Angélica González-González1, Rubén Palma-Millanao1, Osvaldo Yáñez2, Maximiliano Rojas3, Ana Mutis4, Herbert Venthur4, Andrés Quiroz4, Claudio C Ramírez5. 1. Millennium Nucleus Centre in Molecular Ecology and Evolutionary Applications in Agroecosystems, Instituto de Ciencias Biológicas, Universidad de Talca, 2 Norte 685, Talca, Chile (angelica.gonzalez@utalca.cl; rupalma@utalca.cl; clramirez@utalca.cl), rupalma@utalca.cl. 2. Doctorado en Fisicoquímica Molecular, Facultad de Ciencias Exactas, Universidad Andrés Bello, República 275, Santiago, Chile (osvyanezosses@gmail.com). 3. Instituto de Ciencias Biológicas, Universidad de Talca, Dos Norte 685, 3465548 Talca, Chile (mrojasr@alumnos.utalca.cl), and. 4. Laboratorio de Ecología Química, Departamento de Ciencias Químicas y Recursos Naturales, Universidad de La Frontera, Av. Francisco Salazar, 01145 Temuco, Chile (ana.mutis@ufrontera.cl; h.venthur01@ufromail.cl; andres.quiroz@ufrontera.cl). 5. Millennium Nucleus Centre in Molecular Ecology and Evolutionary Applications in Agroecosystems, Instituto de Ciencias Biológicas, Universidad de Talca, 2 Norte 685, Talca, Chile (angelica.gonzalez@utalca.cl; rupalma@utalca.cl; clramirez@utalca.cl).
Abstract
Hylamorpha elegans(Burmeister) is a native Chilean scarab beetle considered to be a relevant agricultural pest to pasture and cereal and small fruit crops. Because of their cryptic habits, control with conventional methods is difficult; therefore, alternative and environmentally friendly control strategies are highly desirable. The study of proteins that participate in the recognition of odorants, such as odorant-binding proteins (OBPs), offers interesting opportunities to identify new compounds with the potential to modify pest behavior and computational screening of compounds, which is commonly used in drug discovery, may help to accelerate the discovery of new semiochemicals. Here, we report the discovery of four OBPs inH. elegans as well as six new volatiles released by its native host Nothofagus obliqua(Mirbel). Molecular docking performed between OBPs and new and previously reported volatiles from N. oblique revealed the best binding energy values for sesquiterpenic compounds. Despite remarkable divergence at the amino acid level, three of the four OBPs evaluated exhibited the best interaction energy for the same ligands. Molecular dynamics investigation reinforced the importance of sesquiterpenes, showing that hydrophobic residues of the OBPs interacted most frequently with the tested ligands, and binding free energy calculations demonstrated van der Waals and hydrophobic interactions to be the most important. Altogether, the results suggest that sesquiterpenes are interesting candidates for in vitro and in vivo assays to assess their potential application in pest management strategies.
Hylamorpha elegans(Burmeister) is a native Chilean scarab beetle considered to be a relevant agricultural pest to pasture and cereal and small fruit crops. Because of their cryptic habits, control with conventional methods is difficult; therefore, alternative and environmentally friendly control strategies are highly desirable. The study of proteins that participate in the recognition of odorants, such as odorant-binding proteins (OBPs), offers interesting opportunities to identify new compounds with the potential to modify pest behavior and computational screening of compounds, which is commonly used in drug discovery, may help to accelerate the discovery of new semiochemicals. Here, we report the discovery of four OBPs inH. elegans as well as six new volatiles released by its native host Nothofagus obliqua(Mirbel). Molecular docking performed between OBPs and new and previously reported volatiles from N. oblique revealed the best binding energy values for sesquiterpenic compounds. Despite remarkable divergence at the amino acid level, three of the four OBPs evaluated exhibited the best interaction energy for the same ligands. Molecular dynamics investigation reinforced the importance of sesquiterpenes, showing that hydrophobic residues of the OBPs interacted most frequently with the tested ligands, and binding free energy calculations demonstrated van der Waals and hydrophobic interactions to be the most important. Altogether, the results suggest that sesquiterpenes are interesting candidates for in vitro and in vivo assays to assess their potential application in pest management strategies.
Scarabaeidae is an important family of Coleoptera comprising near 25,000 species distributed worldwide (Gillott 2005), with species that feed on different substrates such as plants, dung, and decomposing plants and animals (Pedigo and Rice 2009). With regard to agriculture, the larval stage is frequently associated with the consumption of organic matter as well as the roots of berries, cereal crops and pasture (Rodríguez et al. 2004). Scarabaeidae pest species are difficult to control due to the cryptic position of the larvae in the soil (Chen et al. 2014) and the typical nocturnal activity of the adults (Jackson and Klein 2006). In addition, exotic plants introduced within the native geographical range of theses insects are usually invaded by these beetle species (Lefort et al. 2014).Environmentally friendly strategies for controlling adults scarab beetles are needed (Wang et al. 2013a,b; Zhuang et al. 2014), and there is much interest in studying the molecular mechanisms of proteins that are highly expressed in sensory organs (Li et al. 2015), which may lead to the manipulation of behavior driven by olfactory chemoreception (Zhuang et al. 2014, Li et al. 2015).Among such proteins, odorant-binding proteins (OBPs) are major peripheral olfactory proteins involved in the perception of odorants in insects (Leal 2013). OBPs, small soluble proteins present in the sensillum lymph (Gu et al. 2013), are characterized by six conserved cysteine residues joined by three disulfide bridges (Pelosi 1998) and six alpha-helices that form a cavity for ligand binding (Leite et al. 2009). These proteins serve as carriers of lipophilic odorant molecules to olfactory receptors (Wang et al. 2013a,b) and are linked to odorant recognition in the olfactory process (Biessmann et al. 2010).Accordingly, the use of their recognition ability has been reported in the identification of candidate compounds for pest control (Leal et al. 2008). This approach, named “reverse chemical ecology”, reduces the number of odorant candidate compounds based on protein-ligand affinity (Leal 2005), thus saving time and cost compared to the conventional trial-and-error screening performed in the field (Leal 1998). This concept was recently updated, and the combination of in silico molecular docking and molecular dynamics (MD) proved to be reliable for predicting behaviorally active compounds for insect pest species (Jayanthi et al. 2014). Indeed, the simultaneous use of both of these computational tools has been widely used for drug design research (Okimoto et al. 2009), whereas only a few modeling studies have been performed on insect OBPs (Venthur et al. 2014).In the south of Chile, the most threatening phytophagous species are native insects (Durán 1954, Cisternas 1992, Aguilera et al. 1996); among these, Hylamorpha elegans (Burmeister) is an abundant species and is considered to be a relevant pest in different crops (Klein and Waterhouse 2000). H. elegans is distributed from Valparaiso to the Los Lagos region of Chile (Ratcliffe and Ocampo 2002, Aguilera et al. 2011). A monovoltine species, adults are present each year from November to January, emerging from pasture and crops to congregate among the foliage of trees for mating (Aguilera et al. 1996). The beetle prefers certain native species of the genus Nothofagus, especially N. obliqua (Mirbel), and consumes its leaves voraciously (Durán 1951), possibly resulting in severe defoliation (Lanfranco et al. 2001). In addition, it is noteworthy that the distribution of H. elegans coincides with the distribution of Nothofagus species (Ratcliffe and Ocampo 2002). Although little is known about the repertoire of proteins in H. elegans, in a previous work regarding its chemical ecology, a mixture of odorants collected from N. obliqua leaves was found to enhance the attraction of H. elegans males to traps baited with female odorants (Quiroz et al 2007).Several studies have reported their existence in different species of Scarabaeidae (Wojtasek et al. 1998, Peng and Leal 2001, Deng et al. 2012, Chen et al. 2014, Ju et al. 2014, Li et al. 2015). However, few of them note the interaction of those OBPs with kairomones. An OBP in H. elegans showed high binding affinity to β-ionone (Venthur et al. 2016), a volatile derivative compound from plant carotenoids (Simkin et al. 2004). Binding assays of two OBPs of Holotrichia oblita (Faldermann) (HoblOBP1 and HoblOBP2) with compounds, such as green leaves volatiles and attractants of scarab beetles, showed that ligands formed by aldehydes and alcohols with long carbon chains could not fit inside the proteins, but the opposite was observed to benzoates (Deng et al. 2012). A broader range of ligands bound HoblOBP4 compared to HoblOBP3, mainly to aliphatic and aromatic compounds consisting of 4–13 carbons (Wang et al. 2013a,b). Interestingly, three out of four HoblOBPs showed high affinities with α-ionone and all of them with β-ionone (Deng et al. 2012; Wang et al. 2013a,b).Considering these evidences is feasible that any putative OBP found in H. elegans may exhibit remarkable affinity toward at least one individual volatile identified in the myriad of compounds released by its preferred host N. obliqua.The aim of this study is to find novel OBPs in adults of H. elegans, an economically important pest in the south of Chile, by mining an early genome draft of this scarab beetle species. In addition, computational tools (molecular docking and MD) were applied to characterize novel OBPs and to predict their ability to interact with newly identified volatile compounds released by the leaves of one of its preferred hosts. Our findings could provide insight for the successful management of this pest.
Materials and Methods
Insects
Adult individuals were collected from the foliage of N. obliqua in fields of the Estación Experimental Maquehue, Araucanía, Chile. The beetles were separated according to sex, transported to the laboratory in a cooler, and preserved at 4°C until processing.
cDNA Cloning and RT-PCR
RNA from different tissues was extracted using RNeasy Plant Mini Kit (Qiagen, The Netherlands) following the manufacturer’s instructions. A total of 30 males and 50 females were used for extraction of RNA from antennae; 20 males and 20 females for hindleg tibia; and 50 males and 50 females for mouthparts. The RNA quantified using an Epoch spectrophotometer (BioTek, VT). One microgram of total RNA was treated with 1u DNAse I (ThermoFisher, PA) according to the manufacturer’s instructions, and cDNA was synthesized by SMART RACE cDNA Amplification Kit (Clontech, CA). Specific primers were designed based on predicted sequences and used to amplify the 3’- and 5’-ends of cDNAs for the following OBP sequences: HeleOBP1, HeleOBP3, HeleOBP4, and HeleOBP6 (Table 1). The reactions were performed using 20 ng of cDNA and 1 u of Platinum Taq DNA polymerase (Invitrogen, Brazil) under the following conditions: 94°C for 120 s; 30 cycles at 94°C for 30 s, the annealing temperature (Table 1) for 30 s, and 72°C for 30 s; and 94°C for 2 min. The products were visualized on 1.5% agarose gels and sequenced by Macrogen (Seoul, Korea). Actin was used as a control to assess cDNA quality. The sequences were deposited in NCBI under accession numbers KT861417–KT861420.
Table 1.
List of gene-specific primers designed to amplify different OBP sequences using cDNA from different tissues of adult H. elegans males and females
Target
Primer sequence (5′–3′)
Sense
Annealing temperature (°C)
HeleOBP1
GCGTCGAGGAAACCAAAGTTGA
Forward
57.9
CGTGGGCGTTCTGGAAGTAACATT
Reverse
59.6
HeleOBP3
ACGAAGGGCAGTTTTCCGACAA
Forward
59.0
GCAGTTTCGCATGAATCCAGTCCT
Reverse
59.7
HeleOBP4
ACCAGTACAGGGACGATTGCCTTA
Forward
59.7
GCTATTCAGTATGCCACCCTTTCG
Reverse
57.8
HeleOBP6
TCCCACTACGAAAGCAGGCTTATG
Forward
58.8
TTGCTCTTGTCCTCGTTCTTGCTC
Reverse
59.3
List of gene-specific primers designed to amplify different OBP sequences using cDNA from different tissues of adult H. elegans males and femalesHomologous sequences were identified by similarity using the Basic Local Alignment Search Tool (BLASTn). Reading frames were obtained using EMBOSS Transeq (http://www.ebi.ac.uk/Tools/st/emboss_transeq/) and then aligned using BLASTp (http://blast.ncbi.nlm.nih.gov/). Signal peptides were predicted using PrediSi (www.predisi.de), and the isoelectric point (pI) and molecular mass were calculated by the Compute pI/MW tool (http://web.expasy.org/compute_pi/).
Ligand Extraction and Identification
Seventeen compounds found in southern beech (N. obliqua), the native host of H. elegans, were used to perform the in silico analyses; the compounds consisted of those obtained from the report of Quiroz et al. (1999) as well as new compounds extracted and identified in this work (Table 2). Moreover, two potential sex pheromone compounds of H. elegans (Quiroz et al. 2007), 1,4-benzoquinone and 1,4-hydroquinone, were among the tested chemicals. For the collection of new compounds, briefly, volatiles from fresh leaves were trapped in the field by two methods that involved enclosing the apical 30 cm of mature N. obliqua branches, with leaves, in glass bells. In the first method, volatiles were trapped during a 24-h period using a column filled with 100 mg Porapak Q (Sigma-Aldrich, PA), according to Quiroz et al. (1999). The air was dried and purified via passage through activated 5 -Å molecular sieves and charcoal. The trapped volatiles were then desorbed with hexane and concentrated under nitrogen flow. In the second method, the volatiles were trapped by solid-phase microextraction (SPME) according to Palma et al. (2012), with modifications. A holder containing a 65 -µm polydimethylsiloxane/divinylbenzene fiber was used during 180 min, and the volatiles collected with Porapak Q and SPME were analyzed using a gas chromatograph coupled with a mass spectrometer (GC-MS) equipped with a BP-1 capillary column (30 m, 0.22 mm, 0.25 μm); helium was used as the gas carrier (flow 0.5 ml/min). Ionization was performed by electron impact at 70 eV at 250°C. The GC oven was programmed to remain at 40°C for 2 min and the increase at 5°C/min to 280°C. Kovats indices (KIs) of volatiles were determined relative to the retention times of a series of n-alkanes with linear interpolation. The volatiles were identified through comparison of the KIs and mass spectra of available commercial standards.
Table 2.
Composition of volatiles from the leaves of N. obliqua trapped by SPME and Porapak Q
Compound
KI Exp.a
KI Lib.b
Reliability of identificationc
beta-myrcene
985
985
1
(Z)-3-hexenyl acetate
989
989
1
Unknown 1
1,029
beta-ocimene
1,041
1,041
1
beta-linalool
1,086
1,086
1
Unknown 2
1,106
dodecane
1,199
1,200
1
Sesquiterpene
1,375
1,375
2
Sesquiterpene
1,383
1,383
2
tetradecane
1,399
1,400
1
alpha-gurjunene
1,408
1,411
1
caryophyllene
1,416
1,416
1
aromadendrene
1,457
1,455
1
Sesquiterpene
1,480
1,480
2
Sesquiterpene
1,580
1,575
2
Kovats indices experimental.
Kovats indices library.
Reliability of identification is indicated as: 1) when the method comprises a comparison with mass spectra, KI, and matching with commercial standard and 2) when the method comprises only a comparison with mass spectra and KI according to data of literature.
Composition of volatiles from the leaves of N. obliqua trapped by SPME and Porapak QKovats indices experimental.Kovats indices library.Reliability of identification is indicated as: 1) when the method comprises a comparison with mass spectra, KI, and matching with commercial standard and 2) when the method comprises only a comparison with mass spectra and KI according to data of literature.
Prediction of H. elegans Chemoreceptors
Chemoreceptor sequences of several insect species were used to predict chemoreceptors in H. elegans based on the early genome draft (in curation). Sequences from Acyrthosiphon pisum, (Harris) Aedes aegypti, (L.) Anopheles gambiae Giles, Antheraea polyphemus (Cramer), Apis mellifera, (L.) Bombyx mori, (L.) Culex quinquefasciatus, (Say) Dendroctonus ponderosae, Hopkins Drosophila melanogaster, Meigen H. oblita, Nasonia vitripennis, (Walker) Phyllopertha diversa, Waterhouse Solenopsis invicta, Buren and Tribolium castaneum, (Herbst) present in the GenBank database (http://www.ncbi.nlm.nih.gov/genbank), were translated into amino acid sequences using Bioperl (Stajich et al. 2002) algorithms, including six-frame translations or open reading frames (ORFs). BLASTp local (Altschul et al. 1990) was used to compare all chemoreceptor ORFs from these species with those from the early genome draft of H. elegans ORFs. The cut-off parameters used for BLASTp were a threshold E value of 10−5 and 25% amino acid identity (Vieira et al. 2007). Finally, all predicted sequences were checked by BLASTx (http://blast.ncbi.nlm.nih.gov/Blast.cgi) searches against the nonredundant GenBank database.
Homology Modeling
Because of the unknown nature of the templates of OBPs from scarab beetle species (Zhuang et al. 2014), three-dimensional homology models were constructed for HeleOBP1, HeleOBP3, HeleOBP4, and HeleOBP6. A suitable template for three-dimensional modeling was identified using the position-specific iterated basic local alignment search tool (PSIBLAST) from Protein Data Bank. From four to seven PDB templates were tested for each HeleOBP. The template structures were structurally aligned using Modeller 9.14 (Sali and Blundell 1993) to obtain a multiple-template, structure-based sequence alignment. Each alignment was then used to create a set of 10,000 homology models, and the smallest value of the normalized discrete optimized molecule energy function (Shen and Sali 2006) and the GA341 score, available in Modeller 9.14, were used to select the best model from each template. The selected modeled structure geometry was optimized by 5,000 steps of conjugate-gradient energy minimization in an MD simulation with the CHARMM36 force field (MacKerell et al. 1998) in NAMD software (Kalé et al. 1999, Phillips et al. 2005). The quality of the models was then analyzed using PROCHECK (Laskowski et al. 1993) to choose the best of them to each HeleOBP.
Docking
AutoDock (v 4.2.1) and AutoDock Vina (v 1.0.2) (Trott and Olson 2009) were used for all dockings in this study. The three-dimensional coordinates of ligand structures (Table 3) were obtained from the PubChem database (http://pubchem.ncbi.nlm.nih.gov). When ligand structures were not available from PubChem, they were drawn using Discovery Studio 3.1 (Accelrys, CA). The ligand files were prepared using the AutoDockTools package (Sanner 1999) (http://autodock.scripps.edu) provided by AutoDock by accepting all rotatable bonds. The proteins (OBP1, OBP3, OBP4 and OBP6) were treated with the protein preparation wizard by Maestro (Schrodinger NY); polar hydrogen atoms were added, nonpolar hydrogen atoms were merged, and charges were assigned. Docking was treated as rigid and carried out using the empirical free energy function and the Lamarckian Genetic Algorithm provided by AutoDock Vina. The grid map dimensions were 10 by 10 by 10 Å3, with 0.375 Å spacing between the grid points, making the center of the protein the center of the cube, i.e., x, y, and z centers at 0.06, 0.04, and 0.09, respectively. All other parameters were set as the default defined by AutoDock Vina. Dockings were repeated 20 times with 20 conformations. The best interaction energy of binding (kcal/mol) was selected for MD evaluation.
Table 3.
Interaction energy calculated in molecular docking between H. elegans OBPs and the different tested compounds
Ligands were taken from a previous study (Quiroz et al. 1999).
Interaction energy calculated in molecular docking between H. elegans OBPs and the different tested compoundsLigands were taken from a previous study (Quiroz et al. 1999).
MD Protocol
Two complexes were built for each modeled HeleOBP1, HeleOBP3, HeleOBP4, and HeleOBP6, and each model was confined inside a periodic simulation box. Furthermore, an explicit solvent was added to the TIP3P water model (Neria et al. 1996) (3.500 water molecules). Na+ and Cl− ions were added to neutralize the systems and maintain an ionic concentration of 0.15 mol/liter. MD simulations were carried out using the modeled CHARMM22 and CHARMM36 force fields (MacKerell et al. 1998) within the NAMD software (Kalé et al. 1999, Phillips et al. 2005). First, each system included 15,000 steps of conjugate-gradient energy minimization followed by 1 ns of simulation with the protein backbone atoms fixed and gradually releasing the backbone over 10,000 ps with 10–0.1 kcal/mol Å−2 restraints. The total duration of simulation was ∼5 ns for each system. During the MD simulations, motion equations were integrated with a 1 fs time step in the NPT ensemble at a pressure of 1 atm. The SHAKE algorithm was applied to all hydrogen atoms, and the van der Waals cutoff was set to 12 Å. The temperature was maintained at 300 K, employing the Nosée–Hoover thermostat method with a relaxation time of 1 ps. The Nosée–Hoover Langevin piston was used to control the pressure at 1 atm. Long-range electrostatic forces were taken into account by means of the Particle-Mesh Ewald (PME) approach. Data were collected every 1 ps during the MD runs. Molecular visualization of the systems and MD trajectory analysis were carried out with the VMD software package (Humphrey et al. 1996).
MM/GBSA Calculations
The molecular mechanics/generalized born surface area (MM/GBSA) method was employed to estimate the binding free energy of the OBP−ligand complexes. For calculations from a total of 5 ns of MD, 2 ns were extracted for analysis, and the explicit water molecules and ions were removed. The MM/GBSA analysis was performed on three subsets of each system: the protein alone, the ligand alone, and the complex (protein−ligand). For each of these subsets, the total free energy (Gtot) was calculated as follows:
where HMM is the bonded and Lennard–Jones energy terms; Gsolv is the polar contribution of solvation energy and nonpolar contribution to the solvation energy; T is the temperature; and ΔSconf corresponds to the conformational entropy (Hayes and Archontis 2011, Vergara-Jaque et al. 2013). Both HMM and Gsolv were calculated using NAMD 2.9 with the generalized Born implicit solvent model. Gsolv was calculated as a linear function of the solvent-accessible surface area, which was calculated with a probe radius of 1.4 Å (Abroshan et al. 2010). The binding free energy of OBP and ligand complexes (ΔGbind) was calculated by the difference
where Gtot values are the averages over the simulation.
Results
cDNA Cloning and RT-PCR of OBPs
Application of the proposed pipeline to the genome draft resulted in the prediction of six OBPs; however, polymerase chain reaction (PCR) performed with cDNA from adult individuals was able to amplify only four of them. In all cases, transcripts were more abundant in chemosensitive tissues than in hindleg tibia (Fig. 1). HeleOBP1 is predicted to be 119 amino acids in length, with a pI of 5.2 and a calculated mass of 13,759 Da. HeleOBP3 has a predicted length of 109 amino acids, a pI of 8.2 and a mass of 12,477 Da. HeleOBP4, 115 amino acids, has a predicted pI of 4.9 and a mass of 12,533 Da. Finally, comprising 125 amino acids, HeleOBP6 has an estimated mass of 13,420 Da and a pI of 6.5 (Figs. 2 and 3).
Fig. 1.
RT-PCR of OBPs from three different tissues of H. elegans adult individuals of both sexes. Thirty cycles of amplification were used for HeleOBP1, 28 for HeleOBP3 and HeleOBP4, and 26 cycles for HeleOBP6. A, antennae; M, mouthparts; and T, tibiae.
Fig. 2.
Alignment generated by the ESPript 3.0 webtool of H. elegans OBPs with the PDB accessions used to build the models indicating identity and similarity percentage. Asterisks indicate conserved cysteine residues.
Fig. 3.
(A) Alignment of different HeleOBPs made with T-Coffee. Conserved Cys residues in red color. Amino acids participating in the binding pocket in green color. (B) Identity and similarity percentages of HeleOBPs obtained with BLASTp.
RT-PCR of OBPs from three different tissues of H. elegans adult individuals of both sexes. Thirty cycles of amplification were used for HeleOBP1, 28 for HeleOBP3 and HeleOBP4, and 26 cycles for HeleOBP6. A, antennae; M, mouthparts; and T, tibiae.Alignment generated by the ESPript 3.0 webtool of H. elegans OBPs with the PDB accessions used to build the models indicating identity and similarity percentage. Asterisks indicate conserved cysteine residues.(A) Alignment of different HeleOBPs made with T-Coffee. Conserved Cys residues in red color. Amino acids participating in the binding pocket in green color. (B) Identity and similarity percentages of HeleOBPs obtained with BLASTp.
Volatiles
The methods used to determine volatiles from the leaves of N. obliqua led to the discovery of six novel compounds in this species (Table 2): beta-myrcene, beta-ocimene, dodecane, tetradecane, alpha-gurjunene, and aromadendrene. All of these compounds are suitable for use in further analysis.
Modeling
To build the OBP model, different templates were chosen from the PDB database (http://www.rcsb.org/pdb/home/home.do) according to their amino acidic identity (Fig. 2). C. quinquefasciatus OBP1 (PDB code 2L2C), with 24% identity, was used for HeleOBP1. The HeleOBP3 model was generated using the A. gambiae OBP4 (PDB code 3Q8I) (Davrazou et al. 2011) crystal structure, with 25% identity. For HeleOBP4, A. gambiae OBP1 (PDB code 2ERB) (Wogulis et al. 2006), with 19% identity, was used. Rhyparobia maderae (F.) pheromone-binding protein (PDB code 1OW4) (Lartigue et al. 2003), reaching 23% identity, was used for the HeleOBP6 model (Fig. 2).The quality of the models was analyzed with PROCHECK, which showed that 85.6% of the HeleOBP1 residues are in the most favored region and the rest in the additionally allowed region of Ramachandran plots (Laskowski et al. 1993). The values obtained for HeleOBP3, HeleOBP4 and HeleOBP6 were 93.1, 89.4, and 89.2%, respectively.The overall structure of HeleOBP1 comprises six helices (α1–α6) stabilized by three disulfide bridges formed between α1 and α3 (Cys19–Cys50), α3 and α6 (Cys46–Cys98), and α5 and α6 (Cys89–Cys107). The structure of HeleOBP3 is also composed of six helices stabilized by three disulfide bridges formed between α1 and α3 (Cys14–Cys45), α3 and α6 (Cys41–Cys93), and α5 and α6 (Cys84–Cys102). Similarly, the structure of HeleOBP4 contains three disulfide bridges formed between α1 and α3 (Cys17–Cys55), α3 and α6 (Cys51–Cys97), and α5 and α6 (Cys88–Cys106). Finally, the HeleOBP6 structure comprises seven helices (α1–α7) stabilized by three disulfide bridges formed between α2 and α4 (Cys22–Cys53), α4 and α7 (Cys49–Cys108), and α6 and α7 (Cys96–Cys117) (Figs. 2 and 4).
Fig. 4.
Folded OBP models. Images in the left side show models with ligand inside the pockets and highlighted S-S bridges (red sticks). Cysteine residues and α-helices formed are labeled. Images in the right show superimposed template (gray) on their respective model.
Folded OBP models. Images in the left side show models with ligand inside the pockets and highlighted S-S bridges (red sticks). Cysteine residues and α-helices formed are labeled. Images in the right show superimposed template (gray) on their respective model.Docking studies of the protein–ligand complexes resulted in calculation of the affinity energy (Table 3). For HeleOBP1, the best results were obtained for alpha-gurjunene and aromadendrene, at −7.8 kcal/mol each. For HeleOBP3 and HeleOBP4, the best results were obtained for alpha- and beta-copaene, at −7.4 and −6.9 kcal/mol, respectively. The best results for HeleOBP6 were −7.3 kcal/mol for alpha-copaene and −7.2 kcal/mol for beta-copaene. Finally, the best affinity scores for all the proteins were obtained with sesquiterpenic compounds, whereas pheromones exhibited the lowest interaction energy values.
MD and MM/GBSA
Temporal root mean square deviation (RMSD) calculations were performed on all the atoms of each complex (protein and ligand) during the 5 ns of simulation. For the same OBP, the average RMSD values calculated for the protein backbones (Fig. 5A) did not show important differences. Comparing the ligand RMSD values (Fig. 5B), HeleOBP1 showed the largest difference, with 0.486 Å for aromadendrene and 0.214 Å for alpha-gurjunene; compared to alpha- and beta-copaene to HeleOBP3, HeleOBP4, and HeleOBP6 which showed lower differences. The temporal RMSD results suggest that the compounds were well accommodated inside the binding sites during the MD simulations, demonstrating the stabilization of the systems and confirming the results obtained by docking (Table 3) and free energy of binding via MM/GBSA (Table 4).
Fig. 5.
RMSD calculated for OBP backbones (A) and for the ligands (B) used in the MD procedures.
Table 4.
Decomposition of energies calculated by MM/GBSA to the interactions between different H. elegans OBPs and the tested ligands
Protein
Ligand
ΔHMMvdW
ΔHMMelec
ΔGSolv
ΔGbind
HeleOBP1
alpha-gurjunene
−28.04
9.30
−4.37
−23.11(±0.04)
aromadendrene
−25.95
8.79
−3.97
−21.13(±0.04)
HeleOBP3
alpha-copaene
−32.68
10.96
−1.63
−26.03(±0.06)
beta-copaene
−33.63
10.50
−4.29
−27.43(±0.05)
HeleOBP4
alpha-copaene
−27.25
7.81
−4.28
−23.72(±0.06)
beta-copaene
−25.85
8.08
−4.24
−22.01(±0.09)
HeleOBP6
alpha-copaene
−29.86
7.53
−4.41
−26.75(±0.04)
beta-copaene
−29.77
6.76
−4.40
−27.41(±0.03)
ΔHMMvdW, ΔHMMelec, ΔGSolv, and ΔGbind represent energy attributable to van der Waals interactions, electrostatic interactions, solvation, and free binding energy respectively.
RMSD calculated for OBP backbones (A) and for the ligands (B) used in the MD procedures.Decomposition of energies calculated by MM/GBSA to the interactions between different H. elegans OBPs and the tested ligandsΔHMMvdW, ΔHMMelec, ΔGSolv, and ΔGbind represent energy attributable to van der Waals interactions, electrostatic interactions, solvation, and free binding energy respectively.During the MD simulations, the frequency of the closer residues was calculated using a 3 Å cutoff (Fig. 6). The three most frequent residues in HeleOBP1 were TYR51, HSD117, and LEU116 for alpha-gurjunene and ILE72, PHE56, and ARG7 for aromadendrene. With regard to HeleOBP3, the most frequent amino acids were LEU102, ILE63, and LYS70 for alpha-copaene and ILE63, LYS108, and LEU 102 for beta-copaene. In the case of HeleOBP4, ARG13, LEU55, and LEU51 were most frequently close to alpha-copaene and ARG13, LEU55, and MET9 to beta-copaene. Lastly, HeleOBP6LEU78, LYS38, and PHE117 were the amino acids most frequently close to alpha-copaene and LEU10, PHE54, and LYS38 to beta-copaene.
Fig. 6.
Frequency of the appearance of residues at a distance of 3 Å or closer from a ligand for H. elegans OBPs calculated using MD procedures.
Frequency of the appearance of residues at a distance of 3 Å or closer from a ligand for H. elegans OBPs calculated using MD procedures.MM/GBSA analyses for calculating the binding free energy to the selected ligands (Table 4) showed that every couple of ligands tested to each OBP had similar energy. The largest difference was obtained with HeleOBP1, where ΔGbind for alpha-gurjunene reached −23.11 kcal/mol compared to −21.13 kcal/mol for aromadendrene. Moreover, it is important to note the significant contribution of ΔHMMvdW to the binding free energy when compared to the null influence of ΔHMMelec on all of the complexes studied.
Discussion
The method used in this study allowed the prediction of four novel OBP sequence in H. elegans. This is an important results when considering the lack of genomic information for scarab beetles species (Chen et al. 2014). Moreover, RT-PCR analyses showed that the proteins are more expressed in organs related to the olfactory and gustatory senses, in both males and females (Fig. 1), supporting their chemosensitive role. HeleOBP1 and HeleOBP3 appear to be much more expressed in antenna than other tissues and HeleOBP3 appear to be remarkably expressed in female antenna respect to male antenna. In contrast, HeleOBP4 and HeleOBP6 appear to be more expressed in mouth parts than antenna or hindleg tibia, but HeleOBP4 show higher expression in male antenna also.These differences may represent a significative clue about the importance of those proteins, due to the similar habits of adults congregating and feeding on leaves of their hosts, HeleOBP3 could be related to the perception of semiochemicals informative of suitable oviposition sites. Host-seeking and egg-laying task have been suggested for similar female-biased pattern of expression of chemosensitive proteins in A. gambiae (Diptera: Culicidae) (Latrou and Biessmann 2008) and Apolygus lucorum (Meyer-Dür) (Hemiptera: Miridae) (Yuan et al. 2015). Male-biased expression of HeleOBP4 is interesting. Some studies show that certain OBPs have the ability to bind pheromones as well as pheromone-binding proteins do (Liu et al. 2010, Jin et al. 2015). The tissue-biased expression of OBPs has been reported (Pelletier and Leal 2011), and it may be related to the multitasking role played by tissues different than antenna in olfaction (Choo et al. 2015). Although further studies are required, these evidences provide a starting point for using OBPs as targets to regulate the insect behavior of mating, feeding, and oviposition and further to develop novel crop protection strategies (Yuan et al. 2015).It is important to note that modeling was challenging in this case, in part due to the highly divergent nature of OBPs as well as the scarcity of beetle protein template structures available for model building. However, the analyses performed using PROCHECK showed similar values to those previously reported for other binding proteins in insects (Tomaselli et al. 2006, Leite et al. 2009, Pesenti et al. 2009). Of note, multiple sequence alignment between OBPs and templates (Fig. 2) showed several conserved residues, highlighting six highly conserved cysteines due to their roles in the structural stability of insect OBPs as globular proteins (Leal et al. 1999).Assessing a group of volatiles previously reported as well as novel compounds first reported herein, docking analyses revealed interaction energies between the compounds and the four OBPs. It is important to note that the highest interaction energy values were obtained for sesquiterpenic compounds compared to the remaining molecules for all the OBPs analyzed.Interestingly, in the molecular docking, three of the four OBPs studied exhibited the best interaction energy values with the same ligands, and all of them showed the highest interaction energy with compounds that share similar physicochemical properties (sesquiterpenes), despite their marked divergence at the amino acid level. The identity among the different H. elegans OBPs’ ranged from 22 to 50% (Fig. 3), lower than the identity of 57–87% when comparing the amino acidic sequences to the OBPs of other scarab beetle species (data not shown). The affinity for sesquiterpenes may rely in the fact that products from genes that are members of the same family may be able to bind compounds with similar physicochemical properties (Hopkins and Groom 2002). In the other hand, it has been suggested that the binding site is more important to the process of ligand recognition than the entire polypeptide sequence (Zhuang et al. 2014).Considering that at the moment of performing the analyses, 1,4 benzoquinone and 1,4 hydroquinone were the only compounds reported as responsible to elicit behavioral response in H. elegans (Quiroz et al. 2007), they were included in the docking analyses. These compounds did not show high interaction energy, in the same manner that pheromones of H. oblita did not have good binding affinities when they were tested with HoblOBPs (Deng et al. 2012; Wang et al. 2013a,b). However, is feasible that further studies could reveal the existence of new OBPs in H. elegans, especially considering the number of OBPs reported in transcriptome of different scarab beetle species is higher than the number of HeleOBPs reported here (Li et al. 2015).Molecular docking techniques are used to explore translations, orientations, and conformations until an ideal site is found (Morris et al. 1998) and may help delineate the amino acid residues that form cavities (Venthur et al. 2014). By utilizing more detailed molecular mechanics, it is then possible to calculate the energy of the ligand within the context of the putative cavity (Morris et al. 1998).Some studies have used docking to predict the residues of OBPs that form the binding site (Zhuang et al. 2014), to predict their interactions with putative ligands (Jiang et al. 2009), and to relate them to their biological activity (He et al. 2010) in the design of new insect repellents (Affonso et al. 2013) and olfactory biosensors (Lu et al. 2014). However, molecular docking has some limitations and is not completely reliable for establishing ligand affinity (Okimoto et al. 2009, Hayes and Archontis 2011), and complementary analyses are required for improved accuracy (Jayanthi et al. 2014). Thus, MD simulation-based free energy calculations have been used extensively to predict the strength of protein−ligand interactions (Wang et al. 2013a,b). Indeed, these methods provide more accurate binding affinity, though the cost and time required for computational calculations are greater compared to molecular docking (Okimoto et al. 2009). Furthermore, methods for calculating binding free energy offer additional accuracy. One such method is MM/GBSA, which is considered a computationally efficient method (Hou et al. 2011). It provides moderately accurate results at a comparatively low computational cost (Vergara-Jaque et al. 2013) and offer an alternative to rigorous free-energy methods (Wang et al. 2013a,b).Based on the frequency with which amino acids were 3 Å or closer during the molecular simulation (Fig. 6), despite differences in OBP sequences, residues with hydrophobic properties appear more frequently (Fig. 7). Because of their nature, it is expected that van der Waals and hydrophobic interactions will occur in the same manner as that reported for the OBP-binding site of the scarab beetle H. oblita, whereby amino acids such as methionine, tyrosine and isoleucine were predicted as important in the binding site (Zhuang et al. 2014). Altogether, MD simulations are useful for establishing compounds are stabilized in binding pockets (Affonso et al. 2013). Thus, physicochemical properties of amino acids in the binding pockets of HeleOBPs determinated in MD simulations appear to be complementary to the physicochemical properties of the ligands that showed the highest interaction energies among the HeleOBPs in molecular docking.
Fig. 7.
Ligand interaction diagrams generated by Maestro showing residues interacting in the OBP pocket. Green color represents hydrophobic residues, blue is positively charged residues, red is negatively charged, and cyan denotes polar. The gray atom background represents the solvent-accessible surface area (SASA) of that atom. (A) HeleOBP1/alpha-gurjunene; (B) HeleOBP1/aromadendrene; (C) HeleOBP3/alpha-copaene; (D) HeleOBP3/beta-copaene; (E) HeleOBP4/ alpha-copaene; (F) HeleOBP4/ beta-copaene; (G) HeleOBP6/ alpha-copaene; and (H) HeleOBP6/ beta-copaene.
Ligand interaction diagrams generated by Maestro showing residues interacting in the OBP pocket. Green color represents hydrophobic residues, blue is positively charged residues, red is negatively charged, and cyan denotes polar. The gray atom background represents the solvent-accessible surface area (SASA) of that atom. (A) HeleOBP1/alpha-gurjunene; (B) HeleOBP1/aromadendrene; (C) HeleOBP3/alpha-copaene; (D) HeleOBP3/beta-copaene; (E) HeleOBP4/ alpha-copaene; (F) HeleOBP4/ beta-copaene; (G) HeleOBP6/ alpha-copaene; and (H) HeleOBP6/ beta-copaene.Our study did not show a contribution of ΔHMMelec, indicating that no electrostatic interactions can be formed, presumably because the ligands tested (i.e., sesquiterpenes) do not have high-electronegativity atoms in their structures or there is an absence of functional groups, such as aldehydes, alcohols, and ketones. Accordingly, it was expected that van der Waals forces would have the highest contribution to the interaction between OBPs and sesquiterpenes. The partition of energy obtained from MM/GBSA analyses supports this claim. The binding free energies calculated for the compounds in this report are higher than those used previously to predict behavioral activity (Jayanthi et al. 2014).
Conclusions
This work reported four novel OBPs in the scarab beetle H. elegans. All of them appear to be much more expressed in chemosensitive tissues and some of them show a sex-biased expression which provides a starting point for future researches looking for ways to disturb the behavior of this pest species. In parallel from the identification of volatiles in the foliage of the preferred host of adult stage, N. obliqua were reported six new volatiles. Different in silico analyses were performed to study the interaction of HeleOBPs with the volatiles. Molecular docking showed better interaction energy values with sesquiterpenes found in foliage volatiles, and MD reported that hydrophobic amino acids would take part of these relationships. Free-binding energy estimations made by MM/GBSA reinforce the idea that physicochemical properties of binding pocket in HeleOBPs are prepared to interact with compounds like sesquiterpenes despite of the shape and size of binding cavities may be different among these proteins, conferring a certain specificity for this type of compounds. Therefore, these compounds and others that are chemically related could represent interesting candidates for further studies, and in vitro testing (i.e., fluorescence binding assays) should elucidate the properties of these novel OBPs.
Authors: Xiaoli He; George Tzotzos; Christine Woodcock; John A Pickett; Tony Hooper; Linda M Field; Jing-Jiang Zhou Journal: J Chem Ecol Date: 2010-10-28 Impact factor: 2.626
Authors: Andrew J Simkin; Beverly A Underwood; Michele Auldridge; Holly M Loucas; Kenichi Shibuya; Eric Schmelz; David G Clark; Harry J Klee Journal: Plant Physiol Date: 2004-10-29 Impact factor: 8.340
Authors: Shao-Hua Gu; Kong-Ming Wu; Yu-Yuan Guo; Linda M Field; John A Pickett; Yong-Jun Zhang; Jing-Jiang Zhou Journal: PLoS One Date: 2013-09-20 Impact factor: 3.240
Authors: Kamala P D Jayanthi; Vivek Kempraj; Ravindra M Aurade; Tapas Kumar Roy; K S Shivashankara; Abraham Verghese Journal: BMC Genomics Date: 2014-03-19 Impact factor: 3.969
Authors: Renato B Pereira; Nuno F S Pinto; Maria José G Fernandes; Tatiana F Vieira; Ana Rita O Rodrigues; David M Pereira; Sérgio F Sousa; Elisabete M S Castanheira; A Gil Fortes; M Sameiro T Gonçalves Journal: Molecules Date: 2021-10-31 Impact factor: 4.411
Authors: Kauȇ Santana da Costa; João Marcos Galúcio; Clauber Henrique Souza da Costa; Amanda Ruslana Santana; Vitor Dos Santos Carvalho; Lidiane Diniz do Nascimento; Anderson Henrique Lima E Lima; Jorddy Neves Cruz; Claudio Nahum Alves; Jerônimo Lameira Journal: ACS Omega Date: 2019-12-17