Literature DB >> 27006768

Effects of thymol and carvacrol supplementation on intestinal integrity and immune responses of broiler chickens challenged with Clostridium perfringens.

Encun Du1, Weiwei Wang1, Liping Gan1, Zhui Li1, Shuangshuang Guo1, Yuming Guo1.   

Abstract

BACKGROUND: Necrotic enteritis caused by Clostridium perfringens infection leads to serious economic losses in the global poultry production. In the present study, we investigated the protective effects of essential oils (EO, which contained 25 % thymol and 25 % carvacrol as active components) supplementation on growth performance, gut lesions, intestinal morphology, and immune responses of the broiler chickens infected with C. perfringens. A total of 448 1-day-old male broiler chicks were allocated into eight treatment groups following a 4 × 2 factorial arrangement with four dietary EO dosages (0, 60, 120, or 240 mg/kg) and two infection status (with or without C. perfringens challenge from d 14 to 20).
RESULTS: The challenge did not impair the growth performance of birds, but induced gut lesions and increased crypt depth in the ileum (P ≤ 0.05). It also down-regulated the claudin-1 and occludin mRNA expression (P ≤ 0.05), up-regulated the mRNA expression of interleukin-1β (P ≤ 0.05), tended to increase the toll-like receptor (TLR) 2 mRNA expression (P < 0.10) in the ileum, and enhanced the mucosal secretory IgA production (P ≤ 0.05). In the challenged birds, dietary EO supplementation linearly alleviated the gut lesions and improved the ratio of villus height to crypt depth (P ≤ 0.05), and the supplementation of 120 and 240 mg/kg EO increased the serum antibody titers against Newcastle disease virus (P ≤ 0.05). Regardless of challenge, the EO supplementation showed a tendency to linearly elevate the feed conversion efficiency between 14 and 28 d of age as well as the occludin mRNA expression (P < 0.10), and linearly inhibited the mRNA expression of TLR2 and tumor necrotic factor-α in the ileum (P ≤ 0.05).
CONCLUSIONS: The dietary supplementation of EO could alleviate the intestinal injury by improving intestinal integrity and modulating immune responses in the C. perfringens-challenged broiler chickens.

Entities:  

Keywords:  Broiler chicken; Clostridium perfringens; Essential oils; Immune response; Intestinal integrity

Year:  2016        PMID: 27006768      PMCID: PMC4802587          DOI: 10.1186/s40104-016-0079-7

Source DB:  PubMed          Journal:  J Anim Sci Biotechnol        ISSN: 1674-9782


Background

Necrotic enteritis (NE) is one of the most detrimental infectious diseases in poultry, as estimated to cost the global poultry industry approximately six billion US dollars per year in medical treatments and productivity losses [1]. The aetiological agent of NE is Clostridium perfringens, a Gram-positive anaerobic spore-forming bacterium [2, 3]. NE may present as acute clinical or subclinical disease [2]. The acute form of NE is characterized by increased mortality in chicken flocks, whereas in the subclinical form, C. perfringens causes damage in the intestinal mucosa, disrupts the villus-crypt micro-architecture, decreases nutrient digestion and absorption, and thus impairs the growth performance of chickens [3, 4]. For both acute clinical and subclinical forms of NE, C. perfringens type A is the main pathogenic factor, and the newly discovered NetB toxin is supposed to be a vital virulence factor [3, 5]. With the removal of growth-promoting antibiotics, NE has become increasingly prevalent [3], and this problem has inspired the research in alternative managements and dietary strategies to control the incidence and severity of NE [4]. Due to the consumer preference for natural products, the application of essential oils (EO) have been increasing in appeal [6]. The antibacterial property of EO has been well recognized and widely tested in vitro against a wide range of pathogenic bacteria, including both Gram-positive and Gram-negative bacteria [7-10]. Besides direct antibacterial effects, the dietary EO supplementation has been reported to improve intestinal integrity and strengthen mucosal barrier [11, 12]. In broiler chickens, the addition of 0.5 g/kg thyme oil could increase the trans-epithelial electrical resistance of the duodenum [12]. The mice receiving 13.3 μg/mL eugenol in drinking water altered the composition of colonic microbiota and increased the thickness of the inner mucus [11]. Furthermore, the EO supplementation has been reported to enhance the cellular and humoral immunity [13, 14], and modulate the gene expression of host immunity in chickens [15]. Among thousands of EO constituents, the two isomers thymol and carvacrol possess great antibacterial activity, which are also major components of common used herbs such as thyme and oregano [16]. In rodents, thymol and carvacrol have been reported to inhibit pro-inflammatory cytokines,decrease inflammatory cell recruitment and alleviate oxidative damage [17-19]. Our previous study suggested that a mixture of thymol and carvacrol could decrease the tumor necrotic factor (TNF)-α gene expression and increase the interleukin (IL)-4 gene expression in the spleen of the broilers injected with lipopolysaccharides (LPS) [20]. Therefore, we hypothesized that the supplementation of EO may protect birds from NE through their modulatory effects on intestinal integrity and immunity.

Methods

Birds and experimental design

A total of 448 1-day-old male broiler chicks (Cobb 500) were used in a 28-day experiment. Chicks were allocated into eight treatment groups and each group consisted of eight replicate pens (seven birds each pen). The experiment was following a 4 × 2 factorial arrangement in a randomized complete block design to evaluate the effects of dietary EO dosages, pathogen challenge and their interaction, as shown in Table 1. Birds in groups U1, U2, U3 and U4 were unchallenged and fed the wheat-based diet supplemented with 0, 60, 120, or 240 mg/kg EO, respectively. Correspondingly, birds in groups C1, C2, C3, and C4 were challenged with C. perfringens and fed the wheat-based diet supplemented with 0, 60, 120, or 240 mg/kg EO, respectively. The EO preparation used in this trial was a commercial product provided by Novus International Inc. (St Charles, MO, USA), which contained 25 % thymol and 25 % carvacrol as active components, 37 % silicon dioxide as caking inhibitor, and 13 % glycerides as stabilizing agents.
Table 1

Experimental designa

TreatmentsDietary EO dosage (mg/kg) C. perfringens challenge
U10Unchallenged
U260Unchallenged
U3120Unchallenged
U4240Unchallenged
C10Challenged
C260Challenged
C3120Challenged
C4240Challenged

a EO essential oils; Unchallenged, birds without oral gavage of C. perfringens; Challenged, birds with oral gavage of 1.0 mL actively growing culture of C. perfringens from d 14 to d 20 (1.0 × 108 cfu/mL)

Experimental designa a EO essential oils; Unchallenged, birds without oral gavage of C. perfringens; Challenged, birds with oral gavage of 1.0 mL actively growing culture of C. perfringens from d 14 to d 20 (1.0 × 108 cfu/mL)

Diet formulation

Chickens were fed starter (d 0–21) and grower (d 22–28) diets in the form of mash. The basal diets were formulated to meet or exceed the feeding standard of China for broilers (NY/T 2004) [21] and the diet composition was shown in Table 2. To promote the proliferation of C. perfringens, the antibiotic-free and coccidiostat-free wheat-based diets were formulated. Both wheat and soybean meal were pre-mixed in advance and the basal diet was subsequently mixed to reduce mixing variation among treatments. Then, the EO preparation was carefully added to 100 g of the basal diet, and blended with 10 kg of the basal diet to make a premix. Finally, the premix was mixed in the basal diet. All of the experimental diets were manufactured weekly at the feed mill of China Agricultural University, and stored in airtight containers.
Table 2

Diet composition and nutrient levels

Items (%, unless otherwise indicated)Starter diets (d 0–21)Grower diets (d 22–28)
Ingredient
 Wheat62.7568.50
 Soybean meal29.6123.72
 Soybean oil3.404.00
 Dicalcium phosphate1.911.63
 Limestone1.040.96
 Sodium chloride0.350.35
 Choline chloride (50 %)0.250.25
 L-Lysine (99 %)0.250.24
 DL-Methionine (98 %)0.190.11
 Santoquin0.030.03
 Trace mineral premixa 0.200.20
 Vitamin premixb 0.020.02
Calculated nutrient level
 ME (Mcal/kg)2.902.98
 Protein21.0019.00
 Calcium1.000.90
 Available Phosphorus0.450.40
 Lysine1.151.00
 Methionine0.500.40

aThe trace mineral premix provided the following (per kg of diet): manganese, 100 mg; zinc, 75 mg; iron, 80 mg; copper, 8 mg; selenium, 0.25 mg; iodine, 0.35 mg

bThe vitamin premix provided the following (per kg of diet): vitamin A, 18,750 IU; vitamin D3, 3750 IU; vitamin E, 28 IU; vitamin K3, 3.975 mg; thiamine mononitrate, 3 mg; riboflavin, 9 mg; vitamin B12, 0.0375 mg; d-biotin, 0.150 mg; folic acid, 1.875 mg; d-calcium pantothenate, 18 mg; nicotinic acid, 75 mg

Diet composition and nutrient levels aThe trace mineral premix provided the following (per kg of diet): manganese, 100 mg; zinc, 75 mg; iron, 80 mg; copper, 8 mg; selenium, 0.25 mg; iodine, 0.35 mg bThe vitamin premix provided the following (per kg of diet): vitamin A, 18,750 IU; vitamin D3, 3750 IU; vitamin E, 28 IU; vitamin K3, 3.975 mg; thiamine mononitrate, 3 mg; riboflavin, 9 mg; vitamin B12, 0.0375 mg; d-biotin, 0.150 mg; folic acid, 1.875 mg; d-calcium pantothenate, 18 mg; nicotinic acid, 75 mg

Animal husbandry

Approval for this study was obtained from the Animal Ethics Committees of China Agricultural University. Chickens were housed in the battery pens (100 cm × 70 cm) with plastic wire floors and two nipple-type waterers each pen. Feed and water were provided ad libitum throughout the experiment. The room temperature was maintained at 36 °C for the first week and then reduced by 3 °C each week until reaching 24 °C. The lighting schedule was 23 h light and 1 h dark throughout the experiment. In addition, the chickens were vaccinated against Newcastle disease virus (NDV) after hatch and on d 10 according to the routine immunization programme.

Clostridium perfringens challenge and sampling

C. perfringens challenge was based on the method originally developed by Dahiya et al. [22], and also previously used in our lab [23, 24]. The C. perfringens strain we used was type A field strain, which was isolated from a clinical case of NE and did not carry the NetB gene as determined by polymerase chain reaction (PCR). Briefly, the organism was cultured anaerobically on tryptose-sulphite-cycloserine for 18 h at 37 °C, and then aseptically inoculated into cooked meat medium and incubated anaerobically overnight at 37 °C. All birds in the challenged groups were orally gavaged in the crop with 1.0 mL actively growing culture of C. perfringens each day from d 14 to d 20 (1.0 × 108 cfu/mL). Birds in the unchallenged groups received the same volume of sterile meat medium. On d 21, one bird from each replicate was randomly selected and killed by intracardial administration of sodium pentobarbital (30 mg per kg of body weight) and jugular exsanguination for tissue sampling.

Analysis of dietary thymol and carvacrol concentrations

To extract thymol and carvacrol from the diets, 4 g of grinded diets were weighted into centrifuge tubes, mixed with 2.5 mL water and 1.0 mL ethanol, and allowed to stand for 15 min. The calibration samples were prepared by supplemented the basal diet with standard solutions of thymol and carvacrol at five different concentrations (300, 150, 75, 37.5 and 18.75 mg/L in ethanol). Both thymol and carvacrol were purchased from Sigma-Aldrich Corporation (St Louis, MO, USA) with compound purities at ~ 98 %. Then diethyl ether (12 mL) was added, and the samples were shaken for 16 h and centrifuged at 15, 000 g for 5 min. 1 μL of each supernatant was used for gas chromatographic analysis according to the method of Michiels et al. [25].

Growth performance

Feed intake (FI) and body weight (BW) for each replicate were measured on d 14 and 28. Feed conversion ratio (FCR) was calculated during d 0 to14 and d 14 to 28.

Intestinal lesion score

The small intestine from each bird was opened and scored blindly by three independent observers as described by Dahiya et al. [22]. Briefly, lesions were scored using a scale from 0 to 4, in which 0 was apparently normal intestinal appearance, no lesion; 0.5 = severely congested serosa and mesentery engorged with blood; 1 = thin walled and friable intestines with small red petechiae (>5); 2 = focal necrotic lesions; 3 = patches of necrosis (1 to 2 cm long); and 4 = diffused necrosis typical of field cases.

Intestinal morphological analyses

The distal ileum segments were collected and fixed in 4 % paraformaldehyde and then embedded in paraffin. Tissue sections (5 μm) were prepared and stained with haematoxylin and eosin for the morphological analyses. The measurements were performed with an Olympus optical microscope using ProgRes CapturePro software (version 2.7; Jenoptik, Jena, Germany). Nine villi were measured for each section and only complete and vertically oriented villi were measured. Villus height was measured from the tip of the villus to the crypt opening and the associate crypt depth was measured from the base of the crypt to the level of the crypt opening. Then the ratio of villus height to relative crypt depth (V:C ratio) was calculated from these measurements.

Serum and mucosal antibody levels

On d 21, blood was aseptically collected from the wing vein into vacutainers and centrifuged at 3,000 rpm for 15 min to obtain the serum. The serum antibody titers against NDV were determined by the commercial ELISA kit (IDEXX laboratories Inc., Westbrook, Maine, USA) according to the manufacture’s protocol. Intestinal mucosa was scraped from 10 cm of the jejunum (proximal to Meckel’s diverticulum) and homogenized with phosphate buffered saline. The secretory IgA (sIgA) concentrations and protein content in mucosal homogenates were determined by ELISA kit (Bethyl Laboratories Inc., Montgomery, TX, USA) and BCA protein assay kit (Thermo Scientific) according to the manufacture’s protocol, respectively. The final sIgA concentrations were expressed as mg/g protein.

Lymphocytes proliferative responses

Blood was collected into the vacutainers containing heparin to prevent clotting on d 21. Then peripheral blood mononuclear cells (PBMC) were isolated using Ficoll density centrifugation according to the method of Tan et al. [26] with some modifications. Briefly, heparinized blood was diluted with Hank’s balanced salt solution by 1:1 (no calcium, no magnesium, Life Technologies), and layered on the top of Histopaque 1077 (Sigma-Aldrich Corporation) carefully in a 10 mL centrifuge tube (2:1). After centrifugation for 30 min at 3,000 rpm (20 °C), the PBMC at the plasma-ficoll interface were collected. Then PBMC was washed three times with cold RPMI-1640 medium (containing 5.0 % inactivated fetal bovine serum, 0.0599 mg/mL penicillin, 100 μg/ml streptomycin and 24 mM-HEPES) by centrifugation at 1,800 rpm for 10 min (4 °C). Cell counts and viability were evaluated using trypan blue staining. The proliferative response of T cells and B cells after stimulation with concanavalin A (ConA, 45 μg/mL) and LPS (25 μg/mL) were determined by MTT assay, respectively, as described by Wagner et al. [27]. ConA from Canavalia ensiformis (C2010) and LPS from Escherichia coli (L2880) were both obtained from Sigma-Aldrich Corporation. Results were expressed as stimulation index (SI).

Total RNA extraction and reverse transcription

Total RNA was extracted from intestinal segments using Trizol reagent (Invitrogen Life Technologies, Carlsbad, California, USA) following the manufacturer’s protocol. The concentration of extracted RNA was measured using a NanoDrop spectrophotometer (ND-1000, NanoDrop Products, Wilmington, Delaware, USA) at an optical density of 260 nm, and RNA purity was verified by the ratio of absorbance at 260 nm/280 nm. Then, 1 μg of total RNA was used for reverse transcription by a reverse transcription kit (Takara Bio Inc., Dalian, China) following the manufacturer’s protocol. All the cDNA preparations were stored at −20 °C until further use.

Real-time quantitative PCR

Expression levels of the following genes were analyzed by real-time quantitative PCR (RT-PCR): toll-like receptor (TLR) 2, TLR4, IL-1β, TNF-α, claudin-1, occludin, mucin-2 and an endogenous reference gene β-actin (which has been previously used [24, 28]). Gene-specific primer sequences are shown in Table 3. The RT-PCR was performed on the 7500-fluorescence detection system (Applied Biosystems, Foster City, California, USA) using a commercial SYBR-Green PCR kit (Takara Bio Inc.). According to the manufacturer’s protocol, the following PCR conditions were employed: 95 °C for 30 s, 40 cycles of 95 °C for 5 s and 60 °C for 34 s, and followed by the stage of melting curve. At the end of each run, melting curve analysis and subsequent agarose gel electrophoresis of the PCR products were subjected to confirm the amplification specificity. Relative gene expression data were analyzed using the 2−ΔΔCt method as developed by Livak et al. [29].
Table 3

RT-PCR primers and Genbank accession numbers of chicken

TargetPrimer sequenceAccession no.Product size, bp
(5′–3′)a
TLR2F: GATTGTGGACAACATCATTGACTCNM_001161650294
R: AGAGCTGCTTTCAAGTTTTCCC
TLR4F: AGTCTGAAATTGCTGAGCTCAAATNM_001030693190
R: GCGACGTTAAGCCATGGAAG
IL-1βF: ACTGGGCATCAAGGGCTANM_204524131
R: GGTAGAAGATGAAGCGGGTC
TNF-αF: GAGCGTTGACTTGGCTGTCNM_20426764
R: AAGCAACAACCAGCTATGCAC
Claudin-1F: CATACTCCTGGGTCTGGTTGGTAY750897.1100
R: GACAGCCATCCGCATCTTCT
OccludinF: ACGGCAGCACCTACCTCAAD21837.1123
R: GGGCGAAGAAGCAGATGAG
Mucin-2F: TTCATGATGCCTGCTCTTGTGXM_42103593
R: CCTGAGCCTTGGTACATTCTTGT
β-actinF: GAGAAATTGTGCGTGACATCAL08165152
R: CCTGAACCTCTCATTGCCA

a F means forward, R means reverse

RT-PCR primers and Genbank accession numbers of chicken a F means forward, R means reverse

Statistical analyses

Results are given as mean values and pooled standard errors. Data were analyzed using the general linear model procedure of SAS software (SAS Institute Inc., Cary, NC, USA), and subjected to two-way ANOVA in a 4 × 2 factorial arrangement to analyze the main effects of EO supplementation and pathogen challenge, and their interaction. When the interaction was significant, polynomial contrasts were performed with the individual means in the unchallenged groups and challenged groups respectively, and the linear and quadratic responses to EO dosages were determined. If the interaction was not significant, polynomial contrasts were conducted to determine the linear and quadratic responses of the main-effect means (averaged between the unchallenged and challenged groups) to dietary EO dosages. Statistical significance was set at P ≤ 0.05, and 0.05 < P < 0.10 was considered a trend towards significance.

Results

Dietary thymol and carvacrol concentrations

The intended concentrations of thymol and carvacrol were 15, 30, and 60 mg/kg for the diets supplemented with 60, 120, and 240 mg/kg EO, respectively (Table 4). According to the quantitative analysis, the thymol concentrations were 94.5–95.1 % of the desired amount, and the carvacrol concentrations were 101.1–103.1 % of the desired amount. None of thymol or carvacrol was detected in the unsupplemented basal diet.
Table 4

Intended and analyzed concentrations of thymol and carvacrol in the experimental diets

ItemDietary EO concentration, mg/kg
060120240
ThymolND15.0/14.2a 30.0/28.560.0/56.8
CarvacrolND15.0/15.230.0/30.960.0/61.9

ND not detected. aIntended concentration in the diet/analyzed concentration in the diet

Intended and analyzed concentrations of thymol and carvacrol in the experimental diets ND not detected. aIntended concentration in the diet/analyzed concentration in the diet Dietary supplementation of 60, 120 and 240 mg/kg EO did not influence the growth performance of the broilers during d 0 to 14 (data not shown). BW gain (BWG) and FI were not impaired by C. perfringens challenge (Table 5). Between 14 and 28 d of age, the EO addition tended to linearly reduce the FCR (P = 0.056). The relative weight of spleen was increased due to C. perfringens challenge on d 21 (P = 0.004). No interaction on the growth performance was found between EO addition and C. perfringens challenge (P > 0.10).
Table 5

Effect of essential oils on the growth performance and relative spleen weight of broilersa

ItemsBWG (d 14–28), gFI (d 14–28), gFCR (d 14–28)Spleen (d 21), %
Treatment
 U181014351.770.10
 U283314071.700.11
 U385914541.700.12
 U486814361.660.11
 C188315101.710.11
 C287814801.690.14
 C382713951.690.13
 C483614181.700.14
 SEM11.214.30.010.004
P-value
 Challenge0.5590.5530.5690.004
 EO0.9840.6170.1480.289
 Challenge × EO0.2610.2620.3920.426
 Linearb 0.9380.2880.0560.155
 Quadraticb 0.9250.4340.3050.338

aValues are means of eight replicates per treatment. BWG body weight gain, FI feed intake, FCR feed conversion ratio, SEM pooled standard error, EO essential oils

bWhen the interaction between C. perfringens challenge and EO supplementation was not significant, linear and quadratic polynomial contrasts were performed on the main-effect means to EO dosages

Effect of essential oils on the growth performance and relative spleen weight of broilersa aValues are means of eight replicates per treatment. BWG body weight gain, FI feed intake, FCR feed conversion ratio, SEM pooled standard error, EO essential oils bWhen the interaction between C. perfringens challenge and EO supplementation was not significant, linear and quadratic polynomial contrasts were performed on the main-effect means to EO dosages No intestinal lesions were observed in the unchallenged birds. In the challenged birds, intestinal lesion scores were linearly reduced with increasing EO dosages (P = 0.010, Table 6), and the lesion severity of broilers in group C4 was milder than that of birds in group C1 (P ≤ 0.05). However, C. perfringens challenge did not lead to mortality in the present study.
Table 6

Effect of essential oils on the intestinal lesion score of the Clostridium perfringens-challenged broilers c

ItemC1C2C3C4SEM P-valueLineard Quadraticd
Lesion score1.50a 0.93ab 0.71ab 0.29b 0.1660.0650.010.514

a,bMean values within the same row not sharing a common uppercase superscript letter differ significantly (P ≤ 0.05)

cValues are means of eight replicates per treatment. SEM pooled standard error

dLinear and quadratic polynomial contrasts to EO dosages

Effect of essential oils on the intestinal lesion score of the Clostridium perfringens-challenged broilers c a,bMean values within the same row not sharing a common uppercase superscript letter differ significantly (P ≤ 0.05) cValues are means of eight replicates per treatment. SEM pooled standard error dLinear and quadratic polynomial contrasts to EO dosages

Intestinal morphology

The challenge of C. perfringens significantly increased crypt depth in the ileum (P = 0.005, Table 7). Although the dietary addition of 60–240 mg/kg EO did not influence villus height or crypt depth, the pathogen challenge and EO supplementation showed a significant interactive effect on the V:C ratio (P = 0.003). In the challenged birds, the EO supplementation linearly and quadratically increased the V:C ratio (P ≤ 0.05), and the ratio was greatly increased by the EO-included diets compared with the basal diet (P ≤ 0.05). The thickness of the muscular layer was not significantly influenced by C. perfringens challenge or EO supplementation.
Table 7

Effect of essential oils on the ileal morphology of broilersc

ItemsVH, μmCD, μmV:CML, μm
Treatment
 U1442.8194.32.32201.6
 U2395.2206.62.12201.8
 U3376.0225.81.74189.4
 U4488.7214.71.98181.2
 C1412.7270.01.32b, * 159.2
 C2472.0245.01.95a, * 160.8
 C3552.3270.21.93a, * 184.3
 C4451.0237.31.99a, * 201.7
 SEM18.697.940.065.93
P-value
 Challenge0.2200.0050.0350.161
 EO0.8050.7120.4500.898
 Challenge × EO0.1510.6680.0030.186
 Linear d 0.3700.664NA0.371
 Quadratic d 0.6680.687NA0.985

a,bMean values within the same column not sharing a common uppercase superscript letter differ significantly (P ≤ 0.05)

cValues are means of eight replicates per treatment. VH villus height, CD crypt depth, V:C the ratio of villus height to crypt depth, ML thickness of muscular layer, SEM pooled standard error, EO essential oils, NA not analyzed

dWhen the interaction between C. perfringens challenge and EO supplementation was not significant, linear and quadratic polynomial contrasts were performed on the main-effect means to EO dosages

* When the interaction was significant, mean values within the challenged or unchallenged groups have a linear and quadratic dose response to EO dosages (P ≤ 0.05)

Effect of essential oils on the ileal morphology of broilersc a,bMean values within the same column not sharing a common uppercase superscript letter differ significantly (P ≤ 0.05) cValues are means of eight replicates per treatment. VH villus height, CD crypt depth, V:C the ratio of villus height to crypt depth, ML thickness of muscular layer, SEM pooled standard error, EO essential oils, NA not analyzed dWhen the interaction between C. perfringens challenge and EO supplementation was not significant, linear and quadratic polynomial contrasts were performed on the main-effect means to EO dosages * When the interaction was significant, mean values within the challenged or unchallenged groups have a linear and quadratic dose response to EO dosages (P ≤ 0.05)

Gene expression of tight junction proteins and mucin-2

According to Table 8, C. perfringens challenge decreased the claudin-1 and occludin gene expression in the ileum (P = 0.006 and 0.031, respectively). The occludin gene expression tended to be up-regulated linearly with increasing EO dosages (P = 0.099). The expression of mucin-2 was not significantly influenced by C. perfringens challenge or EO addition.
Table 8

Effect of essential oils on the ileal gene expression of claudin-1, occludin and mucin-2 in broilersa

ItemClaudin-1OccludinMucin-2
Treatment
 U11.041.011.05
 U20.990.840.63
 U31.271.110.95
 U41.331.090.82
 C10.980.800.86
 C20.950.910.80
 C30.800.930.68
 C40.800.940.93
 SEM0.0510.0290.047
P-value
 Challenge0.0060.0310.627
 EO0.9080.1300.335
 Challenge × EO0.1360.2500.281
 Linearb 0.5990.0990.892
 Quadraticb 0.8940.7660.159

aValues are means of eight replicates per treatment. SEM pooled standard error, EO essential oils

bWhen the interaction between C. perfringens challenge and EO supplementation was not significant, linear and quadratic polynomial contrasts were performed on the main-effect means to EO dosages

Effect of essential oils on the ileal gene expression of claudin-1, occludin and mucin-2 in broilersa aValues are means of eight replicates per treatment. SEM pooled standard error, EO essential oils bWhen the interaction between C. perfringens challenge and EO supplementation was not significant, linear and quadratic polynomial contrasts were performed on the main-effect means to EO dosages

Inflammation-related gene expression

C. perfringens challenge enhanced the gene expression of TLR2 and IL-1β in the ileum (P = 0.057 and 0.042, respectively, Table 9), but did not significantly influence the gene expression of TLR4 and TNF-α. Dietary EO supplementation linearly (P = 0.050) and quadratically (P = 0.023) down-regulated the TLR2 gene expression, and linearly decreased the TNF-α gene expression (P = 0.020).
Table 9

Effect of essential oils on the ileal inflammation-related gene expression of broilersa

ItemTLR2TLR4TNF-αIL-1β
Treatment
 U11.281.021.031.09
 U21.181.050.841.34
 U30.740.970.921.00
 U41.100.930.821.08
 C11.571.101.071.74
 C21.360.970.901.52
 C31.081.021.061.53
 C41.150.880.851.27
 SEM0.0610.0430.0280.091
P-value
 Challenge0.0570.9630.1930.042
 EO0.0150.6690.0180.722
 Challenge × EO0.7770.9020.8600.707
 Linearb 0.0500.2040.0200.261
 Quadraticb 0.0230.9540.8510.949

aValues are means of eight replicates per treatment. SEM pooled standard error, EO essential oils

bWhen the interaction between C. perfringens challenge and EO supplementation was not significant, linear and quadratic polynomial contrasts were performed on the main-effect means to EO dosages

Effect of essential oils on the ileal inflammation-related gene expression of broilersa aValues are means of eight replicates per treatment. SEM pooled standard error, EO essential oils bWhen the interaction between C. perfringens challenge and EO supplementation was not significant, linear and quadratic polynomial contrasts were performed on the main-effect means to EO dosages

Humoral immunity and cellular immunity parameters

A significant interaction on serum NDV antibody titers was observed between C. perfringens challenge and the EO supplementation (P < 0.001, Table 10). In the challenged birds, the NDV antibody titers were linearly and qudratically elevated with increasing EO dosages (P ≤ 0.05). To be specific, the NDV antibody titers of birds in groups C3 and C4 were higher than those of birds in groups C1 and C2 (P ≤ 0.05), and the highest antibody titers were found in group C4 among all challenged groups (P ≤ 0.05). However, no significant differences in the NDV antibody titers were found in the unchallenged groups. In addition, C. perfringens challenge greatly increased the mucosal sIgA levels (P ≤ 0.05), which was not significantly affected by the EO supplementation. No remarkable differences were found in the proliferative responses of T cells and B cells, as evidenced by unchanged ConA and LPS SI in vitro.
Table 10

Effect of essential oils on the humoral and cellular immunity parameters of broilersd

ItemNDV antibody titers, log10 sIgA, mg/g proteinConA SILPS SI
Treatment
 U13.012.241.141.12
 U22.872.161.040.94
 U32.962.240.971.12
 U42.792.510.941.11
 C12.80c, * 3.841.051.20
 C23.14c, * 3.430.821.04
 C34.13b, * 3.420.991.01
 C44.24a, * 3.220.941.00
 SEM0.0850.2590.0310.03
P-value
 Challenge<0.0010.0330.2170.836
 EO<0.0010.9910.1830.279
 Challenge × EO<0.0010.9500.5050.425
 Lineare NA0.8000.1570.493
 Quadratice NA0.7600.2550.225

a,b,cMean values within the same column not sharing a common uppercase superscript letter differ significantly (P ≤ 0.05)

dValues are means of eight replicates per treatment. NDV Newcastle disease virus, sIgA secretory IgA, ConA concanavalin A, LPS lipopolysaccharides, SI stimulation index, SEM pooled standard error, EO essential oils, NA not analyzed

eWhen the interaction between C. perfringens challenge and EO supplementation was not significant, linear and quadratic polynomial contrasts were performed on the main-effect means to EO dosages

* When the interaction was significant, mean values within the challenged or unchallenged groups have a linear and quadratic dose response to EO dosages (P ≤ 0.05)

Effect of essential oils on the humoral and cellular immunity parameters of broilersd a,b,cMean values within the same column not sharing a common uppercase superscript letter differ significantly (P ≤ 0.05) dValues are means of eight replicates per treatment. NDV Newcastle disease virus, sIgA secretory IgA, ConA concanavalin A, LPS lipopolysaccharides, SI stimulation index, SEM pooled standard error, EO essential oils, NA not analyzed eWhen the interaction between C. perfringens challenge and EO supplementation was not significant, linear and quadratic polynomial contrasts were performed on the main-effect means to EO dosages * When the interaction was significant, mean values within the challenged or unchallenged groups have a linear and quadratic dose response to EO dosages (P ≤ 0.05)

Discussion

In the present study, the wheat-based diets and multiple oral gavages of C. perfringens were used to induce the experimental NE. High levels of soluble non-starch polysaccharides in the wheat could favor the proliferation of intestinal C. perfringens and cause more gut lesions [2, 30, 31]. However, the challenge did not result in overtly clinical signs of NE or NE-related mortality in the present study. The deficiency of the NetB gene in the C. perfringens strain we used might partially explain the absence of characteristic NE, since NetB has been demonstrated to play a major role in the pathogenesis of NE [3, 5]. Despite this, C. perfringens challenge damaged the intestinal mucosa, as observed by macroscopic lesions, which was similar to previous studies using the same challenge model to create the sub-clinical NE [23, 24]. In the current study, dietary supplementation of thymol and carvacrol-bearing EO alleviated the intestinal lesions, increased the intestinal V:C ratio, decreased the inflammatory response and improved the specific antibody titers in the challenged birds. These results suggested that the EO preparation had protective effects against C. perfringens challenge. And this might, at least partially, be associated with their modulation on intestinal integrity and immunity. Usually, damaged mucosa caused by C. perfringens leads to retarded growth rate and poor feed conversion efficiency in chickens [3, 4]. However, FI and BWG were not significantly influenced in the present study, which was similar to the results obtained by Grilli et al. [32]. In the current study, the EO supplementation did not significantly influence the growth performance except that FCR tended to be reduced with increasing EO dosages during 14 to 28 days of age. In fact, the effects of EO on the growth performance of piglets and poultry were variable. However, the majority of experimental results indicated reduced FI at largely unchanged BWG or final BW, which led to an improved feed conversion ratio when feeding EO [6, 33, 34]. Generally speaking, the stimulation of digestive secretions (e.g., saliva and bile) and enhanced enzyme activity were proposed to be a core mode of EO to improve the feed conversion efficiency [33-36]. In the current study, dietary EO supplementation linearly decreased macroscopic gut lesions, and improved intestinal histomorphology microscopically in the challenged birds. Morphology of the small intestine can be used as an indicator for intestinal health and integrity [37]. Deeper crypts indicate faster cellular turnover to permit renewal of the villus as needed in response to normal sloughing or inflammation induced by pathogens or their toxins [37]. In this study, C. perfringens challenge led to remarkably deeper crypt in the ileum and pronounced intestinal lesions. Similar observations were reported in birds infected with C. perfringens [24, 37]. In the challenged birds, however, the dietary EO supplementation linearly alleviated the intestinal lesions, and 60–240 mg/kg EO numerically increased the villus height and decreased the crypt depth, which resulted in significantly elevated V:C ratio, indicating mature enterocytes and efficient ability of nutrient absorption. The beneficial effects of EO on intestinal lesions and histomorphology might be associated with their antibacterial activity and stabilizing effects on intestinal microflora [33, 34]. Also, the anti-inflammatory effects of EO might favor the intestinal health and develop better villus-crypt micro-architecture. The intestinal mucosa is not only the major site for nutrient digestion and absorption, but also plays a key role in host defense against pathogen infection. Tight junction (TJ) proteins form a dynamic seal between epithelial cells and act as a fence preventing macromolecular transmission. The disruption of intestinal TJ proteins could lead to increasing permeability to luminal antigens and bacteria translocation [38]. However, few data are available regarding TJ protein expression in C. perfringens-infected birds, except that Liu et al. reported decreased occludin gene expression in the small intestine of the infected birds [24]. In the present study, decreased ileal gene expression of occludin and claudin-1 was also observed in the challenged broilers, and the dietary supplementation of EO tended to linearly increase the occludin gene expression. Besides TJ proteins, mucus layer is the first barrier of defense encountered by intestinal bacteria, and mucins are the primary constituent of the mucus layer [39]. Mucin-2, the major mucin gene in the small intestine, was not significantly influenced by C. perfringens infection in the present study, which was similar to previous studies [24, 39]. And EO supplementation also did not affect the gene expression of mucin-2. During evolution, pattern recognition receptors (PRRs) are selected to recognize the conserved components of microorganisms or pathogen associated molecular patterns, including LPS and peptidoglycans [40]. TLRs are important members of PRRs, which trigger subsequent inflammatory responses through MyD88 dependent or independent signaling pathways and finally lead to release of pro-inflammatory cytokines [40, 41]. In mammals, TLR4 could recognize LPS, which is unique to Gram-negative bacteria, and TLR2 could recognize peptidoglycans, which is abundant in Gram-positive bacteria [41]. In the present study, the intestinal TLR2 gene expression was up-regulated in the C. perfringens-challenged birds, but the TLR4 gene expression was not significantly affected. Similar results were obtained by Cao et al. [28]. Of note, however, some investigators reported no obvious alteration of the TLR2 gene expression was observed in chicken intestine and primary intestinal epithelial cells [42, 43]. The controversial results might be related with dosage and frequency of C. perfringens infection, which need further investigation. TNF-α and IL-1β are the important pro-inflammatory cytokines, which regulate the host immunity against multiple pathogens through immune cell differentiation, proliferation, apoptosis and NO production [44]. However, excessive and long-term production of pro-inflammatory cytokines might lead to gut damage and high consumption of energy [44]. Thus, the suppression of TLR2 and pro-inflammatory cytokine TNF-α by the dietary EO supplementation in the current study might alleviate inflammation and improve gut health, as evidenced by attenuated gut lesions and increased V:C ratio in the ileum. Actually, anti-inflammatory effects of thymol and carvacrol have been well documented in pharmacological experiments with rodents. They could inhibit pro-inflammatory cytokines,decrease inflammatory cell recruitment, alleviate oxidative damage and thus reduce tissue injury [17-19]. However, limited information is available about the effects of EO on the production of cytokines and chemokines in poultry. One of our previous studies demonstrated that 60 mg/kg of the same EO preparation showed anti-inflammatory effects by decreasing the TNF-α gene expression and increasing the IL-4 gene expression in the broilers challenged with multiple LPS injections [20]. Besides the important roles in immunity, cytokines were also demonstrated to affect TJ. Pro-inflammatory cytokines could induce disruption of TJ, which led to increased intestinal permeability, whereas anti-inflammatory cytokines tended to protect the intestinal integrity [45]. In the present study, dietary EO supplementation suppressed the TNF-α gene expression, which was in accordance with the trend of increased occludin gene expression in the ileum. To explore the effects of EO on humoral immunity, specific antibody titers were analyzed. We observed that dietary supplementation of 120 and 240 mg/kg EO significantly increased the serum NDV antibody titers compared with the basal diet or diet with 60 mg/kg EO in the challenged birds. This was consistent with previous studies, which demonstrated that dietary supplementation of EO enhanced the specific immune responses in broilers and laying hens [14, 46, 47]. As the most abundant immunoglobulin isotype in mucosal secretions, sIgA is the fundamental effector to mucosal immunity. In the present study, C. perfringens challenge induced sIgA secretion, which was not significantly affected by the EO supplementation. In addition to humoral immunity, 5 mg/kg carvacrol-bearing EO and 707 mg/kg carvacrol-bearing oregano oil was reported to promote the lymphocyte proliferation [13, 48]. Under certain concentrations, however, carvacrol could suppress the porcine lymphocyte proliferation, which might occur through the induction of apoptosis [49]. We did not found any remarkable effect of C. perfringens challenge or EO supplementation on the proliferative responses of T cells and B cells in vitro.

Conclusions

In conclusion, the dietary supplementation of 60, 120 and 240 mg/kg EO (which contained 25 % thymol and 25 % carvacrol as active components) alleviated the intestinal lesions, improved the intestinal histomorphology, decreased the inflammatory response and enhanced the specific immune response in the C. perfringens-challenged broiler chickens. Based on the results obtained in this study, 240 mg/kg of the EO preparation was an optimum supplementation dose for protecting broiler chickens against C. perfringens challenge. The beneficial effects of EO might, at least partially, be associated with their modulatory effects on the intestinal integrity and immunity. More studies are needed to further define the underlying molecular mechanisms.
  36 in total

Review 1.  Toll-like receptors: linking innate and adaptive immunity.

Authors:  Chandrashekhar Pasare; Ruslan Medzhitov
Journal:  Microbes Infect       Date:  2004-12       Impact factor: 2.700

Review 2.  Rethinking our understanding of the pathogenesis of necrotic enteritis in chickens.

Authors:  Filip Van Immerseel; Julian I Rood; Robert J Moore; Richard W Titball
Journal:  Trends Microbiol       Date:  2008-10-30       Impact factor: 17.079

Review 3.  Regulation of tight junction permeability by intestinal bacteria and dietary components.

Authors:  Dulantha Ulluwishewa; Rachel C Anderson; Warren C McNabb; Paul J Moughan; Jerry M Wells; Nicole C Roy
Journal:  J Nutr       Date:  2011-03-23       Impact factor: 4.798

4.  Inflammatory responses to a Clostridium perfringens type A strain and α-toxin in primary intestinal epithelial cells of chicken embryos.

Authors:  Shuangshuang Guo; Changwu Li; Dan Liu; Yuming Guo
Journal:  Avian Pathol       Date:  2015       Impact factor: 3.378

5.  Dietary calcium, phosphorus, and phytase effects on bird performance, intestinal morphology, mineral digestibility, and bone ash during a natural necrotic enteritis episode.

Authors:  Diego Paiva; Carrie Walk; Audrey McElroy
Journal:  Poult Sci       Date:  2014-08-20       Impact factor: 3.352

6.  Xylanase supplementation to a wheat-based diet alleviated the intestinal mucosal barrier impairment of broiler chickens challenged by Clostridium perfringens.

Authors:  Dan Liu; Shuangshuang Guo; Yuming Guo
Journal:  Avian Pathol       Date:  2012       Impact factor: 3.378

7.  Carvacrol attenuates mechanical hypernociception and inflammatory response.

Authors:  Adriana G Guimarães; Maria A Xavier; Marília T de Santana; Enilton A Camargo; Cliomar A Santos; Fabíola A Brito; Emiliano O Barreto; Sócrates C H Cavalcanti; Angelo R Antoniolli; Rita C M Oliveira; Lucindo J Quintans-Júnior
Journal:  Naunyn Schmiedebergs Arch Pharmacol       Date:  2011-12-03       Impact factor: 3.000

Review 8.  Predisposing factors and prevention of Clostridium perfringens-associated enteritis.

Authors:  Janneke G Allaart; Alphons J A M van Asten; Andrea Gröne
Journal:  Comp Immunol Microbiol Infect Dis       Date:  2013-06-18       Impact factor: 2.268

9.  Anti-inflammatory and cicatrizing activities of thymol, a monoterpene of the essential oil from Lippia gracilis, in rodents.

Authors:  K R Riella; R R Marinho; J S Santos; R N Pereira-Filho; J C Cardoso; R L C Albuquerque-Junior; S M Thomazzi
Journal:  J Ethnopharmacol       Date:  2012-07-31       Impact factor: 4.360

10.  Effects of dietary essential oil components on growth performance, digestive enzymes and lipid metabolism in female broiler chickens.

Authors:  K W Lee; H Everts; H J Kappert; M Frehner; R Losa; A C Beynen
Journal:  Br Poult Sci       Date:  2003-07       Impact factor: 2.095

View more
  43 in total

1.  In vitro and in vivo evaluation of thyme (Thymus vulgaris) essential oil as an alternative for antibiotic in quail diet1.

Authors:  Naghmeh Dehghani; Mohsen Afsharmanesh; Mohammad Salarmoini; Hadi Ebrahimnejad
Journal:  J Anim Sci       Date:  2019-07-02       Impact factor: 3.159

Review 2.  Inactivation Strategies for Clostridium perfringens Spores and Vegetative Cells.

Authors:  Prabhat K Talukdar; Pathima Udompijitkul; Ashfaque Hossain; Mahfuzur R Sarker
Journal:  Appl Environ Microbiol       Date:  2016-12-15       Impact factor: 4.792

Review 3.  Dietary phytonutrients and animal health: regulation of immune function during gastrointestinal infections.

Authors:  Andrew R Williams; Audrey I S Andersen-Civil; Ling Zhu; Alexandra Blanchard
Journal:  J Anim Sci       Date:  2020-04-01       Impact factor: 3.159

4.  A study on fungal defensin against multidrug-resistant Clostridium perfringens and its treatment on infected poultry.

Authors:  Xueling Zheng; Da Teng; Ruoyu Mao; Ya Hao; Na Yang; Fengming Hu; Jianhua Wang
Journal:  Appl Microbiol Biotechnol       Date:  2021-09-07       Impact factor: 4.813

5.  Dietary Eugenol Nanoemulsion Potentiated Performance of Broiler Chickens: Orchestration of Digestive Enzymes, Intestinal Barrier Functions and Cytokines Related Gene Expression With a Consequence of Attenuating the Severity of E. coli O78 Infection.

Authors:  Doaa Ibrahim; Fatma Eldemery; Aya Sh Metwally; Ehab M Abd-Allah; Dalia T Mohamed; Tamer Ahmed Ismail; Thoria A Hamed; Gehan M Al Sadik; Ahmed N F Neamat-Allah; Marwa I Abd El-Hamid
Journal:  Front Vet Sci       Date:  2022-06-23

6.  Effects of dietary oregano essential oil supplementation on growth performance, intestinal antioxidative capacity, immunity, and intestinal microbiota in yellow-feathered chickens.

Authors:  Dong Ruan; Qiuli Fan; Ahmed Mohamed Fouad; Yunyun Sun; Shengshu Huang; Aiji Wu; Chuxiao Lin; Zhixiang Kuang; Chang Zhang; Shouqun Jiang
Journal:  J Anim Sci       Date:  2021-02-01       Impact factor: 3.159

7.  Effects of a dietary direct-fed microbial and Ferulago angulata extract on growth performance, intestinal microflora, and immune function of broiler chickens infected with Campylobacter jejuni.

Authors:  Zahra Nooreh; Kamran Taherpour; Mohammad Akbari Gharaei; Hassan Shirzadi; Hossein Ali Ghasemi
Journal:  Poult Sci       Date:  2021-01-05       Impact factor: 3.352

8.  Over-expression of Toll-like receptor 2 up-regulates heme oxygenase-1 expression and decreases oxidative injury in dairy goats.

Authors:  Shoulong Deng; Kun Yu; Wuqi Jiang; Yan Li; Shuotian Wang; Zhuo Deng; Yuchang Yao; Baolu Zhang; Guoshi Liu; Yixun Liu; Zhengxing Lian
Journal:  J Anim Sci Biotechnol       Date:  2017-01-09

9.  Supplemental thymol and carvacrol increases ileum Lactobacillus population and reduces effect of necrotic enteritis caused by Clostridium perfringes in chickens.

Authors:  Dafei Yin; Encun Du; Jianmin Yuan; Jinxin Gao; YouLi Wang; Samuel E Aggrey; Yuming Guo
Journal:  Sci Rep       Date:  2017-08-04       Impact factor: 4.379

10.  Monoglyceride Blend Reduces Mortality, Improves Nutrient Digestibility, and Intestinal Health in Broilers Subjected to Clinical Necrotic Enteritis Challenge.

Authors:  Alip Kumar; Sarbast K Kheravii; Lily Li; Shu-Biao Wu
Journal:  Animals (Basel)       Date:  2021-05-17       Impact factor: 2.752

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.