Viraphong Lulitanond1, Marutpong Panya1,2, Namfon Suebwongsa1, Baltasar Mayo3, Panjamaporn Yotpanya1. 1. Department of Microbiology and Research and Diagnostic Center for Emerging Infectious Diseases, Faculty of Medicine, Khon Kaen University, Khon Kaen, 40002 Thailand. 2. College of Medicine and Public Health, Ubon Ratchathani University, Ubon Ratchathani, 34190 Thailand. 3. Departamento de Microbiología y Bioquímica, Instituto de Productos Lácteos de Asturias (IPLA-CSIC), Paseo Río Linares, s/n, 33300 Villaviciosa, Asturias Spain.
Abstract
There is an increasing interest to develop various lactic acid bacteria (LAB) species as mucosal delivery vehicles, for which the development of a variety of cloning and expression systems for these bacteria is of primary importance. This study reports the complete nucleotide sequence of the cryptic plasmid pRCEID7.6 derived from the chicken probiotic LAB strain Lactobacillus casei TISTR1341. Sequence analysis and comparison showed that pRCEID7.6 is composed of nine putative open reading frames. The replicon origin of pRCEID7.6 consisted of untranslated origin of replication and translated replication protein B sequences. This region was used to construct Escherichia coli/L. casei shuttle vectors carrying erythromycin and chloramphenicol resistance genes as selective markers. Segregation and structural stability of the vectors in L. casei was sufficient for most genetic applications. The feasibility of this vector for heterologous protein expression in L. casei was determined by cloning in pRCEID-LC7.6, the gene encoding the nucleocapsid protein (NP), from the influenza A virus under the control of the homologous promoter from the lactate dehydrogenase gene. L. casei carrying this recombinant plasmid was shown to successfully express the NP protein. Therefore, this shuttle vector can be used for further study in the development of mucosal delivery vehicles.
There is an increasing interest to develop various lactic acid bacteria (LAB) species as mucosal delivery vehicles, for which the development of a variety of cloning and expression systems for these bacteria is of primary importance. This study reports the complete nucleotide sequence of the cryptic plasmid pRCEID7.6 derived from the chicken probiotic LAB strain Lactobacillus casei TISTR1341. Sequence analysis and comparison showed that pRCEID7.6 is composed of nine putative open reading frames. The replicon origin of pRCEID7.6 consisted of untranslated origin of replication and translated replication protein B sequences. This region was used to construct Escherichia coli/L. caseishuttle vectors carrying erythromycin and chloramphenicol resistance genes as selective markers. Segregation and structural stability of the vectors in L. casei was sufficient for most genetic applications. The feasibility of this vector for heterologous protein expression in L. casei was determined by cloning in pRCEID-LC7.6, the gene encoding the nucleocapsid protein (NP), from the influenza A virus under the control of the homologous promoter from the lactate dehydrogenase gene. L. casei carrying this recombinant plasmid was shown to successfully express the NP protein. Therefore, this shuttle vector can be used for further study in the development of mucosal delivery vehicles.
Lactobacillus casei is a member of the lactic acid bacteria (LAB) that can be found in various environments, including that of animal and human intestines (Kandler and Weiss 1986). Besides generally recognized as safe (GRAS) status, many strains of LAB including a number of L. casei strains are also recognized as probiotics, defined as “live microorganisms that, when administered in adequate amounts, confer a health benefit on the host” (Hill et al. 2014). Some strains of L. casei have been demonstrated to exert probiotic properties, such as anti-infective, anti-tumor, and immunomodulating activity (Kim et al. 2006; Ohashi et al. 1989).There is now a growing trend in the development of LAB as mucosal vaccines, as well as vehicles for the delivery of therapeutic and prophylactic molecules. A major advantage of using LAB as mucosal delivery vehicles is their ability to be engineered to express both homologous and heterologous proteins. Many studies have successfully used L. casei to express a variety of heterologous proteins of viral (Suebwongsa et al. 2013), bacterial (Liu et al. 2014), and mammalian origin (Qiu et al. 2013). One critical step to develop L. casei and other LAB as mucosal delivery vehicles is to construct the expression systems for these bacteria. Generally, most of the genetic manipulations in the development process are preferred to be done in Escherichia coli than in Lactobacillus species, thus E.coli/Lactobacillusshuttle vectors are the essential part of the process.The construction of E. coli/Lactobacillusshuttle vectors is usually based on replicons, a DNA region that necessary for plasmid replication, derived from both E. coli and Lactobacillus species. The replicon of later species is derived from cryptic plasmid of Lactobacillus species. For the effective expression system for either homologous or heterologous proteins, the basic biological properties of plasmid vector, for example mode of replication, copy number, and stability, are key factors (Shareck et al. 2004). Previously, the researchers had determined the complete nucleotide sequence from three of the four plasmids derived from L. casei TISTR 1341, a probiotic strain isolated from chickens obtained from the Thailand Institute of Scientific and Technological Research (TISTR). The replicons from the largest and the smallest plasmids, pRCEID13.9 and pRCEID2.9 respectively, have already been successfully used to construct E. coli/Lactobacillusshuttle vectors (Panya et al. 2012).In this study, the fourth plasmid of L. casei TISTR 1341, pRCEID7.6, was sequenced and its sequence analyzed. The replicon of this plasmid was then used to generate a new E. coli/Lactobacillusshuttle vector. The vector was successfully used for the expression of NP, a synthetic gene based on the nucleocapsid protein (NP) gene of the influenza A virus, in L. casei. Expression of this protein would allow its use as a mucosal delivery vehicle for oral immunization.
Methods
Bacterial strains and their growth conditions
Bacterial strains used in this study are listed in Table 1. Lactobacillus strains were cultured statically in de Man Rogosa Sharpe (MRS) medium (Difco, East Molesey, UK) at 37 °C. E. coli cells were grown in Luria–Bertani (LB) broth at 37 °C with vigorous shaking. When needed, antibiotics were added to the media as follows: for E. coli, ampicillin (100 µg/ml), chloramphenicol (10 µg/ml); for L. casei, erythromycin (2.5 µg/ml), chloramphenicol (5 µg/ml), and tetracycline (10 µg/ml). White/blue selection was done on LB agar supplemented with ampicillin, 20 mg/ml of 5-bromo-4chloro-3-indolyl-β-d-galatopyonoside (X-Gal) and 0.4 M of isopropyl-β-d-thiogalactopyranoside (IPTG) (Sigma-Aldrich, St. Louis, MO, USA).
Table 1
List of bacterial strains, plasmids, and oligonucleotide primers utilized in this study
Materials
Relevant properties
Source or reference
Bacteria
Escherichia coli XL-1 Blue
White/blue screening
Stratagene, La Jolla, CA
Lactobacilluscasei TISTR1341
Source of pRCEID7.6 native plasmid
TISTR
Lactobacillus casei RCEID02
Plasmid-free L. casei TISTR1341-derivative
Panya et al. (2012)
Lactobacillus casei ATCC393
Plasmid-free stain
ATCC
Plasmids
pUC19E
Apr, Emr, pUC19 carrying the Emr gene from pE194 at the SmaI site
Leenhouts et al. (1991)
pGEM-T easy
Apr, M13ori, T-overhang cloning vector
Promega, MD, USA
pRCEID-LC2.9
Apr, Emr, E. coli/L. casei shuttle vector based on pRCEID2.9
Panya et al. (2012)
pRCEID-LC13.9Tc
Apr, Tcr, pRCEID-LC13.9 derivative, the Tcr gene was inserted at SacI site
Panya et al. (2012)
pNZ8048
Cmr, NcoI site used for translational fusions, standard vector
Mierau and Kleerebezem (2005)
Oligonucleotides
Sequence (5′–3′)
p6.8F-1
gggtcagttttgccttatg
This study
P6.8R-1
ctggcaatgactttgcgga
This study
p6.8F
attgcttggatcctctggcatgacaaac (BamHI)
This study
p6.8R
ctttttggtatacggatccagtcgcta (KpnI)
This study
SpeI-ldh_F
caaactagtagcttttagtcctcgtgaaaa (SpeI)
Suebwongsa et al. (2013)
pnisNdeI
attacatatgaagctcgcgttatcggtc (NdeI)
Suebwongsa et al. (2013)
Underlined nucleotides show introduced restriction enzyme sites, which are indicated in parenthesis
TISTR Thailand Institute of Scientific and Technological Research, ATCC American Type Culture Collection
List of bacterial strains, plasmids, and oligonucleotide primers utilized in this studyUnderlined nucleotides show introduced restriction enzyme sites, which are indicated in parenthesisTISTR Thailand Institute of Scientific and Technological Research, ATCC American Type Culture Collection
DNA isolation and purification
Plasmids from E. coli were isolated the by an alkaline lysis method, as described by Sambrook and Russell (2001). Plasmids from LAB were isolated by the O’Sullivan and Klaenhammer method (O’Sullivan and Klaenhammer O’Sullivan and Klaenhammer 1993). Total genomic DNA of L. casei was extracted and purified from the mid-log phase of bacterial cultures by using QIAamp DNA Mini Kit according to the instructions of the manufacturer (Qiagen, Hilden, Germany). Purified plasmids were verified by agarose gels electrophoresis, stained with ethidium bromide and visualized under UV light, and photographed.
General DNA manipulation
General DNA manipulations were performed as described by (Sambrook and Russell 2001). Restriction endonuclease and T4 ligase were obtained from Fermentas (Fermentas, USA), Taq and Pfu polymerases were obtained from RBC (RBC, Taiwan). PCR amplicons and DNA fragments from agarose gels were purified using the Gel/PCR DNA Fragments Extraction Kit (RBC, Taiwan) as recommended by the manufacturer. Nucleotide sequences of the recombinant plasmids were verified by sequencing using a MegaBACE 1000 sequencer (BioDesign Co. Ltd., Pathumthani, Thailand).
Plasmid sequencing and assembly
The contig2310 with a length of 6814 bp had been obtained as reported elsewhere (Panya et al. 2012). This sequence has been found to share high homology to several plasmids from LAB and proved to be unrelated to all other plasmid sequences from L. casei TISTR 1341. The researchers assumed the contig could be a major part of a plasmid with the length of 7.6 kb observed by agarose gel electrophoresis in L. casei TISTR 1341 (Panya et al. 2012). Thus, DNA from the band corresponding to that plasmid was extracted from a gel, purified, and used as a template to amplify the remaining sequence with conventional PCR using the primers p6.8F-1 and p6.8R-1 (Table 1). The amplicon obtained was cloned into pGEM-T easy vector and sequenced by using the primers M13F(−40) and M13R(−40) (Table 1). The obtained sequence was assembled with that of the previous contig2310 by using CLC Workbench 5.6 program.
Analysis of the plasmid nucleotide sequence
Nucleotide sequence similarity searches were performed using the BLAST program at the NCBI database (http://www.ncbi.nlm.nih.gov/BLAST/). Open reading frames (ORFs), Direct (DR) and Inverse (IR) repeat sequences, restriction endonuclease sites, and plasmid maps were determined using Clone Manager 7.0 software. The putative promoter and ribosome binding site (RBS) sequences were searched for by comparing with the consensus sequences (TTGACA for −35 box, TATAAT for −10 box, and AGGAGG for RBS). Protein structure and motives were searched for by using the Pfam search tool (http://pfam.sanger.ac.uk/).
Plasmid transfer
Plasmids were introduced into either E. coli or L. casei by electroporation. E. coli electroporation was performed using a Gene Pulser apparatus (Bio-Rad, Richmond, CA, USA) as described by Dower et al. (1988). Preparation of competent cells and electroporation of L. casei was performed as previously described by (Chassy and Flickinger 1987).
Construction of E. coli/L. casei shuttle vector
The cloning procedure to obtain the pRCEID7.6-derived shuttle vector is shown in Fig. 2. Initially, a DNA sequence containing the ori, and repB genes from pRCEID7.6 was amplified by PCR using primers p6.8F and p6.8R (Table 1). The amplified segment was cloned into pGEM-T Easy vector resulting in a pGEM:pRCEID7.6Rep. The pRCEID7.6 replicon was recovered from pGEM:pRCEID7.6Rep by double AatII/NdeI digestion and cloned into AatII/NdeI-digested pUC19E, a pUC19 derivative contain E. coli replicon that does not replicate in L. casei but contains an erythromycin resistance gene as selective marker (Leenhouts et al. 1991), resulting in the construct pRCEID-LC7.6. To change the selective marker from erythromycin-resistant gene (EmR) to chloramphenicol-resistant gene (cat), the pRCEID-LC7.6 was digested with SalI to remove the EmR gene and was self-ligated, giving rise to pRCEID-LC7.6ery-. The chloramphenicol resistant gene (cat) was obtained from pNZ8048 by double SalI/SpeI digestion and was inserted into SalI/SpeI-digested pRCEID-LC7.6ery-, resulted in pRCEID-LC7.6Cm.
Fig. 2
Construction of the shuttle vectors, pRCEID-LC7.6 and its derivatives, pRCEID-LC7.6ery-, and pRCEID-LC7.6Cm. amp, ery and cm = ampicillin, erythromycin, and chloramphenicol resistant genes respectively
Segregational and structural stability of the constructs
The segregational and structural stability of a pRCEID-LC7.6 shuttle vector was studied in L. casei RCEID02, a plasmid-free derivative from L. casei TISTR 1341. Transformants with pRCEID-LC7.6 were grown in MRS broth without erythromycin for approximately 200 generations. Every 20 generations, an aliquot of the culture was removed, diluted, and plated onto antibiotic-free MRS medium. One hundred colonies were selected and then replicated on MRS agar with and without erythromycin. For segregational stability, colonies grown on MRS agar with and without antibiotics were counted and calculated as follow: (NA/NNA) × 100, where NA and NNA is number of colonies appearing on MRS plate with and without erythromycin, respectively. For plasmid structural stability was checked by restriction analysis of plasmids isolated from colonies grown on MRS agar supplement with erythromycin at approximately 20, 40, 60, 80 and 100 generation intervals.
Determination of plasmid copy number
Real-time quantitative PCR was used to determine the relative copy number of pRCEID-LC7.6 in L. casei RCEID02 as described by (Lee et al. 2006). The copy number of the constructs was calculated using the formula Nrelative = (1 + E)−ΔCT, where E is amplification efficiency of the target (EmR) and reference (greA) genes, and −ΔCT is the difference between the threshold cycle number of the reference gene and that of the target. DNA amplification and detection was performed in a Fast Real-Time PCR equipment (Applied Biosystems, Foster City, CA, USA) using SYBR® Green (Power SYBR® Green PCR Master Mix, Applied Biosystems).
Compatibility of the construct
The compatibility of pRCEID-LC7.6Cm with other vectors was assayed in L. casei RCEID02. Competent cells of L. casei harboring pRCEID-LC7.Cm were electrotransformed with pRCEID-LC2.9 and pRCEID-LC13.9Tc. Transformants were grown on MRS agar supplemented with appropriate antibiotics. The colonies on MRS agar were randomly selected for plasmid isolation. The plasmid profile was verified by agarose gel electrophoresis.
Construction of pRCEID-LC7.6:LdhL:NP:TT
The DNA segment containing the promoter of the lactate dehydrogenase (LdhL) gene, the synthetic gene encoding the NP protein of influenza A virus and a transcription terminator (TT) obtained from pNZ8048, was amplified from pLC13.9:LdhL:NP:TT (Suebwongsa et al. 2013) using primers SpeI-ldh_F and pnisNdeI (Table 1). The amplicon was digested with SpeI/NdeI and inserted into pRCEID-LC7.6 digested with the same restriction endonuclease enzymes, resulting in pRCEID-LC7.6:LdhL:NP:TT.
Detection of NP by Western blotting analysis
The bacterial cell lysates obtained by sonication from overnight cultures of E. coli and L. casei RCEID02 transformants containing pRCEID-LC7.6:LdhL:NP:TT were subjected to SDS-PAGE (12 % of SDS-PAGE, 100 V for 2 h) and their proteins transferred from the gel to a nitrocellulose membrane (Bio-Rad, Hercules, California, USA) by using the Trans-Blot® SD Semi-Dry Electrophoretic Transfer Cell (Bio-Rad, Hercules, California, USA). The NP protein on the membrane was detected by a chemiluminescent detection system (CL-XPosure Film; Thermo Scientific, West Palm Beach, Florida, USA) using anti-Avian Influenza A Nucleoprotein antibody (Abcam, Cambrideg, UK), HRP-conjugated anti-rabbit IgG antibody (Abcam, Cambrideg, UK), and SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific, West Palm Beach, Florida, USA).
Nucleotide sequence accession number
The complete nucleotide sequence of pRCEID7.6 was deposited in the GenBank database under accession number JN793951.
Results
Sequencing, sequence comparison and assemblage of pRCEID7.6
Initially, the contig2310 with a total length of 6814 bases showed a nucleotide identity of 96 and 87 % of the segments embraced by the positions 696–3639 and 5944–6814 respectively to sequences of plasmid pCD01 (AY662330.1) from Lactobacillus paracasei NFBC338, strongly suggesting that the contig may be part of pRCEID7.6, the missing plasmid of L. casei TISTR 1341 (Panya et al. 2012). To verify this possibility and to complete the nucleotide plasmid sequence, primers in opposite orientation were designed based on the sequence flanking both sides of the contig and used in PCR amplifications using as a template plasmid pRCEID7.6 isolated from a gel. A single amplicon of 1 kb was obtained which was subsequently cloned in E. coli in the pGEM-T vector and double stranded sequenced. Finally, assemblage of the new sequence to that of contig2310 produced a total 7604 bp which, after analysis, was considered to constitute the whole molecule of pRCEID 7.6.
Sequence analysis of pRCEID7.6
The genetic organization of the plasmid pRCEID7.6 is depicted in Fig. 1. Nucleotide and deduced amino acid comparisons against the GenBank database predicted that pRCEID7.6 was composed of nine ORFs larger than 50 amino acids. The products of these ORFs and the most homologous protein in databases to each of them are listed in Table 2.
Fig. 1
Physical and genetic map of the plasmid pRCEID7.6 (7604 bp) from L. casei TISTR1341. Arrows indicate the length and direction of the ORFs. Relevant unique restriction enzyme sites are indicated. The ori region of the plasmid is denoted by a solid box. DR direct repeats, IR inverted repeats
Table 2
Open reading frames (ORFs) identified in the 7604-bp plasmid pRCEID7.6 from L. casei TISTR1341
Gene/ORF
% GC content
5′ end position
3′ end position
No. of aa.
Known protein with the highest homology (microorganism)
% amino acid identity (length)
GenBank accession no.
repB
39
297
1076
259
Plasmid replication protein, RepB
100 (259)
YP_003329273.1
Plasmid pCD01p07 (L. paracasei subsp. paracasei)
ORF2
42
1461
1772
103
Hypothetical protein of plasmid pCD01p08 (L. paracasei subsp. paracasei)
97 (100)
YP_003329274.1
ORF3a
41
1609
2148
179
Putative replication protein of plasmid pCD01 (L. paracasei subsp. paracasei)
100 (179)
YP_003329275.1
ORF4a
36
2316
2684
122
Hypothetical protein LSEI_A19 of plasmid1 (L. casei ATCC334)
100 (122)
YP_796451.1
ORF5a
39
2977
3627
216
Hypothetical protein of plasmid1 (L. casei)
100 (216)
YP_005351865
ORF6a
38
3696
4886
396
C-terminus part of type IC specificity subunit protein (L. rhamnosus)
92 (180)
ZP_04439481.1
ORF7
43
6027
6377
116
Plasmid replication protein of pLR001 (L. rhamnosus HN001)
Physical and genetic map of the plasmid pRCEID7.6 (7604 bp) from L. casei TISTR1341. Arrows indicate the length and direction of the ORFs. Relevant unique restriction enzyme sites are indicated. The ori region of the plasmid is denoted by a solid box. DR direct repeats, IR inverted repeatsOpen reading frames (ORFs) identified in the 7604-bp plasmid pRCEID7.6 from L. casei TISTR1341aORFs are encoded on the complementary strandThe product of three ORFs, repB, ORF3, and ORF7, encoded putative proteins involved in plasmid replication. The repB gene encoded a protein of 259 amino acids with 100 % amino acid identity with the replication protein B (RepB) of plasmid pCD01 (YP_003329273.1) from L. paracasei. Upstream of the repB gene of pRCEID7.6, a putative origin of replication (ori) region was observed, including a DR of 10-bp (ATACTTCTAA) repeated two times, and a tandem DR of 22-bp (ATAGGTCACCAAAAAGCACACG) repeated four times followed by a truncated repeat (ATAGGTCACCAAAAAG). This organization resembles the typical feature of the theta-replicating plasmid family of pUCL287 (Kanatani et al. 1995). Downstream of the 22-bp DR, a putative promoter (TTGtgtn15TtaAAT) was found. In addition, a possible ribosome binding site (RBS) (GAGGTG) downstream of the promoter was observed 7 bp upstream from the start codon of repB (ATG). Therefore, based on sequence similarity, pRCEID7.6 could be reasonably ascribed to the theta-mode of replication.Surprisingly, the gene product of ORF3 and ORF7 also showed homology to replication-associated proteins. ORF3 encoded 179 amino acid that have a 100 % identity to whole replication protein of plasmid pCD01 (YP_003329275.1) from L. paracasei NFBC338. Similarly, the gene product of ORF7, a protein of 116 amino acids, showed 99 % (115 amino acid identity) sequence identity to a 116 amino acids of putative replication protein of plasmid pLR001 (YP_002221586.1) from L. paracaseiHN001. However, since the immediate upstream sequence of these two ORFs lack the typical features of ori region, such as those described for repB, they are considered to be non-functional for the replication of pRCEID7.6ORF2 and ORF4 encoded protein with unknown function. ORF2 encoded 103 amino acid with 97 % similarity to hypothetical protein of plasmid pCD01p08 (YP_003329274.1) from L. paracasei. ORF4 encoded a protein of 122 amino acids with 100 % similarity to an hypothetical protein of plasmid1 (YP_796451.1) from L. casei ATCC334. A conserved RBS (GGGAGA) was found at 7 bp upstream of the start codon (ATG) of ORF4. The gene product of ORF5 consisted of 216 amino acids with 100 % homology to an hypothetical protein of plasmid1 of L. casei ATCC334 (YP_796451). ORF8 and ORF9 were found to encode proteins responsible, most likely, for plasmid recombination and integration. ORF8 encoded a protein of 178 amino acid s with 96 % identity to transposases (ZP_04672204.1) from L. paracasei 8700:2. This protein is known as a member of transposase family with DDE_Tnp domain (PF01609). Similarly, ORF9 encoded a protein of 106 amino acids with 100 % identity to transposase (tnp4) (CAQ65752.1) from L. casei BL23 and transposase AEA57601.1 from L. casei BD-II.ORF6 encoded a peptide very similar to the partial part of C-terminal domain of a type IC specificity subunit protein with Methylase_S domain (pfam, PF01420). This domain is also known as a member of target recognition domain (TRD) involved in bacterial restriction-modification system.
Construction and characterization of the E. coli/L. casei shuttle vectors
Figure 2 shows the cloning steps for constructing the pRCEID7.6-derived E. coli/L. caseishuttle vectors. From the sequence analysis, it was considered that the pRCEID7.6 replication region (including the ori sequence and repB) could consist in the DNA segment encompassing the nucleotide positions from 135 to 1076. Primers were designed to amplify this region and the resulting amplicon was cloned in E. coli in pUC19E. As this vector carries an erythromycin resistance gene active in Gram-positives, the construct pRCEIC-LC7.6 was then electrotransformed into L. casei RCEID02 where it proved to drive plasmid replication.Construction of the shuttle vectors, pRCEID-LC7.6 and its derivatives, pRCEID-LC7.6ery-, and pRCEID-LC7.6Cm. amp, ery and cm = ampicillin, erythromycin, and chloramphenicol resistant genes respectivelyFor the vector to be compatible with the two previous vectors developed from other plasmids from the L. casei TISTR 1341 strain, the erythromycin resistance gene of construct pRCEID-LC7.6 was changed by a chloramphenicol resistance gene, giving rise to plasmid pRCEID-LC7.6Cm (Fig. 2). It was found that pRCEID-LC7.6 could compatibly replicate with both pRCEID-LC2.9 and pRCEID-LC13.9Tc in the same bacterial host (Fig. 3).
Fig. 3
Ethidium bromide staining agarose gel of plasmid profile of L. casei RCEID02 harboring pRCEID-LC7.6Cm (5.1 kb), pRCEID-LC2.9 (5.3 kb), and pRCEID-LC13.9Tc (7.1 kb). Lane 1 plasmid profile of L. casei RCEID02 harboring pRCEID-LC7.6Cm, pRCEID-LC2.9, and pRCEID-LC13.9Tc. Lane M Super coiled DNA ladder (Invitrogen, USA). On the left, sizes in base pairs of the different molecules of the ladder. The electrophoresis reaction was carried out by using 0.7 % agarose gel electrophoresis in ×1 TAE buffer at 50 voltages for 3 h
Ethidium bromide staining agarose gel of plasmid profile of L. casei RCEID02 harboring pRCEID-LC7.6Cm (5.1 kb), pRCEID-LC2.9 (5.3 kb), and pRCEID-LC13.9Tc (7.1 kb). Lane 1 plasmid profile of L. casei RCEID02 harboring pRCEID-LC7.6Cm, pRCEID-LC2.9, and pRCEID-LC13.9Tc. Lane M Super coiled DNA ladder (Invitrogen, USA). On the left, sizes in base pairs of the different molecules of the ladder. The electrophoresis reaction was carried out by using 0.7 % agarose gel electrophoresis in ×1 TAE buffer at 50 voltages for 3 hStructural and segregational analysis in L. casei RCEID02 indicated that the vector pRCEID-LC7.6 was maintained in 75 and 16 % of the cells after 100 and 200 generations, respectively, in the absence of selective pressure (without antibiotics) (Fig. 4). Additionally, structural changes of plasmid after 100 generations were never observed (Fig. 5). The relative copy number per chromosome equivalent of the constructs was found to be 12 copies per chromosome in L. casei RCEID02.
Fig. 4
Segregational stability of the shuttle vectors pRCEID-LC7.6 in L. casei RCEID02. L. casei RCEID02 harboring these plasmids was culture in the absence of selective pressure, plated on the same condition, and assayed for plasmid maintenance by replica-plating onto erythromycin-containing MRS medium at approximately 20, 40, 60, 80, 100, 120, 140, 160, 180 and 200 generation intervals. Em erythromycin
Fig. 5
Ethidium bromide staining gel of HindIII-digested shuttle vector pRCEID-LC7.6. Lane 2–6
HindIII-digested pRCEID-LC7.6 derived from the generation time of 20, 40, 60, 80 and 100, respectively. Lane 1 the original vector pRCEID-LC7.9 digested with HindIII. Lane M MassRuler™ Express Reverse DNA ladder
Segregational stability of the shuttle vectors pRCEID-LC7.6 in L. casei RCEID02. L. casei RCEID02 harboring these plasmids was culture in the absence of selective pressure, plated on the same condition, and assayed for plasmid maintenance by replica-plating onto erythromycin-containing MRS medium at approximately 20, 40, 60, 80, 100, 120, 140, 160, 180 and 200 generation intervals. Em erythromycinEthidium bromide staining gel of HindIII-digested shuttle vector pRCEID-LC7.6. Lane 2–6
HindIII-digested pRCEID-LC7.6 derived from the generation time of 20, 40, 60, 80 and 100, respectively. Lane 1 the original vector pRCEID-LC7.9 digested with HindIII. Lane M MassRuler™ Express Reverse DNA ladder
Expression of a heterologous protein in L. casei RCEID02 using pRCEID-LC7.6
To determine whether pRCEID-LC 7.6 can be used for expression of heterologous proteins, the construct pRCEID-LC7.6:LdhL:NP:TT was developed. It is a pRCEID-LC7.6 derivative carrying an expression cassette composed of the ldh gene promoter, a codon-optimized, synthetic gene encoding the NP of influence A virus, and a transcription terminator derived by PCR from pLC13.9:LdhL:NP:TT (Suebwongsa et al. 2013) was introduced into E. coli XL-1 blue and L. casei RCEID02. Expression of the NP protein in both hosts was determined by Western blot analysis. As shown in the Fig. 6, a protein of the expected size of NP (56 kD), and identical to that of a cell lysate infected with the influenza virusH1N1 used as a control, was clearly revealed in transformants of the two species. In addition, the expression level of NP in L. casei RCEID02 after using the different plasmids, pRCEID-LC 7.6 and pRCEID-LC13.9 as backbone vector, was compared. It was found that that expression level of NP in L. casei RCEID02 was not difference as shown in Fig. 7.
Fig. 6
Western blot analysis of expressed NP in recombinant L. casei RCEID02 and E. coli XL-1 blue containing NP gene using goat anti-NP polyclonal antibody for detection. Lane P Influenza virus H1N1 infected cell lysate. Lane 1
E. coli XL-1blue containing pRCEID-LC7.6. Lane 2 recombinant E. coli XL-1blue containing pRCEID-LC7.6:LdhL:NP:TT. Lane 3 recombinant L. csei RCEID02 containing pRCEID-7.6:LdhL:NP:TT. Lane 4
L. casei RCEID02 containing pRCEID-LC7.6
Fig. 7
Western blot analysis of expressed NP in recombinant L. casei RCEID02 harboring different vectors using goat anti-NP polyclonal antibody for detection. Lane P Influenza virus H1N1 infected cell lysate. Lane 1
L. casei containing pRCEID-7.6:LdhL:NP:TT. Lane 2
L. casei containing empty pRCEID-7.6. Lane 3
L. casei containing pRCEID-13.9:LdhL:NP:TT. Lane 4
L. casei containing empty pRCEID-13.9
Western blot analysis of expressed NP in recombinant L. casei RCEID02 and E. coli XL-1 blue containing NP gene using goat anti-NP polyclonal antibody for detection. Lane P Influenza virusH1N1 infected cell lysate. Lane 1
E. coli XL-1blue containing pRCEID-LC7.6. Lane 2 recombinant E. coli XL-1blue containing pRCEID-LC7.6:LdhL:NP:TT. Lane 3 recombinant L. csei RCEID02 containing pRCEID-7.6:LdhL:NP:TT. Lane 4
L. casei RCEID02 containing pRCEID-LC7.6Western blot analysis of expressed NP in recombinant L. casei RCEID02 harboring different vectors using goat anti-NP polyclonal antibody for detection. Lane P Influenza virusH1N1 infected cell lysate. Lane 1
L. casei containing pRCEID-7.6:LdhL:NP:TT. Lane 2
L. casei containing empty pRCEID-7.6. Lane 3
L. casei containing pRCEID-13.9:LdhL:NP:TT. Lane 4
L. casei containing empty pRCEID-13.9
Discussion
Lactobacillus casei is a member of LAB that has drawn a lot of attention as the candidate for the development of mucosal delivery vehicles (Wen et al. 2012). This bacterial species has been recognized as safe and certain strains possess probiotic properties conferring various health benefits to the hosts (Dong et al. 2013). For example, L. casei strain Shirota was demonstrated to enhance NK cell activity by dairy intake (Takeda and Okumura 2007; Takeda et al. 2006). It has been demonstrated that oral administration of L. casei Shirota in humans can prevent and reduce the risk of the occurrence of bladder carcinoma (Aso et al. 1995; Ohashi et al. 2002). Besides probiotic properties, L. casei has the most essential property for development as a mucosal delivery vehicle, the ability to be genetically engineered. For genetic engineering in L. casei and other LAB, plasmid replicons are generally required to develop the genetic tools for manipulation. The researchers’ previous study (Panya et al. 2012) sequenced and analyzed three cryptic plasmids present in L. casei TISTR1341 and selected two replicons, one from pRCEID13.9 and the other from pRCEID2.9, to construct E.coli/Lactobacillusshuttle vectors, pRCEID-LC13.9 and pRCEID-LC2.9 respectively. Due to the high structural and segregational stability of pRCEID-LC13.9, this vector was successfully used for expressing the nucleocapsid protein of influenza A virus in L. casei RCEID02 (the plasmid-free derivative of L. casei TISTR1341) in the researchers’ subsequent study (Suebwongsa et al. 2013). In this present work, the pRCEID7.6 were completely sequenced and analyzed. The replicon of pRCEID7.6 was identified and selected to construct a new shuttle vector using pUC19E as backbone. The new vector, pRCEID-LC7.6, showed excellent structural stability as there was no structural change after 100 generations. For segregation stability, though the stability was less than that of pRCEID13.9 and pRCEID-LC2.9, and it was sufficient (75 and 16 % after 100 and 200 generations, respectively) for protein expression and other genetic processes in this system. Though not thoroughly verified, replication in other strain of L. casei is expected as pRCEID-LC13.9 and 2.9 were shown to be able to replicate in different L. casei strains (Panya et al. 2012). In addition, as this vector can replicate with both pRCEID13.9 and pRCEID2.9 in a single cell, this allows the development of more robust, naturally compatible vectors. Finally, pRCEID-LC7.6 was used for the expression of NP of influenza A virus under the control of lactate dehydrogenase promoter in L. casei RCEID02. The successful expression of a heterologous protein in L. casei in this study allows further promising development of this vector as a mucosal delivery vehicle in the near future.
Conclusion
The present study reported the completion of the plasmid complement of L. casei TISTR 1341, which consists in four plasmids, pCREID2.9, pRCEID3.2, pCREID7.6, and pRCEID13.9. As the replicons of all four plasmids are naturally compatible, the development vectors based on these plasmid replicons would provide high flexibility for cloning and expression of homologous and heterologous proteins in L. casei and other LAB species. The suitability of the new cloning vector pRCEID-LC7.6 was demonstrated by cloning and expressing the nucleocapsid protein-encoding gene from the influenza A virus. Expression of this protein would allow its use as a mucosal delivery vehicle for oral immunization.
Authors: Colin Hill; Francisco Guarner; Gregor Reid; Glenn R Gibson; Daniel J Merenstein; Bruno Pot; Lorenzo Morelli; Roberto Berni Canani; Harry J Flint; Seppo Salminen; Philip C Calder; Mary Ellen Sanders Journal: Nat Rev Gastroenterol Hepatol Date: 2014-06-10 Impact factor: 46.802