneously with ovalbumin in CFA. The draining inguinal lymph node (ILN), non-draining axillary lymph nodes (ALN) and spleen were analyzed 4 days later. (a) Representative images of germinal centers stained with peanut agglutinin (PNA) in the spleen (top) and ILN (middle) of WT and Rgs1 KD mice. The bottom panels show co-staining of PNA with B220 to control for specificity of PNA staining in B cell areas. Scale bar: 200 µm. (b) Quantification of the area of germinal centers in 3 (spleen) and 5 (ILN) mice per group. (c,d) Frequency and absolute number of IgDlo B cells (c) and of Ki-67+ cells within the IgDlo population (d) in immunized mice (n = 5 mice per group). (e) Inguinal lymph nodes were stained for PNA and Ki-67 to visualize proliferating B cells within germinal centers. Scale bar: 100 µm. * p < 0.05, *** p < 0.001 (unpaired t-test).

Figure 5

Rgs1 KD decreases the frequency of TFH cells. Representative flow cytometry results (a), frequency (b) and number (c) of CD4+PD-1+CXCR5+ TFH cells in immunized WT and Rgs1 KD mice. Cells shown in a are gated on the CD4+ population. (d,e): Representative flow cytometry results (d) and frequency (e) of FoxP3+ expressing cells within the CD4+PD-1+CXCR5+ population gated as shown in a. (f) Representative flow cytometry results for ICOS expression within the CD4+PD-1+CXCR5+ population as gated in a. (g) Frequency of CD4+CXCR5+Bcl6+ cells and mean fluorescence intensity (MFI) of Bcl6 staining within this population in immunized WT and Rgs1 KD mice. (h) Spleen sections were stained with PNA and anti-CD4 to quantify CD4+ T cells within germinal centers of immunized WT and Rgs1 KD mice. Representative images and summary data for 5 WT and 3 Rgs1 KD mice are shown. Results are representative of two or more experiments. All data show means ± SEM, * p < 0.05, ** p < 0.01 (unpaired t-test).

Rgs1 KD increases B cell migration in a B cell-extrinsic manner

Data from the Rgs1 KO mouse model had demonstrated that Rgs1-dependent chemokine signals modify germinal center formation[9-11]. The increase in germinal centers in the absence of Rgs1 had been attributed to a B cell-intrinsic effect. We sought to investigate if this phenotype is also influenced by Rgs1 function in T lymphocytes. To this end, we transferred B cells from NOD Raspberry mice, that express the mRaspberry fluorescent reporter[24], into WT or Rgs1 KD mice. Migration of Raspberry+ B cells into the spleen was analyzed by flow cytometry four days later. As observed in previous experiments, TFH cell frequency and number was decreased in the spleen of Rgs1 KD mice (Fig. 6a and 6b). Notably, transferred Raspberry+ B cells were more numerous in the spleen of Rgs1 KD recipient animals (Fig. 6c and 6d), suggesting that loss of Rgs1 leads to active recruitment and/or retention of circulating B cells into secondary lymphoid organs owing to B cell-extrinsic effects.
Figure 6

The migratory behavior of WT B cells is modified in Rgs1 KD mice. WT NOD Raspberry B cells were transferred into WT or Rgs1 KD mice treated with doxycycline. Recipient mice were immunized, and spleens were analyzed 4 days later. Representative flow cytometry data (a,c), frequency and absolute number (b,d) of host CD4+PD1highCXCR5high T cells (a,b) and donor WT Raspberry B cells (c,d). Data show mean values ± SEM in 5 WT and 6 Rgs1 KD mice. * p < 0.05, ** p < 0.01 (unpaired t-test).

Rgs1 deficiency in T cells modifies B cell migration

In order to investigate if Rgs1 KD in T cells alone can influence the migratory behavior of B cells, we co-transferred B and T cells from WT and Rgs1 KD mice into NOD.SCID mice in all four possible combinations (supplementary Fig. S3). Mice reconstituted with Rgs1 KD T cells had fewer TFH cells (Fig. 7a and 7b) irrespective of the genotype of co-transferred B cells, indicating that the effect of Rgs1 KD on TFH cell frequency is T cell-intrinsic. The frequency and number of B cells in the spleen of recipient mice was increased in the presence of Rgs1 KD T cells (Fig. 7c and 7d); in contrast, the frequency and number of CD4+ T cells was comparable in all experimental groups (Fig. 7e). These results suggest that Rgs1 deficiency in T cells is sufficient to modify B cell migration. Collectively, the data indicate that Rgs1 KD modifies B cell migration through both B cell-intrinsic and T cell-mediated effects.
Figure 7

Rgs1 KD in T cells is sufficient to modify B cell migration. T cells and B cells from WT and Rgs1 KD were co-transferred into NOD.SCID mice in all four combinations. Recipient mice were immunized with ovalbumin in CFA, and draining lymph nodes and spleen were analyzed 4 days later. Representative flow cytometry data (a,c) used to measure the frequency of CD4+CXCR5+ TFH cells (b), and the frequency and number of CD19+ B cells (d) and total CD4+ T cells (e). Data show mean values ± SEM from 4–5 mice per group.

Rgs1 KD sensitizes TFH cells to CCR7 ligands

The reduced frequency of TFH cells in Rgs1 KD mice could be due to impaired proliferation after immunization. Alternatively, compromised migration into the follicular area may hinder T cell differentiation towards a TFH cell phenotype. We found that Rgs1 was up-regulated after T cell activation (supplementary Fig. S4). However, reduced Rgs1 expression in transgenic T cells did not affect their proliferation (supplementary Fig. S4). To test if Rgs1 KD had a direct effect on TFH cell migration, CD4+ T cells isolated from immunized mice were subjected to a migration assay towards CCL19, CCL21 and CXCL13. TFH cells from WT mice migrated in response to CXCL13 but were irresponsive to CCR7 ligands (Fig. 8). In contrast, we found that Rgs1 silencing sensitized transgenic TFH cells to CCL19 and CCL21, without affecting migration towards CXCL13. It was shown previously that the expression of CXCR5 is not sufficient for TFH cell migration into the germinal centers[15]. TFH cells must also down regulate CCR7 signaling to skew chemotactic signals in favor of CXCL13. Our results show that silencing Rgs1 in T cells potentiates CCR7 responsiveness, a feature that may compromise the differentiation of TFH cells by positioning them outside of their follicular niche.
Figure 8

Rgs1 KD increases TFH cell sensitivity to CCR7 but not CXCR5 ligation. CD4+ T cells were purified from WT (black bars) and Rgs1 KD mice (white bars) and subjected to a transwell migration assays towards CCL19 and CCL21 (100 ng/ml, top panel) or CXCL13 (concentration as indicated, bottom panel). After 4 hours incubation, transmigrated cells were labeled for CD4 and CXCR5 and analyzed by FACS. Data show the percentage CD4+CXCR5+ cells within the CD4+ population and represents means ± SEM of 3 biological replicates. * p < 0.05, ** p < 0.01 (unpaired t-test).

DISCUSSION

In this study, we describe a functional link between Rgs1 and TFH cells. Rgs1 had previously been implicated in chemokine receptor signaling in both T and B cells[9-12]. In particular, Rgs1 deletion was shown to modify the migratory behavior of B cells within follicular areas and to increase germinal center formation[9-11]. Even the partial loss of Rgs1 in heterozygous Rgs1 mutant mice was demonstrated to impact chemokine responses[11], and this was confirmed in our experiments with Rgs1 KD mice. Germinal centers are structured into the so-called dark and light zones[13]. These zones are functionally distinct, and their organization is strictly dependent on CXCR4 signals that retain centroblasts - dividing B cells undergoing somatic hypermutation - within the dark zone[25]. In CXCR4-deficient mice, germinal centers lack distinguishable dark and light zones. The cycling of germinal center B cells from the dark to the light zone and back thus requires sequential up- and down-regulation of CXCR4 signals. Expression of CXCR4 itself modifies these signals. In addition, increased Rgs1 expression is required to desensitize B cells to CXCR4 ligation. Consistent with this notion, germinal centers in Rgs1 KO mice feature a more prominent dark zone[9], likely because GC B cells stay sensitive to CXCL12 even after decreasing CXCR4 expression. Consequently, the abnormal size and structure of germinal centers in Rgs1 deficient mice had been attributed primarily to a change in B cell chemotaxis. However, Rgs1 is also expressed in T cells[12]. Rgs1 is upregulated following T cell activation, and is expressed at particularly high levels in TFH cells[16]. TFH cells localize to the follicular areas of secondary lymphoid organs, and participate in germinal center reactions. Their correct localization requires not only up-regulation of CXCR5, that draws TFH cells towards B cell areas, but simultaneous down-regulation of CCR7 signals[15]. Expression of CXCR5 alone was shown to be insufficient to promote T cell migration into follicles. Notably, CCR7 expression is reduced but not absent in TFH cells[15]. Furthermore, Kehrl and colleagues have reported that partial loss of CCR7 is insufficient to significantly diminish CCR7-dependent chemotaxis[10]. Rgs1 expression may thus serve to further desensitize activated T cells to CCR7 ligands that would otherwise retain them in the T cell zone. We propose that loss of Rgs1 impairs the migration of activated T cells into the B cell zone and thereby inhibits the full differentiation of TFH cells[26]. In a situation analogous to Rgs1 KO B cells being retained in the dark zone by hypersensitivity to CXCL12, Rgs1 deficient T cells are presumably retained in the T cell zone by hypersensitivity to CCL19 and CCL21. This idea is supported by our observation that Rgs1 KD TFH cells migrated in response to CCR7 ligation, while WT TFH cell did not. Of note, CCR7 expression itself was not affected by Rgs1 KD (data not shown). Our data thus indicate that Rgs1 is a key modifier of T cell localization within lymphoid organs, and that Rgs1 plays a role in the differentiation of TFH cells. Interestingly, our data suggest that Rgs1 silencing in T cells alone had an effect on B cell migration. We posit that the germinal center phenotype described for Rgs1 KO mice may be exacerbated by a change in T cell function, and that this phenotype is not solely caused by B cell-intrinsic effects. Both previously reported data[9] and our own experiments support the notion that loss of Rgs1 directly affects B cell migration. However, T cells appear to contribute to altered B cell trafficking in Rgs1 deficient mice. Mice devoid of TFH cells fail to form germinal centers. The observations that loss of Rgs1 both reduces TFH cell frequency and increases germinal center formation may seem contradictory. This unexpected correlation could be explained first by the fact that the B cell-intrinsic effects of Rgs1 deficiency are dominant, and second because TFH cells are reduced in number but not entirely absent in Rgs1 KD mice. Rgs1 KD had a moderate impact on TFH cells overall, and it will be of interest to revisit Rgs1’s role in TFH cells in the context of mice completely deficient in Rgs1[9]. Exactly how and to what extent the loss of Rgs1 in T cells might contribute to increased germinal center size remains to be explained. Notwithstanding, our findings that Rgs1 plays a role in TFH cells may provide a possible explanation for the association of RGS1 with several autoimmune disorders including type 1 diabetes[2-5]. TFH cells have been implicated in multiple sclerosis[27,28] and type 1 diabetes[17-19]. Conceivably, RGS1 variants that promote TFH cell formation could increase the risk of autoimmunity. In this regard, a disease-associated RGS1 variant has been associated with elevated levels of CXCL13 in the cerebrospinal fluid of multiple sclerosis patients, thus linking a TFH-relevant chemokine to RGS1 gene variation in the context of autoimmune disease[29]. Whether an analogous relationship can be found between the type 1 diabetes-associated variants and TFH cell frequency warrants further investigation. In sum, we have shown that Rgs1 is a critical modifier of T cell migration within lymphoid tissue, and that this disease-associated gene participates in the development and function of TFH cells. In light of multiple recent publication reporting an association between elevated TFH cell frequency and type 1 diabetes[17-19], our findings raise the intriguing possibility that RGS1 variation impacts the risk of autoimmunity owing to its role in TFH cells.

MATERIALS AND METHODS

Mice

Non-obese diabetic (NOD) mice were maintained under specific pathogen-free conditions at the Joslin Diabetes Center. Transgenic mice were generated as described previously[30]. Briefly, lentiviral vectors encoding a short-hairpin RNA (shRNA) that targets the sequences CGCAAATAACAGTTGCTATTA (#1) or GCATAACAAAGCAGAGAATAT (#3) in the Rgs1 gene were used in which shRNA expression is under the control of a tetracycline-inducible promoter[21]. The same lentiviral construct also encodes the tetracycline repressor and a GFP reporter, both driven by a constitutive promoter[21]. Lentiviral particles were microinjected into the perivitelline space of NOD zygotes. Transduced embryos were re-implanted into pseudo-pregnant NOD mice. Transgenic animals were identified by GFP expression, and bred several generations to establish stable lines carrying a hemizygous transgene with Mendelian inheritance. Transgenic mice were treated with 100 µg/ml doxycycline in the drinking water to silence Rgs1 in all experiments unless specified. Data for shRNA #1 mice are shown in all experiments, unless otherwise noted. All experiments were approved by the Institutional Committee for the Care and Use of Animals (IACUC) at the Joslin Diabetes Center (protocol #2014-01).

Luciferase assay

The Rgs1 cDNA (GenBank: BC028634.1) was cloned into the dual-luciferase reporter plasmid psiCheck2 (Promega). HEK293T cells were transfected using Fugene 6 transfection reagent (Promega) combining 100 ng psiCheck2 plasmid together with 300 ng lentiviral vector pUTG containing a doxycycline-inducible shRNA sequences against Rgs1. Luminescence in cell lysates was measured with a SynergyMx luminometer (Biotek) after 48h to assess reporter silencing.

Western blotting

To validate the knockdown efficiency of selected shRNA sequences in vitro, HEK293T cells were co-transfected with 1 µg of pcDNA3 plasmid containing the Rgs1 gene fused to a N-terminus FLAG-tag peptide and 1 µg of pUTG vector containing a shRNA sequence against Rgs1 transcript. Cell lysates were resolved in a 15% SDS-PAGE and transferred onto a nitrocellulose membrane. Proteins were visualized using the following antibodies: HRP-anti-FLAG antibody (Sigma) and rabbit anti-actin antibody (Santa Cruz Biotech) Endogenous Rgs1 expression in lymphocytes was also analyzed using an anti-rabbit Rgs1 antibody (Thermo Scientific).

Quantitative PCR

RNA isolation was performed using TRIzol reagent (Life Technologies). Subsequently cDNA was synthesized using the Superscript III (Life Technologies) according to manufacturer’s protocol. Quantitative Rgs1 PCR was performed using the following primers: Fwd 5’ TTTTCTGCTAGCCCAAAGGA 3’ and Rev 5’ TGTTTTCACGTCCATTCCAA 3’. Results were normalized to GAPDH.

Lymphocyte migration assays

T and B cells were isolated by magnetic sorting using a Pan T cell isolation kit II or a CD43 (Ly48) Microbeads respectively (Miltenyi Biotech). Cell purity following magnetic sorting was >95% for all experiments. Cells derived from Rgs1 KD (GFP+) and wild type (GFP−) mice were mixed in a 1:1 ratio and placed in the upper chamber of transwell plate. In the lower chamber, CCL19, CCL21, CXCL12 or CXCL13 was added to the media at the indicated concentrations. Cells that transmigrated to the lower chamber over the period of 4 hours were analyzed by flow cytometry. Percentage of migration = (number of cells in the lower chamber after migration / input cell number in the upper chamber) × 100.

Diabetes measurements

Diabetes incidence in transgenic mice was compared to non-transgenic littermates. Four-week old mice were fed 100 µg/ml of doxycycline in drinking water ad libitum and were either left to develop diabetes spontaneously over the course of 30 weeks or administered 200 mg/kg cyclophosphamide intraperitoneally to accelerate diabetes onset. In additional experiments, adoptive transfer of diabetes was performed by injecting intravenously 2 × 106 splenocytes from overtly diabetic NOD Rgs1 KD mice into 6-week old NOD.SCID mice. Cell recipients were then either treated or not with doxycycline. Diabetes was tested by glycosuria measurements using Diastix (Bayer). Mice with two consecutive readings of 250 mg/dl were considered diabetic.

Histology and immunofluorescence

Five days after subcutaneous immunization in the leg with ovalbumin in complete Freund adjuvant (CFA), mice were euthanized and spleen, axillary lymph nodes (ALN) and inguinal lymph nodes (ILN) were dissected and frozen in OCT medium. Sections mounted on slides were stained with the following antibodies: anti-CD45R (B220) Alexa fluor 488 (eBioscience), anti-Ki67 (eBioscience), anti-CD4 (Serotec) or biotinylated peanut agglutinin (PNA) (Sigma), followed by the secondary antibody anti-rat Alexa Fluor 488 or Alexa Fluor-594 streptavidin (Invitrogen), and analyzed by fluorescent microscopy. Germinal centers size was determined using the measuring tool in the CellSense software (Olympus).

Flow cytometry

Lymphocytes were purified from the spleen or lymph nodes of WT and Rgs1 KD mice and labelled with the following antibodies: anti-PD1 PE-Cy7, anti-CXCR5 APC, anti-CD4 PE, anti-IgD PE, anti-ICOS PE or anti-CD19 PB (BioLegend). Foxp3 intracellular staining kit (eBioscience) was used to label follicular regulatory T cells. Fixation/Permeabilization buffers were used to stain intracellular Bcl6 and Ki-67. Intrinsic GFP and Raspberry fluorophores were also analyzed in specific experiments. Data were acquired on an LSRII flow cytometer (BD Biosciences) and analyzed using the FlowJo software (TreeStar Inc.).

B cell transfer assay

B cells were isolated from NOD Raspberry donors by negative selection using CD43 (Ly-48) magnetic beads (Miltenyi Biotech). Cell purity following magnetic sorting was > 95%. 2 × 107 cells were injected intravenously into age and gender matched WT or Rgs1 KD NOD mice. Two weeks later, mice were immunized via intradermal injection in the leg with 160 µg of ovalbumin in complete Freund’s adjuvant (CFA). Mice were euthanized for analysis four days later.

Lymphocyte transfer into NOD.SCID mice

T and B lymphocytes were isolated by magnetic sorting from WT or Rgs1 KD mice by negative selection using the Pan T cell isolation kit or CD43 (Ly-48) microbeads (Miltenyi Biotech.). WT and Rgs1 KD T and B cells (each 1 × 107) were mixed at a 1:1 ratio in all four combinations. A total of 2 × 107 cells were injected intravenously into age and gender matched NOD.SCID recipient mice. Two weeks later, mice were immunized as described previously. Mice were euthanized for analysis of lymph nodes and spleens four days later.

Statistical analyses

Experimental groups were compared by two-tailed unpaired student’s t-test using the GraphPad Prism software (Treestar Inc.). A P value < 0.05 was considered significant. Sufficient sample size was estimated withouth the use of a power calculation. No samples were excluded from the analysis. No randomization was used for animal experiments. Data analysis was not blinded.
  30 in total

Review 1.  Germinal centers.

Authors:  Gabriel D Victora; Michel C Nussenzweig
Journal:  Annu Rev Immunol       Date:  2012-01-03       Impact factor: 28.527

Review 2.  Heterotrimeric G protein activation by G-protein-coupled receptors.

Authors:  William M Oldham; Heidi E Hamm
Journal:  Nat Rev Mol Cell Biol       Date:  2008-01       Impact factor: 94.444

3.  RGS molecule expression in murine B lymphocytes and ability to down-regulate chemotaxis to lymphoid chemokines.

Authors:  K Reif; J G Cyster
Journal:  J Immunol       Date:  2000-05-01       Impact factor: 5.422

4.  Rgs1 and Gnai2 regulate the entrance of B lymphocytes into lymph nodes and B cell motility within lymph node follicles.

Authors:  Sang-Bae Han; Chantal Moratz; Ning-Na Huang; Brian Kelsall; Hyeseon Cho; Chong-Shan Shi; Owen Schwartz; John H Kehrl
Journal:  Immunity       Date:  2005-03       Impact factor: 31.745

Review 5.  Chemokine-mediated control of T cell traffic in lymphoid and peripheral tissues.

Authors:  Lisa M Ebert; Patrick Schaerli; Bernhard Moser
Journal:  Mol Immunol       Date:  2004-11-23       Impact factor: 4.407

Review 6.  From genome-wide association studies to etiology: probing autoimmunity genes by RNAi.

Authors:  Stephan Kissler
Journal:  Trends Mol Med       Date:  2011-07-23       Impact factor: 11.951

7.  Germinal center dark and light zone organization is mediated by CXCR4 and CXCR5.

Authors:  Christopher D C Allen; K Mark Ansel; Caroline Low; Robin Lesley; Hirokazu Tamamura; Nobutaka Fujii; Jason G Cyster
Journal:  Nat Immunol       Date:  2004-08-01       Impact factor: 25.606

8.  Multiple sclerosis risk genotypes correlate with an elevated cerebrospinal fluid level of the suggested prognostic marker CXCL13.

Authors:  M Lindén; M Khademi; I Lima Bomfim; F Piehl; M Jagodic; I Kockum; T Olsson
Journal:  Mult Scler       Date:  2012-11-22       Impact factor: 6.312

9.  Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis.

Authors:  Stephen Sawcer; Garrett Hellenthal; Matti Pirinen; Chris C A Spencer; Nikolaos A Patsopoulos; Loukas Moutsianas; Alexander Dilthey; Zhan Su; Colin Freeman; Sarah E Hunt; Sarah Edkins; Emma Gray; David R Booth; Simon C Potter; An Goris; Gavin Band; Annette Bang Oturai; Amy Strange; Janna Saarela; Céline Bellenguez; Bertrand Fontaine; Matthew Gillman; Bernhard Hemmer; Rhian Gwilliam; Frauke Zipp; Alagurevathi Jayakumar; Roland Martin; Stephen Leslie; Stanley Hawkins; Eleni Giannoulatou; Sandra D'alfonso; Hannah Blackburn; Filippo Martinelli Boneschi; Jennifer Liddle; Hanne F Harbo; Marc L Perez; Anne Spurkland; Matthew J Waller; Marcin P Mycko; Michelle Ricketts; Manuel Comabella; Naomi Hammond; Ingrid Kockum; Owen T McCann; Maria Ban; Pamela Whittaker; Anu Kemppinen; Paul Weston; Clive Hawkins; Sara Widaa; John Zajicek; Serge Dronov; Neil Robertson; Suzannah J Bumpstead; Lisa F Barcellos; Rathi Ravindrarajah; Roby Abraham; Lars Alfredsson; Kristin Ardlie; Cristin Aubin; Amie Baker; Katharine Baker; Sergio E Baranzini; Laura Bergamaschi; Roberto Bergamaschi; Allan Bernstein; Achim Berthele; Mike Boggild; Jonathan P Bradfield; David Brassat; Simon A Broadley; Dorothea Buck; Helmut Butzkueven; Ruggero Capra; William M Carroll; Paola Cavalla; Elisabeth G Celius; Sabine Cepok; Rosetta Chiavacci; Françoise Clerget-Darpoux; Katleen Clysters; Giancarlo Comi; Mark Cossburn; Isabelle Cournu-Rebeix; Mathew B Cox; Wendy Cozen; Bruce A C Cree; Anne H Cross; Daniele Cusi; Mark J Daly; Emma Davis; Paul I W de Bakker; Marc Debouverie; Marie Beatrice D'hooghe; Katherine Dixon; Rita Dobosi; Bénédicte Dubois; David Ellinghaus; Irina Elovaara; Federica Esposito; Claire Fontenille; Simon Foote; Andre Franke; Daniela Galimberti; Angelo Ghezzi; Joseph Glessner; Refujia Gomez; Olivier Gout; Colin Graham; Struan F A Grant; Franca Rosa Guerini; Hakon Hakonarson; Per Hall; Anders Hamsten; Hans-Peter Hartung; Rob N Heard; Simon Heath; Jeremy Hobart; Muna Hoshi; Carmen Infante-Duarte; Gillian Ingram; Wendy Ingram; Talat Islam; Maja Jagodic; Michael Kabesch; Allan G Kermode; Trevor J Kilpatrick; Cecilia Kim; Norman Klopp; Keijo Koivisto; Malin Larsson; Mark Lathrop; Jeannette S Lechner-Scott; Maurizio A Leone; Virpi Leppä; Ulrika Liljedahl; Izaura Lima Bomfim; Robin R Lincoln; Jenny Link; Jianjun Liu; Aslaug R Lorentzen; Sara Lupoli; Fabio Macciardi; Thomas Mack; Mark Marriott; Vittorio Martinelli; Deborah Mason; Jacob L McCauley; Frank Mentch; Inger-Lise Mero; Tania Mihalova; Xavier Montalban; John Mottershead; Kjell-Morten Myhr; Paola Naldi; William Ollier; Alison Page; Aarno Palotie; Jean Pelletier; Laura Piccio; Trevor Pickersgill; Fredrik Piehl; Susan Pobywajlo; Hong L Quach; Patricia P Ramsay; Mauri Reunanen; Richard Reynolds; John D Rioux; Mariaemma Rodegher; Sabine Roesner; Justin P Rubio; Ina-Maria Rückert; Marco Salvetti; Erika Salvi; Adam Santaniello; Catherine A Schaefer; Stefan Schreiber; Christian Schulze; Rodney J Scott; Finn Sellebjerg; Krzysztof W Selmaj; David Sexton; Ling Shen; Brigid Simms-Acuna; Sheila Skidmore; Patrick M A Sleiman; Cathrine Smestad; Per Soelberg Sørensen; Helle Bach Søndergaard; Jim Stankovich; Richard C Strange; Anna-Maija Sulonen; Emilie Sundqvist; Ann-Christine Syvänen; Francesca Taddeo; Bruce Taylor; Jenefer M Blackwell; Pentti Tienari; Elvira Bramon; Ayman Tourbah; Matthew A Brown; Ewa Tronczynska; Juan P Casas; Niall Tubridy; Aiden Corvin; Jane Vickery; Janusz Jankowski; Pablo Villoslada; Hugh S Markus; Kai Wang; Christopher G Mathew; James Wason; Colin N A Palmer; H-Erich Wichmann; Robert Plomin; Ernest Willoughby; Anna Rautanen; Juliane Winkelmann; Michael Wittig; Richard C Trembath; Jacqueline Yaouanq; Ananth C Viswanathan; Haitao Zhang; Nicholas W Wood; Rebecca Zuvich; Panos Deloukas; Cordelia Langford; Audrey Duncanson; Jorge R Oksenberg; Margaret A Pericak-Vance; Jonathan L Haines; Tomas Olsson; Jan Hillert; Adrian J Ivinson; Philip L De Jager; Leena Peltonen; Graeme J Stewart; David A Hafler; Stephen L Hauser; Gil McVean; Peter Donnelly; Alastair Compston
Journal:  Nature       Date:  2011-08-10       Impact factor: 49.962

10.  Follicular helper T cell signature in type 1 diabetes.

Authors:  Rupert Kenefeck; Chun Jing Wang; Tauseef Kapadi; Lukasz Wardzinski; Kesley Attridge; Louise E Clough; Frank Heuts; Alexandros Kogimtzis; Sapna Patel; Miranda Rosenthal; Masahiro Ono; David M Sansom; Parth Narendran; Lucy S K Walker
Journal:  J Clin Invest       Date:  2014-12-08       Impact factor: 14.808

View more
  9 in total

1.  AhR Activation Leads to Attenuation of Murine Autoimmune Hepatitis: Single-Cell RNA-Seq Analysis Reveals Unique Immune Cell Phenotypes and Gene Expression Changes in the Liver.

Authors:  Alkeiver S Cannon; Bryan Latrell Holloman; Kiesha Wilson; Kathryn Miranda; Nicholas Dopkins; Prakash Nagarkatti; Mitzi Nagarkatti
Journal:  Front Immunol       Date:  2022-06-03       Impact factor: 8.786

2.  An Immune-Related Prognostic Signature Predicts Overall Survival in Stomach Adenocarcinomas.

Authors:  Kangjie Zhou; Nan Hu; Yidong Hong; Xueyu Wu; Jingzhou Zhang; Huan Lai; Yang Zhang; Fenglei Wu
Journal:  Front Genet       Date:  2022-05-23       Impact factor: 4.772

3.  Chromosome contacts in activated T cells identify autoimmune disease candidate genes.

Authors:  Oliver S Burren; Arcadio Rubio García; Biola-Maria Javierre; Daniel B Rainbow; Jonathan Cairns; Nicholas J Cooper; John J Lambourne; Ellen Schofield; Xaquin Castro Dopico; Ricardo C Ferreira; Richard Coulson; Frances Burden; Sophia P Rowlston; Kate Downes; Steven W Wingett; Mattia Frontini; Willem H Ouwehand; Peter Fraser; Mikhail Spivakov; John A Todd; Linda S Wicker; Antony J Cutler; Chris Wallace
Journal:  Genome Biol       Date:  2017-09-04       Impact factor: 13.583

4.  The Role of NOD Mice in Type 1 Diabetes Research: Lessons from the Past and Recommendations for the Future.

Authors:  Yi-Guang Chen; Clayton E Mathews; John P Driver
Journal:  Front Endocrinol (Lausanne)       Date:  2018-02-23       Impact factor: 5.555

5.  T cell landscape and dynamics in immunoglobulin light chain amyloidosis before and after daratumumab-based therapy.

Authors:  Yujia Wang; Lushuang Xu; Weijia Zhao; Xiaojie Chen; Lei Wen; Wenbing Duan; Xiao-Juan Yu; Fu- De Zhou; Yang Liu; Jie Hao; Xiaojun Huang; Jin Lu; Qing Ge
Journal:  Clin Transl Med       Date:  2021-11

Review 6.  Progress Toward a Multiomic Understanding of Traumatic Brain Injury: A Review.

Authors:  Philip A Kocheril; Shepard C Moore; Kiersten D Lenz; Harshini Mukundan; Laura M Lilley
Journal:  Biomark Insights       Date:  2022-06-13

7.  Expression of HLA and Autoimmune Pathway Genes in Liver Biopsies of Young Subjects With Autoimmune Hepatitis Type 1.

Authors:  Emilia Shin; Kathleen B Schwarz; Lorraine V Jones-Brando; Liliana D Florea; Sarven Sabunciyan; Laura Delong Wood; Robert H Yolken
Journal:  J Pediatr Gastroenterol Nutr       Date:  2022-06-27       Impact factor: 3.288

8.  Ageing-Associated Transcriptomic Alterations in Peri-Implantitis Pathology: A Bioinformatic Study.

Authors:  Zhaojun Tian
Journal:  Dis Markers       Date:  2022-10-11       Impact factor: 3.464

9.  Epigenetic Alterations Are Associated With Gastric Emptying Disturbances in Diabetes Mellitus.

Authors:  Susrutha Puthanmadhom Narayanan; Jeong-Heon Lee; Aditya Bhagwate; Saatchi Kuwelker; Huihuang Yan; Tamas Ordog; Adil E Bharucha
Journal:  Clin Transl Gastroenterol       Date:  2020-03       Impact factor: 4.396

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.