Literature DB >> 26998071

miR-196b regulates gastric cancer cell proliferation and invasion via PI3K/AKT/mTOR signaling pathway.

N A Li1, Weiqiang Wang2, Bin Xu1, Hongyun Gong1.   

Abstract

miR-196b plays a significant role in the regulation of tumor pathogenesis and progression by promoting tumor cell proliferation, invasion and metastasis. In order to explore the effects of miR-196b on the proliferation and invasion ability of gastric cancer cells and the involved mechanisms, in the present study the lentivirus expression vector miR-196b was constructed and transfected into the human gastric cancer cell line MKN28. The cell proliferation and invasion ability were observed and the expression of PI3K/AKT/mTOR protein and mRNA were analyzed following upregulation of the expression of miR-196b. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) results revealed that the proliferation of MKN28 cells was notably increased following upregulation of the expression of miR-196b (P<0.01). Flow cytometry analysis demonstrated that miR-196b decreased the ratios of cells in the GO/G1 stage but increased the ratios in S and G2 stage (P<0.05). Furthermore, the cell clone formation and trans-membrane rates were increased following upregulation of the expression of miR-196b (P<0.01). The nude mouse tumor growth test revealed that tumor growth was more rapid following upregulation of the expression of miR-196b. The expression of PI3K/AKT/mTOR protein and mRNA were increased following upregulation of the expression of miR-196b. We concluded that upregulation of miR-196b promotes the proliferation and invasion ability of gastric cancer cells by regulating the PI3K/AKT/mTOR pathway.

Entities:  

Keywords:  AKT; PI3K; gastric cancer; invasion; mTOR; miR-196b; proliferation

Year:  2016        PMID: 26998071      PMCID: PMC4774536          DOI: 10.3892/ol.2016.4141

Source DB:  PubMed          Journal:  Oncol Lett        ISSN: 1792-1074            Impact factor:   2.967


Introduction

Gastric cancer is a common type of tumor with high incidence and mortality rates which poses a significant threat to human life. As the mechanism of gastric carcinogenesis is still unknown, the study of gastric cancer initiation and progression and the search for new therapeutic targets are currently hot research topics. microRNA (miR) is a newly identified single-stranded non-coded RNA containing 17–19 nucleotides that is a significant regulator of gastric cancer initiation and progression. A series of studies has reported that miR plays an essential regulatory role in the proliferation, invasion and metastasis of gastric cancer cells and in cell apoptosis (1–8). miR-196 was demonstrated to be associated with involution of normal tissues, rib (9), tail (10) and bone marrow (11), as well as regulation of cancers of the rectum (12,13) and liver (14), and appears to be a potential target for cancer therapy (15). The PI3K/AKT/mTOR signaling pathway is known to be essential to cell apoptosis. To determine the effect of miR-196b in controlling apoptosis in gastric cancer cells, as well as the underlying mechanism, here we examined the correlation between miR-196b expression and apoptosis of MKN28 gastric cancer cells and assessed its role in controlling the PI3K/AKT signaling pathway.

Materials and methods

Lentivirus-based miR-196b vector production and its delivery to gastric cancer MKN28 cells

The following study was approved by the Ethics Committee of Wuhan University (Wuhan, China). Primers specific to human miR-196b (gene ID 442920) were designed as follows: 5′-CGGTTAACCCCTTCCTTGACGCATTTG-'3 (sense) and 5′-CGACTCGAGAACCTAACCCTACCTGCTGTGA-3′ (anti-sense). The primers were synchronized by Takara Biotechnology Co., Ltd. (Dalian, China) by introducing HpaI and XhoI restriction enzyme sites at the terminals. The normal male peripheral blood genomic DNA template was used to amplify specific fragments by polymerase chain reaction (PCR). Then the PCR product and pLL-3.7 plasmid (Takara Biotechnology Co., Ltd.) were digested with HpaI and XhoI and ligated overnight using T4 ligase at 16°C. The ligated product was transferred to E.coli STBL-3 competent cells (Takara Biotechnology Co., Ltd.) and selected for positive clones by plating on an ampicillin+LB plate. pLL-miR-196 plasmid was purified from the positive clones. Using Lipofectamine® 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), 10 mg pLL-miR-196b and 5 mg pCMV-VSV-G were delivered to HEK293FT cells (Cell Bank of the Chinese Academy of Science, Beijing, China). Prior to transfection, the cells were seeded on a six-well plate at a density of 2×106 cells per well and co-cultured with modified RPMI-1640 medium containing 2 ml 10% fetal bovine serum (FBS; HyClone; GE Healthcare Life Sciences, Logan, UT, USA) until confluence reached 70–90%. Virus-containing cell culture fluid was collected at 48 h post-transfection, centrifugated at 3000 × g for 15 min at 4°C, filtered through a 0.45-µm filter, and maintained at −80°C. MKN28 gastric cancer cells (Cell Bank of the Chinese Academy of Science) were incubated on a six-well plate at a density of 1×106 per well with modified RPMI-1640 medium supplemented with 2 ml 10% FBS. After 24 h, virus-containing supernatant was delivered to the cells to serve as the miR-196b group. For the control group, the same procedure was carried out, with the exception that the virus-containing supernatant was replaced with 100 µl phosphate-buffered saline (PBS). The transduced cells demonstrated green fluorescence under the fluorescence microscope. The expression of miR-196b was measured using quantitative PCR (qPCR).

qPCR

When cells were in the exponential phase of growth, TRIzol reagent (Thermo Fisher Scientific, Inc.) was used to isolate total RNA. mRNA reverse transcription was generated using the RevertAid First Strand cDNA synthesis kit (Thermo Fisher Scientific, Inc.) following the instructions. The reaction system was as follows: 2 µl 5X PrimeScript buffer, 2 µl total RNA (0.25 µg/µl), 1 µl primers (10 pM), 0.5 µl PrimerScript RT enzyme mix, and 6.5 µl RNase-free dH2O. The reaction parameters were 37°C for 15 min, followed by 85°C for 5 sec and 4°C for the hold. Quantitative analysis was performed using a Thunderbird SYBR® qPCR mix kit (Toyobo Co., Ltd., Osaka, Japan). The reaction system was as follows: 12.5 µl 2X qPCR mix, 2.0 µl of each 2.5 µM primer, 2.0 µl reverse transcription products, and 8.5 µl ddH2O. The amplification parameters were 40 cycles of 95°C for 3 sec, 95°C for 5 sec, 60°C for 30 sec, and 68°C for 45 sec. For the qPCR primers, see Table I.
Table I.

Quantitative polymerase chain reaction primers.

GenePrimers (5′→3′)
miR-125aSense: CGGTTAACCCCTTCCTTGACGCATTTG
Anti-sense: CGACTCGAGAACCTAACCCTA
CCTGCTGTGA
PI3KSense: GCCCAGGCTTACTACAGAG
Anti-sense: AAGTAGGGAGGCATCTCG
AKTSense: CTCATTCCAGACCCACGAC
Anti-sense: ACAGCCCCGAAGTCCGTTA
mTORSense: ATGACGAGACCCAGGCTAA
Anti-sense: GCCAGTCCTCTACAATACGC
β-actinSense: ATCATGTTTGAGACCTTCAACA
Anti-sense: CATCTCTTGGTCGAAGTCCA
U6Sense: CTCGCTTCGGCAGCACA
Anti-sense: AACGCTTCACGAATTTGCGT

Western blot analysis

Cells were lysed for total protein extraction using RIPA buffer (250 µl, Beyotime Institute of Biotechnology, Shanghai, China) for 24 h after being incubated on a six-well plate. The expression of miR-196a, PI3K, AKT and mTOR was measured using a western blot kit (Biosdec, Wuhan, China). Rat anti-human miR-196a, PI3K, AKT and mTOR antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, Dallas, TX, USA). Successively, 50 µg total protein was separated using sodium dodecyl sulphate-polyacrylamide gel electrophoresis, transferred to a 0.45 µm polyvinylidene fluoride membrane and incubated overnight at 4°C with rat anti-human monoclonal antibody (1:3000 dilution). Following decoloration, horseradish peroxidase-conjugated goat anti-rabbit secondary antibody at a 1:3000 dilution was added for 30 min at room temperature and unbound antibody was washed away. Proteins were visualized by enhanced chemiluminescence detection reagents (Thermo Fisher Scientific, Inc.) and exposed to X-ray film after raffinate clearance. Exposure conditions and developing and fixing were based on the light intensity. Developed films were processed with BanScan software (Glyko Inc., Novato, CA, USA) to determine optical densities.

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method for analysis of cell proliferative activity

Cells were seeded on a 96-well plate at a density of 2000 cells per well. When the cells reached 80% confluence, the culture medium was removed before adding 20 µl MTT reaction solution (5 mg/ml, Beyotime Institute of Biotechnology) to each well. Once the cells had been incubated in the dark for 4 h at 37°C, the supernatant was removed and 150 µl DMSO (Beyotime Institute of Biotechnology) was added to each well and agitated for 10 min at room temperature. Optical density was measured at 490 nm using the enzyme-linked immunosorbent assay.

Flow cytometry for analysis of cell cycle

Cells were seeded on a six-well plate at a density of 1×106 per well and allowed to incubate until cell adhesion using the conventional culture technique. The culture medium was removed, then cells were suspended, centrifuged and then fixed with precooled 75% ethanol overnight at −20°C. Cells were centrifuged to remove supernatant and washed twice with PBS. A total of 450 µl PBS was added to each well to resuspend cells. Subsequently, 50 µl propidium iodide (0.5 mg/ml, Beyotime Institute of Biotechnology) was added, agitated and the cells were maintained in a water bath at 37°C for 30 min. Cells were again centrifuged to remove the supernatant and PBS was used to resuspend the cells. The cell cycle was determined by flow cytometer (BD-FACSCalibur, BD Biosciences, San Jose, CA, USA).

Soft agar colony formation assay

Soft agar (5%) was added to the medium at a 1:9 ratio and mixed well before being placed on dishes and cooled at room temperature. Exponentially growing cell suspension containing 1×103 cells/ml was prepared. Cell suspension (1.5 ml) was then added to an equal volume of 0.5% soft agar, agitated and incubated on a dish at 37°C under 5% CO2 for 2 to 3 weeks. The formation of colonies was calculated using the formula: Colony formation rate (%) = (number of colonies/number of cells incubated) × 100.

In vitro cell invasion assay

Cell invasion ability was tested using a Transwell chamber model (Chemicon; EMD Millipore, Billerica, MA, USA). Cell suspension was adjusted to a concentration of 1×105 cells/ml. Then, 50 µl cell suspension was placed in the upper chamber. After 24 h, cells that had migrated to the lower chamber were fixed with 10% formalin and stained with Giemsa to quantitate the number of transmigrated cells under an inverted microscope. The transmigration rate was the number of cells transmigrated over the total number of cells.

Tumorigenecity test in nude mice

Six 5-week-old BALB/c nude mice purchased from Wuhan University Center for Animal Experiments, China, were randomly assigned to the miR-196a group and control group, with three mice per group. In the miR-196a group, 1×105 miR-196a-transfected MKN28 cells were suspended in a serum-free RPMI-1640 medium (0.1 ml), and administered by subcutaneous injection into the back of the nude mice. Three days later, another injection with the same number of cells at the same concentration was administered. In the control group, the mice underwent the same treatment as the miR-196a group with the exception that the MKN28 cells were not miR-196a-transfected. Animals were sacrificed 4 weeks after tumor formation and tumor weight was determined.

Statistical analysis

Data were expressed as the means ± standard deviation and were processed with the paired t-test using SPSS 16.0 software (SPSS, Inc., Chicago, Illinois, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Effect of miR-196b activation on gastric cancer cell proliferation

MKN28 cells exhibited green fluorescence when transfected with lentivirus-mediated miR-196b. In addition, the expression of miR-196b RNA was ~20-fold higher than that in the control group (Fig. 1A). The results of the MTT assay revealed that miR-196b activation enhanced the proliferative ability of MKN28 cells compared with that of the control group (P<0.01; Fig. 1B). We assessed the effect of miR-196b on the cycle of gastric cancer cells by flow cytometry and observed that gastric cancer cells in the G0/G1 phase decreased, while those in the S and G2 phase of the cell cycle increased compared with the control group (P<0.05; Fig. 1C).
Figure 1.

Upregulation of miR-196b induces gastric cancer cell proliferation and transition from GO/G1 phase to S phase. (A) miR-196b RNA was upregulated by miR-196b transfection; (B) Cell proliferation ability was enhanced by miR-196b transfection; (C) The number of cells in the G0/G1 phase was decreased and that in the S and G2 phase increased following miR-196b transfection. *P<0.01 vs. control group, **P<0.05 vs. control group.

Effect of miR-196b on gastric cancer cell cloning and invasion

Colony-forming cell assay revealed that the cell cloning efficiency increased to (78±12)% following miR-196b activation compared with (32±8)% in the control group (P<0.01; Fig. 2A). Transwell invasion assay revealed (48±16)% cell migration following miR-196b activation, which was far higher than the (12±4)% observed in the control group (P<0.01; Fig. 2B).
Figure 2.

miR-196b activation induces gastric cancer cell cloning and invasion. (A) miR-196b induced a cloning efficiency of gastric cancer cells far higher than that observed in the control group; (B) miR-196b induced greater migration capacity in gastric cancer cells compared with the control group.

In vitro tumor growth induced by miR-196b transfection

The results of the tumorigenecity test revealed increased tumor growth following miR-196b transfection (Fig. 3A). Four weeks after injection of miR-196b-transfected gastric cancer cells into nude mice, the tumor weight was significantly higher than that of the control group (P<0.01; Fig. 3B).
Figure 3.

In vitro tumor growth induced by miR-196b transfection. (A) miR-196b induced growth of tumors; (B) Tumor weight was significantly higher than that in the control group 4 weeks after injection of miR-196b-transfected gastric cancer cells into nude mice. *P<0.01 vs. control group.

miR-196b regulates PI3K/AKT/mTOR expression

Western blot analysis revealed that the levels of PI3K/AKT/mTOR protein in gastric cancer cells were 0.38±0.06, 0.46±0.08 and 0.22±0.06 in the miR-196b transfection group, which was far higher than the levels 0.18±0.03, 0.16±0.04 and 0.09±0.03 observed in the negative control group (P<0.01; Fig. 4A). qPCR analysis demonstrated significant upregulation of PI3K/AKT/mTOR mRNA in gastric cancer cells following miR-196b transfection (Fig. 4B).
Figure 4.

miR-196b regulates PI3K/AKT/mTOR expression in gastric cancer cells. (A) As demonstrated by western blot analysis, miR-196b induced a significantly higher expression of PI3K/AKT/mTOR protein (P<0.01); (B) As demonstrated by quantitative polymerase chain reaction analysis, miR-196b increased the expression of PI3K/AKT/mTOR mRNA to a level far higher than that in the control group (P<0.01). *P<0.01 vs. control group.

Discussion

A previous study reported that miR-196b played a significant role in human tissue evolution and tumor growth with particular emphasis on its role in the development and progression of tumors (15). This provided a promising targeted cancer therapy. miR-196b and miR-196a are each members of the miR-196 family, despite miR-196b exhibiting one basic group difference from miR-196a, they present similarities in terms of their molecular structure and function. miR-196b was demonstrated to have a positive effect on cancer proliferation, but a negative effect on tumor cell apoptosis and differentiation was implicated in the development and progression of leukemia and other cancer types. The expression of miR-196b was upregulated in short-term hematopoietic stem cells and downregulated in highly-differentiated hematopoietic stem cells (16). In addition, in mixed-lineage leukemia medullary cells, miR-196b demonstrated overexpression driven by the pathogenically abnormal MLL fusion protein (16) and became a target of HOX genes (17,18). The regulatory role of miR-196b in gastric cancer cells was investigated with lentivirus-mediated miR-196b transfection into gastric cancer cells. To verify the role of miR-196b in regulating gastric cancer cell proliferation, we conducted an MTT assay to measure the proliferative ability of gastric cancer cells following miR-196b activation, and observed that miR-196b enhanced cell proliferation (Fig. 1B). In addition, changes in gastric cancer cell cycle following miR-196b activation were detected using flow cytometry. As a result, cells progressing from the G0/G1 phase to the S phase were observed. Taken together, our results indicate a significant regulatory role of miR-196b in gastric cancer cell proliferation. In our study, soft agar and Transwell assays were performed to validate the role of miR-196b in regulating the proliferation and migration of gastric cancer cells. Soft agar colony formation assay is used to monitor tumor anchorage-independent growth and tumor malignancy; i.e., a stronger invasion ability of tumor cells is associated with a greater number of cell colonies (19–21). The Transwell chamber model, which imitates a cancer-associated microenvironment and extracellular matrix, is known to be a reliable method for assaying cell invasion ability (22). Our results identified a marked increase in the cloning efficiency and migration rate of gastric cancer cells following miR-196b activation, and implicated a metastasis-promoting role of miR-196b in gastric cancer cells (Fig. 2). In addition, to measure the role of miR-196b in cancer genesis and growth in vitro, we conducted tumorigenicity test in nude mice to assess cancer growth following miR-196b activation. It was observed that miR-196b induced tumor growth (Fig. 3). The PI3K/AKT/mTOR signaling pathway is known to be significant in the genesis, invasion and migration of gastric cancer (23–26). Our study identified that PI3K/AKT/mTOR mRNA and protein were upregulated in gastric cancer cells following miR-196b activation, and implicated an active role of miR-196b in gastric cancer cells via the PI3K/AKT/mTOR pathway. High expression of miR-196b contributes to gastric cancer proliferation and migration, and the mechanism is associated with the interference of the PI3K/AKT/mTOR signaling pathway. miR-196b may be a potential molecular target for gastric cancer therapy.
  26 in total

Review 1.  HER2 expression and PI3K-Akt pathway alterations in gastric cancer.

Authors:  Yasutaka Sukawa; Hiroyuki Yamamoto; Katsuhiko Nosho; Miki Ito; Hisayoshi Igarashi; Takafumi Naito; Kei Mitsuhashi; Yasutaka Matsunaga; Taiga Takahashi; Masashi Mikami; Yasushi Adachi; Hiromu Suzuki; Yasuhisa Shinomura
Journal:  Digestion       Date:  2014-01-20       Impact factor: 3.216

2.  A synonymous variant in IRGM alters a binding site for miR-196 and causes deregulation of IRGM-dependent xenophagy in Crohn's disease.

Authors:  Patrick Brest; Pierre Lapaquette; Mouloud Souidi; Kevin Lebrigand; Annabelle Cesaro; Valérie Vouret-Craviari; Bernard Mari; Pascal Barbry; Jean-François Mosnier; Xavier Hébuterne; Annick Harel-Bellan; Baharia Mograbi; Arlette Darfeuille-Michaud; Paul Hofman
Journal:  Nat Genet       Date:  2011-01-30       Impact factor: 38.330

3.  Expression of PI3K/AKT pathway in gastric cancer and its blockade suppresses tumor growth and metastasis.

Authors:  B Ye; L-L Jiang; H-T Xu; D-W Zhou; Z-S Li
Journal:  Int J Immunopathol Pharmacol       Date:  2012 Jul-Sep       Impact factor: 3.219

4.  Evaluation of SNPs in miR-196-a2, miR-27a and miR-146a as risk factors of colorectal cancer.

Authors:  Renata Hezova; Alena Kovarikova; Julie Bienertova-Vasku; Milana Sachlova; Martina Redova; Anna Vasku; Marek Svoboda; Lenka Radova; Igor Kiss; Rostislav Vyzula; Ondrej Slaby
Journal:  World J Gastroenterol       Date:  2012-06-14       Impact factor: 5.742

5.  The microRNA miR-196 acts upstream of Hoxb8 and Shh in limb development.

Authors:  Eran Hornstein; Jennifer H Mansfield; Soraya Yekta; Jimmy Kuang-Hsien Hu; Brian D Harfe; Michael T McManus; Scott Baskerville; David P Bartel; Clifford J Tabin
Journal:  Nature       Date:  2005-12-01       Impact factor: 49.962

6.  Expression of miR-196b is not exclusively MLL-driven but is especially linked to activation of HOXA genes in pediatric acute lymphoblastic leukemia.

Authors:  Diana Schotte; Ellen A M Lange-Turenhout; Dominique J P M Stumpel; Ronald W Stam; Jessica G C A M Buijs-Gladdines; Jules P P Meijerink; Rob Pieters; Monique L Den Boer
Journal:  Haematologica       Date:  2010-05-21       Impact factor: 9.941

7.  The clinical significance of downregulation of mir-124-3p, mir-146a-5p, mir-155-5p and mir-335-5p in gastric cancer tumorigenesis.

Authors:  Hailong Li; Shoupin Xie; Min Liu; Zhaofeng Chen; Xiaojun Liu; Li Wang; Dayan Li; Yongning Zhou
Journal:  Int J Oncol       Date:  2014-05-06       Impact factor: 5.650

8.  Regulation of mir-196b by MLL and its overexpression by MLL fusions contributes to immortalization.

Authors:  Relja Popovic; Laurie E Riesbeck; Chinavenmeni S Velu; Aditya Chaubey; Jiwang Zhang; Nicholas J Achille; Frank E Erfurth; Katherine Eaton; Jun Lu; H Leighton Grimes; Jianjun Chen; Janet D Rowley; Nancy J Zeleznik-Le
Journal:  Blood       Date:  2009-02-02       Impact factor: 22.113

9.  miR-196 is an essential early-stage regulator of tail regeneration, upstream of key spinal cord patterning events.

Authors:  Tina Sehm; Christoph Sachse; Corina Frenzel; Karen Echeverri
Journal:  Dev Biol       Date:  2009-08-13       Impact factor: 3.582

10.  miR-375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression.

Authors:  Zhi-Yong Shen; Zi-Zhen Zhang; Hua Liu; En-Hao Zhao; Hui Cao
Journal:  Exp Ther Med       Date:  2014-03-20       Impact factor: 2.447

View more
  12 in total

1.  Anticancer effect of resibufogenin on gastric carcinoma cells through the phosphoinositide 3-kinase/protein kinase B/glycogen synthase kinase 3β signaling pathway.

Authors:  Zhen Lu; Aman Xu; Xiao Yuan; Kaiwei Chen; Likun Wang; Tao Guo
Journal:  Oncol Lett       Date:  2018-06-18       Impact factor: 2.967

Review 2.  Aberrant DNA methylation in melanoma: biomarker and therapeutic opportunities.

Authors:  Goran Micevic; Nicholas Theodosakis; Marcus Bosenberg
Journal:  Clin Epigenetics       Date:  2017-04-04       Impact factor: 6.551

3.  The diagnostic effect of serum miR-196b as biomarker in colorectal cancer.

Authors:  Chunjie Xu; Lei Gu
Journal:  Biomed Rep       Date:  2016-11-18

4.  Silencing of LncRNA PVT1 inhibits the proliferation, migration and fibrosis of high glucose-induced mouse mesangial cells via targeting microRNA-93-5p.

Authors:  Jianzhou Li; Qing Zhao; Xiaohong Jin; Yanhua Li; Jian Song
Journal:  Biosci Rep       Date:  2020-05-29       Impact factor: 3.840

5.  PRL-3 promotes the peritoneal metastasis of gastric cancer through the PI3K/Akt signaling pathway by regulating PTEN.

Authors:  Jianbo Xiong; Zhengrong Li; Yang Zhang; Daojiang Li; Guoyang Zhang; Xianshi Luo; Zhigang Jie; Yi Liu; Yi Cao; Zhibiao Le; Shengxing Tan; Wenyu Zou; Peitao Gong; Lingyu Qiu; Yuanyuan Li; Huan Wang; Heping Chen
Journal:  Oncol Rep       Date:  2016-08-23       Impact factor: 3.906

6.  Identification of microRNAs with Dysregulated Expression in Status Epilepticus Induced Epileptogenesis.

Authors:  Mykaella Andrade de Araújo; Thalita Ewellyn Batista Sales Marques; Shirley Octacílio-Silva; Carmem Lúcia de Arroxelas-Silva; Marília Gabriella Alves Goulart Pereira; José Eduardo Peixoto-Santos; Ludmyla Kandratavicius; João Pereira Leite; Norberto Garcia-Cairasco; Olagide Wagner Castro; Marcelo Duzzioni; Geraldo Aleixo Passos; Maria Luisa Paçó-Larson; Daniel Leite Góes Gitaí
Journal:  PLoS One       Date:  2016-10-03       Impact factor: 3.240

7.  MicroRNA-196b inhibits late apoptosis of pancreatic cancer cells by targeting CADM1.

Authors:  Hong-Ling Wang; Rui Zhou; Jing Liu; Ying Chang; Shi Liu; Xiao-Bing Wang; Mei-Fang Huang; Qiu Zhao
Journal:  Sci Rep       Date:  2017-09-13       Impact factor: 4.379

8.  Gastrin inhibits gastric cancer progression through activating the ERK-P65-miR23a/27a/24 axis.

Authors:  Li-Dong Zu; Xing-Chun Peng; Zhi Zeng; Jing-Long Wang; Li-Li Meng; Wei-Wei Shen; Chun-Ting Hu; Ye Yang; Guo-Hui Fu
Journal:  J Exp Clin Cancer Res       Date:  2018-06-04

9.  MicroRNA-focused CRISPR-Cas9 library screen reveals fitness-associated miRNAs.

Authors:  Jessica S Kurata; Ren-Jang Lin
Journal:  RNA       Date:  2018-05-02       Impact factor: 4.942

Review 10.  Role of PI3K/AKT pathway in cancer: the framework of malignant behavior.

Authors:  Ningni Jiang; Qijie Dai; Xiaorui Su; Jianjiang Fu; Xuancheng Feng; Juan Peng
Journal:  Mol Biol Rep       Date:  2020-04-24       Impact factor: 2.742

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.