Serotonin (5-HT) modulates both neural and immune responses in vertebrates, but its role in insect immunity remains uncertain. We report that hemocytes in the caterpillar, Pieris rapae are able to synthesize 5-HT following activation by lipopolysaccharide. The inhibition of a serotonin-generating enzyme with either pharmacological blockade or RNAi knock-down impaired hemocyte phagocytosis. Biochemical and functional experiments showed that naive hemocytes primarily express 5-HT1B and 5-HT2B receptors. The blockade of 5-HT1B significantly reduced phagocytic ability; however, the blockade of 5-HT2B increased hemocyte phagocytosis. The 5-HT1B-null Drosophila melanogaster mutants showed higher mortality than controls when infected with bacteria, due to their decreased phagocytotic ability. Flies expressing 5-HT1B or 5-HT2B RNAi in hemocytes also showed similar sensitivity to infection. Combined, these data demonstrate that 5-HT mediates hemocyte phagocytosis through 5-HT1B and 5-HT2B receptors and serotonergic signaling performs critical modulatory functions in immune systems of animals separated by 500 million years of evolution.
Serotonin (5-HT) modulates both neural and immune responses in vertebrates, but its role in insect immunity remains uncertain. We report that hemocytes in the caterpillar, Pieris rapae are able to synthesize 5-HT following activation by lipopolysaccharide. The inhibition of a serotonin-generating enzyme with either pharmacological blockade or RNAi knock-down impaired hemocyte phagocytosis. Biochemical and functional experiments showed that naive hemocytes primarily express 5-HT1B and 5-HT2B receptors. The blockade of 5-HT1B significantly reduced phagocytic ability; however, the blockade of 5-HT2B increased hemocyte phagocytosis. The 5-HT1B-null Drosophila melanogaster mutants showed higher mortality than controls when infected with bacteria, due to their decreased phagocytotic ability. Flies expressing 5-HT1B or 5-HT2B RNAi in hemocytes also showed similar sensitivity to infection. Combined, these data demonstrate that 5-HT mediates hemocyte phagocytosis through 5-HT1B and 5-HT2B receptors and serotonergic signaling performs critical modulatory functions in immune systems of animals separated by 500 million years of evolution.
Serotonin (5-hydroxytryptamine, 5-HT) is one of the oldest neurotransmitters/hormones in evolution (Turlejski, 1996). It regulates or modulates a wide variety of processes in most invertebrates and vertebrates, such as metabolism (Sze et al., 2000) and locomotion (Ranganathan et al., 2000) in nematodes; reproduction (Anstey et al., 2009), learning and memory (Sitaraman et al., 2008) in insects; physiologic states and behaviors, including pain, appetite, mood, and sleep (Mössner and Lesch, 1998) in humans. 5-HT also plays an important role outside of the central nervous system (CNS) in immune signaling. Immune cells can synthesize and sequester 5-HT. For instance, human mast cells express the key peripheral 5-HT synthesizing enzyme, tryptophan hydroxylase 1 (TPH-1) (Kushnir-Sukhov et al., 2007, 2008). Mouse dendritic cells (DCs) express the serotonin transporter (SERT), taking up 5-HT from the microenvironment (O'Connell et al., 2006). 5-HT regulates immune responses and inflammatory cascades via distinct receptors and different immune cells have been shown to express a different composition of 5-HT receptor subtypes (Baganz and Blakely, 2013). 5-HT2A may contribute to chemotaxis of eosinophils (Boehme et al., 2008) and 5-HT2C receptors on alveolar macrophages can be activated by 5-HT (Mikulski et al., 2010). However, most studies assess the in vitro response of immune cells to pharmacological agents. Therefore, the function of 5-HT signaling in vivo in are still unclear.Vertebrate blood cells (e.g. macrophages) have evolved a variety of strategies to internalize particles and solutes, including pinocytosis, receptor-mediated endocytosis, and phagocytosis, a highly conserved aspect of innate immunity. Phagocytosis, the uptake of large particles (>0.5 μm) into cells, allows for rapid engulfment of dying cells and pathogens by specialized phagocytes, such as macrophages and neutrophils in mammals (Aderem and Underhill, 1999). In insects, hemocyte phagocytosis is an important cellular defense response to pathogens and parasites (Lavine and Strand, 2002). In lepidopteran insects, the granulocytes and plasmatocytes are the major phagocytes (Kanost et al., 2004). Cross-talk between the immune and nervous system may play a role in regulating phagocytosis in insects during infection. However, the roles of serotonin in insect phagocytosis are less well characterized compared with vertebrate counterparts, although there is evidence that 5-HT can enhance phagocytosis (Baines et al., 1992; Kim et al.,2009).Many of the intracellular signaling pathways that drive the insect immune system are very similar to those found in the mammalian innate immune system (Lemaitre and Hoffmann, 2007), and some of them were first uncovered in insects (Hoffmann, 2003). Indirect evidence suggests that similarities between insects and mammals extend to the molecular mechanisms involved in the neuroendocrine control of immune function (Adamo, 2008). Because of the relative simplicity of the insect immune system, examining the basic interactions between serotonin receptor-medicated second messenger systems and immune-related intracellular signaling pathways may be easier in insects. As an initial step toward this goal, we have made a comprehensive study in the caterpillar, Pieris rapae hemocytes to elucidate the function of 5-HT signaling in insect cellular immune responses. We found that hemocyte-derived 5-HT regulates phagocytosis in an autocrine manner through 5-HT1B and 5-HT2B receptors, each of which produces distinct effects. Mortality experiments using Drosophila mutants and hemocyte-specific RNAi-silencing further found that both 5-HT1B and 5-HT2B are necessary for effective resistance to bacterial infections.
Results
Hemocytes synthesize 5-HT in an activation-dependent manner
After activation with 100 ng/ml of lipopolysaccharide (LPS) for 2 hr, we detected 5-HT within hemocytes directly by immunolabeling and fluorescence microscopy. Figure 1A shows that granules of 5-HT labeled with 5-HT antisera (upper) are readily visible in the cytosol. As a negative control, 5-HT antisera preabsorbed with 5-HT were invisible (lower). Serotonin synthesis requires two enzymes, tryptophan hydroxylase and aromatic L-amino acid decarboxylase (AADC) (Figure 1B). Tryptophan hydroxylase is the rate-limiting enzyme in serotonin biosynthesis encoded by two genes, TPH and TRH in insects, TPH1 and TPH2 in mammals. Both gene products have tryptophan hydroxylase activity in vivo. The TPH/TPH1 gene is expressed in non-neural tissues, and the TRH/TPH2 gene is expressed in neural tissues (Côté et al., 2003; Neckameyer et al., 2007; Watanabe et al., 2011). The high-affinity SERT is a plasma membrane protein that can take up extracellular 5-HT (Rudnick, 2006; Torres et al., 2003). Thus, we performed RT-PCR to characterize TPH, TRH, and SERT expression in hemocytes. Figure 1C shows that hemocytes produced mRNA for TPH, but that transcripts of TRH and SERT were not detected. These results suggest that hemocytes do not selectively sequester 5-HT but can synthesize 5-HT using TPH. Then, we performed ELISA to quantify the amount of 5-HT released into the hemocytes’ culture media. 5-HT levels increased significantly above that found in controls in cell supernatants 1 hr after exposure of hemocytes to LPS. 5-HT levels reached maximal at 2 hr and decreased at 4 hr (Figure 1D). The real-time quantitative RT-PCR results also show that mRNA expression level of TPH was up-regulated by approximately sixfold relative to controls at 15 min and at 4 hr after LPS stimulation, suggesting a potential negative feedback regulation (Figure 1E). Therefore, it is concluded that hemocytes are able to synthesize and release 5-HT in vitro, and this activity is enhanced following their activation. We hypothesise that 5-HT may play an important role in hemocyte function.
Figure 1.
Activated hemocytes are capable of 5-HT synthesis.
(A) 5-HT was visualized by confocal microscopy in hemocytes activated with 100 ng/ml LPS by labeling with 5-HT antisera (Alexa Fluor 546; red) (upper left). 5-HT antisera was preabsorbed with 5-HT as the negative control (lower left). Nuclei were counterstained with DAPI (blue). Scale bar represents 10 μM. Data are representatives of two independent experiments. (B) Serotonin biosynthetic pathway. Tryptophan- phenylalanine hydroxylase (TRH/TPH), aromatic L-amino acid decarboxylase (AADC), 5-hydroxy tryptophan (5-HTP). (C) Expression of gene transcripts for TPH, TRH, and SERT were determined by RT-PCR from naive hemocytes and from hemocytes activated with 100 ng/ml LPS for 2 hr, central nervous system (CNS) as positive control. Data are representatives of three independent experiments. (D) 5-HT concentrations in hemocytes supernatants were determined by ELISA. Hemocytes were activated with 100 ng/ml LPS. Naive hemocytes treated with PBS are as control (n = 4). (E) Relative expression of TPH was quantified by real-time PCR. Hemocytes were activated with 100 ng/ml LPS. Naive hemocytes treated with PBS is as control (n = 3). One-way ANOVA followed by Tukey’s multiple comparison test for and . Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05 and NS means no significant difference.
DOI:
http://dx.doi.org/10.7554/eLife.12241.003
Activated hemocytes are capable of 5-HT synthesis.
(A) 5-HT was visualized by confocal microscopy in hemocytes activated with 100 ng/ml LPS by labeling with 5-HT antisera (Alexa Fluor 546; red) (upper left). 5-HT antisera was preabsorbed with 5-HT as the negative control (lower left). Nuclei were counterstained with DAPI (blue). Scale bar represents 10 μM. Data are representatives of two independent experiments. (B) Serotonin biosynthetic pathway. Tryptophan- phenylalanine hydroxylase (TRH/TPH), aromatic L-amino acid decarboxylase (AADC), 5-hydroxy tryptophan (5-HTP). (C) Expression of gene transcripts for TPH, TRH, and SERT were determined by RT-PCR from naive hemocytes and from hemocytes activated with 100 ng/ml LPS for 2 hr, central nervous system (CNS) as positive control. Data are representatives of three independent experiments. (D) 5-HT concentrations in hemocytes supernatants were determined by ELISA. Hemocytes were activated with 100 ng/ml LPS. Naive hemocytes treated with PBS are as control (n = 4). (E) Relative expression of TPH was quantified by real-time PCR. Hemocytes were activated with 100 ng/ml LPS. Naive hemocytes treated with PBS is as control (n = 3). One-way ANOVA followed by Tukey’s multiple comparison test for and . Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05 and NS means no significant difference.DOI:
http://dx.doi.org/10.7554/eLife.12241.003
5-HT is involved in hemocyte phagocytosis
To examine the physiological role of 5-HT in hemocytes, we tested whether inhibition of 5-HT synthesis would affect hemocyte phagocytosis of Gram-negative E. coli bacteria labeled with pHrodo, a dye that fluoresces in the acidic environment of a mature phagosome upon fusion with lysosomes. α-methyltryptophan (AMTP) is a competitive inhibitor of 5-HT synthesis (Gal and Christiansen, 1975). As shown in Figure 2—figure supplement 1, 5-HT synthesis was significantly reduced in hemocytes after treatment with 10 μM AMTP, compared with PBS-treated controls. The results show that 10 μM AMTP also significantly impaired hemocyte phagocytic ability. Furthermore, treatment with exogenous 5-HT at 100 nM fully restored hemocyte phagocytosis (Figure 2A–D). Next, we tested siTPH-treated hemocytes (knock-down effect was approximately 80%, Figure 2E) for their phagocytosis ability. After incubation with siTPH for 48 hr, hemocyte phagocytosis rate was significantly decreased compared with the negative control. 100 nM 5-HT treatment could fully rescue the siTPH induced phenotype (Figure 2F–I). Collectively, these data indicate that hemocyte-derived 5-HT is critical for proper hemocyte phagocytosis upon immune challenge.
Figure 2—figure supplement 1.
Inhibition of 5-HT synthesis by AMTP.
Both PBS treated hemocytes (control) and 10 μM AMTP-treated hemocytes were incubated with 100 ng/ml LPS for 2 hr. Error bars indicate ± s.e.m., n = 3, the statistical analysis is based on two-tailed t-test, ***p<0.001.
DOI:
http://dx.doi.org/10.7554/eLife.12241.005
Figure 2.
Inhibition of endogenous 5-HT synthesis impairs hemocyte phagocytosis.
() Hemocyte phagocytosis was visualized by florescence microscope. Hemocytes were stained with Cell Tracker Blue CMAC (blue), green represent the phagocytosed pHrodo E. coli. (D) Quantification of phagocytosis of E. coli by hemocytes (n = 3). (E) Confirmation of knock-down effect of TPH by real-time qPCR. The P. rapae18s rRNA gene was used as an internal reference gene (n = 4). () Effect of siTPH on hemocyte phagocytosis was visualized by florescence microscope. (I) Quantification of siTPH effect on hemocyte phagocytosis (n = 3). One-way ANOVA followed by Tukey’s multiple comparison test for and ; two-tailed t-test for . Error bars indicate ± s.e.m., ***p<0.001, **p<0.01 and NS means no significant difference.
DOI:
http://dx.doi.org/10.7554/eLife.12241.004
Both PBS treated hemocytes (control) and 10 μM AMTP-treated hemocytes were incubated with 100 ng/ml LPS for 2 hr. Error bars indicate ± s.e.m., n = 3, the statistical analysis is based on two-tailed t-test, ***p<0.001.
DOI:
http://dx.doi.org/10.7554/eLife.12241.005
Inhibition of endogenous 5-HT synthesis impairs hemocyte phagocytosis.
() Hemocyte phagocytosis was visualized by florescence microscope. Hemocytes were stained with Cell Tracker Blue CMAC (blue), green represent the phagocytosed pHrodo E. coli. (D) Quantification of phagocytosis of E. coli by hemocytes (n = 3). (E) Confirmation of knock-down effect of TPH by real-time qPCR. The P. rapae18s rRNA gene was used as an internal reference gene (n = 4). () Effect of siTPH on hemocyte phagocytosis was visualized by florescence microscope. (I) Quantification of siTPH effect on hemocyte phagocytosis (n = 3). One-way ANOVA followed by Tukey’s multiple comparison test for and ; two-tailed t-test for . Error bars indicate ± s.e.m., ***p<0.001, **p<0.01 and NS means no significant difference.DOI:
http://dx.doi.org/10.7554/eLife.12241.004
Inhibition of 5-HT synthesis by AMTP.
Both PBS treated hemocytes (control) and 10 μM AMTP-treated hemocytes were incubated with 100 ng/ml LPS for 2 hr. Error bars indicate ± s.e.m., n = 3, the statistical analysis is based on two-tailed t-test, ***p<0.001.DOI:
http://dx.doi.org/10.7554/eLife.12241.005
5-HT regulates hemocyte phagocytosis via Pr5-HT1B and Pr5-HT2B
Since 5-HT is involved in the regulation of hemocyte function, it should exert its effects through corresponding 5-HT receptors. So far, five subtypes of 5-HT receptors including 5-HT1A, 5-HT1B, 5-HT2A, 5-HT2B and 5-HT7 are identified in insects (Blenau and Thamm, 2011; Gasque et al., 2013). 5-HT1A and 5-HT1B couple with Gi protein and decrease intracellular cAMP levels. 5-HT2A and 5-HT2B couple with Gq protein, which can induce increased intracellular Ca2+. 5-HT7 couples with Gs protein and increases cAMP levels (Blenau and Thamm, 2011; Gasque et al., 2013). We performed a comprehensive analysis of 5-HT receptor gene expression in hemocytes by RT-PCR after stimulation with 100 ng/ml LPS for 2 hr. The positive control samples were extracted from the CNS of P. rapae. As shown in Figure 3A, naive hemocytes express Pr5-HT and Pr5-HT. We used specific antibodies to confirm the expression of Pr5-HT1B (Figure 3B) and Pr5-HT2B (Figure 3C) on the plasma membranes of hemocytes. We also performed Ca2+ imaging to further confirm functional expression of 5-HT2B in hemocytes. Both plasmatocytes and granulocytes, the two most abundant types of hemocytes, produced intracellular Ca2+ increase in response to 5-HT. 5-HT stimulated Ca2+ responses at concentrations ranging from 0.01 nM to 10 nM (maximal response), and its EC50 value was estimated at 0.15 nM (Figure 3—figure supplement 1).
Figure 3.
5-HT receptor subtypes expressed in naïve and LPS-activated hemocytes.
(A) Hemocytes were negatively purified and activated with 100 ng/ml LPS for 2 hr. The gene expression for 5-HTR subtype was examined by RT-PCR. Data are representatives of three independent experiments. (B) Gene expression for Pr5-HT was examined by immunofluorescence. The scale bar represents 10 μM. Data are representatives of two independent experiments. (C) Gene expression for Pr5-HT was examined by immunofluorescence. PL, plasmatocytes; GR, granulocytes. Data are representatives of two independent experiments. (D-G) The effect of different antagonist on hemocyte phagocytosis was visualized by florescence microscope. SB216641 is an antagonist of 5-HT1B. SB269970 is an antagonist of 5-HT7 and RS127445 is a human 5-HT2B antagonist. (H) Quantification of different antagonist on hemocyte phagocytosis. Data are from three independent experiments that each consists of cells from ten fifth-instar larvae. One-way ANOVA followed by Tukey’s multiple comparison test for H. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01 and NS means no significant difference.
DOI:
http://dx.doi.org/10.7554/eLife.12241.006
(A) Pseudocolored images of hemocytes before and after application of 1 nM 5-HT. Red cells indicate high levels of intracellular Ca2+ measured by fluorescent ratio intensities, and blue cells represent the basal levels. Two major kinds of hemocytes, plasmatocytes and granulocytes, are indicated by arrows. (B) Increasing concentrations of 5-HT dose-dependently induced changes in the fluorescence ratio of hemocytes. (C) Dose-response curve for 5-HT in hemocytes, as obtained from Ca2+ imaging. Each point represents the mean ± s.e.m. from three to five replicates.
DOI:
http://dx.doi.org/10.7554/eLife.12241.007
To characterize the pharmacological properties of Pr5-HT1B and Pr5-HT7, We use HEK 293 cell line to stably express Pr5-HT1B and Pr5-HT7. (A) Dose-response relationships of the effects of 5-HT on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT1B (n = 3). (B) Effects of 5-HT and the antagonist SB 216641 on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT1B (n = 3). (C) Dose-response relationships of the effects of 5-HT on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT7 (n = 3). (D) Effects of 5-HT and the antagonist SB 269970 on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT7 (n = 3). One-way ANOVA followed by Tukey’s multiple comparison test for A and B. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, and NS means no significant difference.
DOI:
http://dx.doi.org/10.7554/eLife.12241.008
Figure 3—figure supplement 1.
Representative Ca2+ responses and dose-response profiles for 5-HT in hemocytes.
(A) Pseudocolored images of hemocytes before and after application of 1 nM 5-HT. Red cells indicate high levels of intracellular Ca2+ measured by fluorescent ratio intensities, and blue cells represent the basal levels. Two major kinds of hemocytes, plasmatocytes and granulocytes, are indicated by arrows. (B) Increasing concentrations of 5-HT dose-dependently induced changes in the fluorescence ratio of hemocytes. (C) Dose-response curve for 5-HT in hemocytes, as obtained from Ca2+ imaging. Each point represents the mean ± s.e.m. from three to five replicates.
DOI:
http://dx.doi.org/10.7554/eLife.12241.007
5-HT receptor subtypes expressed in naïve and LPS-activated hemocytes.
(A) Hemocytes were negatively purified and activated with 100 ng/ml LPS for 2 hr. The gene expression for 5-HTR subtype was examined by RT-PCR. Data are representatives of three independent experiments. (B) Gene expression for Pr5-HT was examined by immunofluorescence. The scale bar represents 10 μM. Data are representatives of two independent experiments. (C) Gene expression for Pr5-HT was examined by immunofluorescence. PL, plasmatocytes; GR, granulocytes. Data are representatives of two independent experiments. (D-G) The effect of different antagonist on hemocyte phagocytosis was visualized by florescence microscope. SB216641 is an antagonist of 5-HT1B. SB269970 is an antagonist of 5-HT7 and RS127445 is a human5-HT2B antagonist. (H) Quantification of different antagonist on hemocyte phagocytosis. Data are from three independent experiments that each consists of cells from ten fifth-instar larvae. One-way ANOVA followed by Tukey’s multiple comparison test for H. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01 and NS means no significant difference.DOI:
http://dx.doi.org/10.7554/eLife.12241.006
Representative Ca2+ responses and dose-response profiles for 5-HT in hemocytes.
(A) Pseudocolored images of hemocytes before and after application of 1 nM 5-HT. Red cells indicate high levels of intracellular Ca2+ measured by fluorescent ratio intensities, and blue cells represent the basal levels. Two major kinds of hemocytes, plasmatocytes and granulocytes, are indicated by arrows. (B) Increasing concentrations of 5-HT dose-dependently induced changes in the fluorescence ratio of hemocytes. (C) Dose-response curve for 5-HT in hemocytes, as obtained from Ca2+ imaging. Each point represents the mean ± s.e.m. from three to five replicates.DOI:
http://dx.doi.org/10.7554/eLife.12241.007
Modulation of intracellular cAMP levels in HEK 293 cells stably expressing the Pr5-HT1B and Pr5-HT2B.
To characterize the pharmacological properties of Pr5-HT1B and Pr5-HT7, We use HEK 293 cell line to stably express Pr5-HT1B and Pr5-HT7. (A) Dose-response relationships of the effects of 5-HT on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT1B (n = 3). (B) Effects of 5-HT and the antagonist SB 216641 on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT1B (n = 3). (C) Dose-response relationships of the effects of 5-HT on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT7 (n = 3). (D) Effects of 5-HT and the antagonist SB 269970 on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT7 (n = 3). One-way ANOVA followed by Tukey’s multiple comparison test for A and B. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, and NS means no significant difference.DOI:
http://dx.doi.org/10.7554/eLife.12241.008Since there are multiple 5-HT receptor types on the hemocyte membranes, we next investigated which one was involved in the 5-HT-mediated phagocytosis by pharmacological manipulation. Three selective 5-HT receptor antagonists (SB 216641, SB 269970, and RS 127445) were applied at a final concentration of 10 μM to block their corresponding receptors. The inhibition effects of SB 216641 and SB 269970 on Pr5-HT1B and Pr5-HT7 were also confirmed by cAMP assays in heterogeneous expression system (Figure 3—figure supplement 2). We found that only blockade of Pr5-HT1B significantly reduced the phagocytic ability of hemocytes. Blockade of Pr5-HT7 neither intensified nor reduced hemocyte phagocytosis. Surprisingly, blockade of 5-HT2B significantly increased hemocyte phagocytosis (Figure 3D–H).
Figure 3—figure supplement 2.
Modulation of intracellular cAMP levels in HEK 293 cells stably expressing the Pr5-HT1B and Pr5-HT2B.
To characterize the pharmacological properties of Pr5-HT1B and Pr5-HT7, We use HEK 293 cell line to stably express Pr5-HT1B and Pr5-HT7. (A) Dose-response relationships of the effects of 5-HT on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT1B (n = 3). (B) Effects of 5-HT and the antagonist SB 216641 on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT1B (n = 3). (C) Dose-response relationships of the effects of 5-HT on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT7 (n = 3). (D) Effects of 5-HT and the antagonist SB 269970 on intracellular cAMP levels in HEK 293 cells stably transfected with pcDNA3/Pr5-HT7 (n = 3). One-way ANOVA followed by Tukey’s multiple comparison test for A and B. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, and NS means no significant difference.
DOI:
http://dx.doi.org/10.7554/eLife.12241.008
We further found that the 5-HT1B blocker SB 216641 affected hemocyte phagocytosis in a dose-dependent manner (Figure 4A). To confirm the above results, we performed siRNA-mediated interference to knock-down each receptor in hemocytes. The results showed that siPr5-HTdecreased Pr5-HT1B expression significantly at both mRNA and protein levels (Figures 4B–C) after 24 hr and 48 hr, respectively. As expected, the siPr5-HT treated hemocytes phagocytose E. coli poorly compared with control (Figure 4D–F). Significantly knock-down of Pr5-HT was also observed at both transcript and protein levels (Figure 4—figure supplement 1A–B) at 48 hr, which promoted hemocyte phagocytosis (Figure 4—figure supplement 1C–E). However, knock-down of Pr5-HThave no significant effect on hemocyte phagocytosis (Figure 4—figure supplement 1F–G). The results demonstrate that 5-HT mediates hemocyte phagocytosis through 5-HT1B and 5-HT2B receptors but that these two receptors act in opposite ways.
Figure 4.
Pr5-HT1B mediates hemocyte phagocytosis.
(A) Dose-response profiles for the effects of Pr5-HT1B blocker SB 216641 on hemocyte phagocytosis. Data are from three independent experiments that each consists of cells from ten fifth-instar larvae. (B) Confirmation of knock-down effect of Pr5-HT by real-time PCR. The P. rapae 18s rRNA gene was used as an internal reference gene (n = 4). (C) Western blot analysis of knock-down effect of Pr5-HT1B. β-actin was used to show equal protein loading. (D-E) Effect of siPr5-HT on hemocyte phagocytosis was visualized by florescence microscope. (F) Quantification of siPr5-HT effect on hemocyte phagocytosis. Data are from three independent experiments that each consists of cells from ten fifth-instar larvae. One-way ANOVA followed by Tukey’s multiple comparison test for A; two-tailed t-test for B and F. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01.
DOI:
http://dx.doi.org/10.7554/eLife.12241.009
(A) Confirmation of knock-down effect of Pr5-HT by real-time PCR. The P. rapae 18s rRNA gene was used as an internal reference gene (n = 3). (B) Western blot analysis of knock-down effect of Pr5-HT2B. β-actin was used to show equal protein loading. (C-D) Effect of siPr5-HT on hemocyte phagocytosis was visualized by florescence microscope. (E) Quantification of siPr5-HT effect on hemocyte phagocytosis (n = 3). (F) Confirmation of knock-down effect of Pr5-HT by real-time PCR. The P. rapae 18s rRNA gene was used as an internal reference gene (n= 3). (G) Quantification of siPr5-HT effect on hemocyte phagocytosis (n = 3). Two-tailed t-test for and . Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05, and NS means no significant difference.
DOI:
http://dx.doi.org/10.7554/eLife.12241.010
Figure 4—figure supplement 1.
Effect of siPr5-HT and siPr5-HT on hemocyte phagocytosis.
(A) Confirmation of knock-down effect of Pr5-HT by real-time PCR. The P. rapae 18s rRNA gene was used as an internal reference gene (n = 3). (B) Western blot analysis of knock-down effect of Pr5-HT2B. β-actin was used to show equal protein loading. (C-D) Effect of siPr5-HT on hemocyte phagocytosis was visualized by florescence microscope. (E) Quantification of siPr5-HT effect on hemocyte phagocytosis (n = 3). (F) Confirmation of knock-down effect of Pr5-HT by real-time PCR. The P. rapae 18s rRNA gene was used as an internal reference gene (n= 3). (G) Quantification of siPr5-HT effect on hemocyte phagocytosis (n = 3). Two-tailed t-test for and . Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05, and NS means no significant difference.
DOI:
http://dx.doi.org/10.7554/eLife.12241.010
Pr5-HT1B mediates hemocyte phagocytosis.
(A) Dose-response profiles for the effects of Pr5-HT1B blocker SB 216641 on hemocyte phagocytosis. Data are from three independent experiments that each consists of cells from ten fifth-instar larvae. (B) Confirmation of knock-down effect of Pr5-HT by real-time PCR. The P. rapae 18s rRNA gene was used as an internal reference gene (n = 4). (C) Western blot analysis of knock-down effect of Pr5-HT1B. β-actin was used to show equal protein loading. (D-E) Effect of siPr5-HT on hemocyte phagocytosis was visualized by florescence microscope. (F) Quantification of siPr5-HT effect on hemocyte phagocytosis. Data are from three independent experiments that each consists of cells from ten fifth-instar larvae. One-way ANOVA followed by Tukey’s multiple comparison test for A; two-tailed t-test for B and F. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01.DOI:
http://dx.doi.org/10.7554/eLife.12241.009
Effect of siPr5-HT and siPr5-HT on hemocyte phagocytosis.
(A) Confirmation of knock-down effect of Pr5-HT by real-time PCR. The P. rapae 18s rRNA gene was used as an internal reference gene (n = 3). (B) Western blot analysis of knock-down effect of Pr5-HT2B. β-actin was used to show equal protein loading. (C-D) Effect of siPr5-HT on hemocyte phagocytosis was visualized by florescence microscope. (E) Quantification of siPr5-HT effect on hemocyte phagocytosis (n = 3). (F) Confirmation of knock-down effect of Pr5-HT by real-time PCR. The P. rapae 18s rRNA gene was used as an internal reference gene (n= 3). (G) Quantification of siPr5-HT effect on hemocyte phagocytosis (n = 3). Two-tailed t-test for and . Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05, and NS means no significant difference.DOI:
http://dx.doi.org/10.7554/eLife.12241.010
Effect of immune challenge on Pr5-HT1B and Pr5-HT2B expression
Although the above data showed that activation of Pr5-HT1B and Pr5-HT2B produced opposite effects, enhanced hemocyte phagocytosis is the overall effect by hemocytes exposed to released 5-HT. Thus, we tested whether 5-HT receptors were upregulated or downregulated in hemocytes during an immune response. qPCR results showed that the mRNA levels of Pr5-HT was significantly increased after LPS stimulation from 15 min to 4 hr (Figure 5A). The protein expression levels also increased at 2 hr and 4 hr (Figure 5C). Interestingly, the mRNA expression level of Pr5-HT was significantly decreased after LPS induction at 1 hr and 4 hr (Figure 5B), in accordance with its protein expression levels (Figure 5D).
Figure 5.
Expression analysis of Pr5-HT1B and Pr5-HT2B in naïve and LPS-induced hemocytes.
(A–B) Relative expression of Pr5-HT and Pr5-HT were quantified by q-PCR. The P. rapae 18s rRNA gene was used as an internal reference (n = 3). (C–D) Western blot analysis of Pr5-HT1B and Pr5-HT2B in naive and LPS-induced hemocytes. β-actin was used to show equal protein loading. One-way ANOVA followed by Tukey’s multiple comparison test for A and B. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05, and NS means no significant difference.
DOI:
http://dx.doi.org/10.7554/eLife.12241.011
Expression analysis of Pr5-HT1B and Pr5-HT2B in naïve and LPS-induced hemocytes.
(A–B) Relative expression of Pr5-HT and Pr5-HT were quantified by q-PCR. The P. rapae 18s rRNA gene was used as an internal reference (n = 3). (C–D) Western blot analysis of Pr5-HT1B and Pr5-HT2B in naive and LPS-induced hemocytes. β-actin was used to show equal protein loading. One-way ANOVA followed by Tukey’s multiple comparison test for A and B. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05, and NS means no significant difference.DOI:
http://dx.doi.org/10.7554/eLife.12241.011
5-HT1B and 5-HT2B are required for proper bacteria phagocytosis and resistance in Drosophila
We hypothesized that 5-HT receptors mediate immunoregulation in other insects and that it is important in host defense in vivo. On the other hand, it is a technical challenge to perform in vivo RNAi in Lepidoptera (Terenius et al., 2011). Thus, we chose the model animal Drosophila melanogaster to address the above questions. Both 5-HT and 5-HT transcripts were detected in wild-type Drosophila hemocytes by RT-PCR. High mRNA levels of Henna, the DrosophilaTPH homolog, were also expressed in hemocytes (Figure 6A). We next used a 5-HT null allele (5-HT) and its corresponding control allele (Gasque et al., 2013) to examine the ability to phagocytose bacteria as well as susceptibility to infections. A 1344 bp fragment is removed from genomic DNA to disrupt the III-V transmembrane domains of the 5-HT allele (Figure 6B).
Figure 6.
5-HT1B is required for microbial phagocytosis and plays an important role in the Drosophila defense against S. aureus infection.
(A) 5-HT and TPH are expressed in Drosophila naive hemocytes. RPL11 was used as an internal reference gene. Data are representatives of three independent experiments. (B) Genomic PCR of 5-HT1B control and 5-HT flies. Data are representatives of three independent experiments. (C) Representative pictures depicting phagocytosis in 5-HT1B control and 5-HTflies of fluorescein-labeled E. coli bioparticles. (D) Quantification of in vivo phagocytosis of E. coli. Approximately 10 flies per genotype were used in each experiment. Data are representatives of three independent experiments. (E) Representative pictures depicting phagocytosis in 5-HT1B control and 5-HT flies of fluorescein-labeled S. aureus bioparticles. (F) Quantification of in vivo phagocytosis of S. aureus. Approximately eight flies per genotype were used in each experiment. Data are representatives of three independent experiments. (G-H) Representative survival curves of female (G) and male (H) 5-HT1B control and 5-HTflies after injection of S. aureus (optical density [OD] 0.4). n = 20–25 flies. Experiments were performed in triplicate. (I) Comparison of the S. aureus (OD 0.4) recovered in 5-HT1B control and 5-HT flies 0, 6, and 18 hr post infection. Bacterial load was measured in eight individual female flies per genotype at each time point in each experiment. Two-tailed t-test for D, F and I. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05.
DOI:
http://dx.doi.org/10.7554/eLife.12241.012
5-HT1B is required for microbial phagocytosis and plays an important role in the Drosophila defense against S. aureus infection.
(A) 5-HT and TPH are expressed in Drosophila naive hemocytes. RPL11 was used as an internal reference gene. Data are representatives of three independent experiments. (B) Genomic PCR of 5-HT1B control and 5-HT flies. Data are representatives of three independent experiments. (C) Representative pictures depicting phagocytosis in 5-HT1B control and 5-HTflies of fluorescein-labeled E. coli bioparticles. (D) Quantification of in vivo phagocytosis of E. coli. Approximately 10 flies per genotype were used in each experiment. Data are representatives of three independent experiments. (E) Representative pictures depicting phagocytosis in 5-HT1B control and 5-HT flies of fluorescein-labeled S. aureus bioparticles. (F) Quantification of in vivo phagocytosis of S. aureus. Approximately eight flies per genotype were used in each experiment. Data are representatives of three independent experiments. (G-H) Representative survival curves of female (G) and male (H) 5-HT1B control and 5-HTflies after injection of S. aureus (optical density [OD] 0.4). n = 20–25 flies. Experiments were performed in triplicate. (I) Comparison of the S. aureus (OD 0.4) recovered in 5-HT1B control and 5-HT flies 0, 6, and 18 hr post infection. Bacterial load was measured in eight individual female flies per genotype at each time point in each experiment. Two-tailed t-test for D, F and I. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05.DOI:
http://dx.doi.org/10.7554/eLife.12241.012The phagocytic capacity of flies was measured using an in vivo adult phagocytosis assay (Kocks et al., 2005). Flies were injected with fluorescently labeled pHrodo bioparticles. The amount of fluorescence in the dorsal vessel area where sessile phagocytes accumulates were visualized and quantified. In 5-HT flies, in vivo phagocytosis of E. coli was strongly impaired when compared to controls (Figure 6C–D). A similar effect was observed with the Gram-positive bacterium S. aureus (Figure 6E–F). After infection with S. aureus, 5-HTflies die more quickly than controls, for both male and female flies (Figure 6G–H). To determine whether the increased mortality of 5-HT flies following infection was due to defective resistance or decreased tolerance (Schneider and Ayres, 2008), we also assessed bacterial clearance by comparing colony-forming units (CFU) 6 hr and 18 hr after infection. There is an increased bacterial load in 5-HT null flies compared to control files (Figure 6I).5-HT1B function in the regulation of hemocyte phagocytosis was further confirmed by RNAi. We used the HmlΔ-Gal4 (Sinenko et al., 2004) driver to specifically express UAS-1B RNAi (Yuan et al. 2005) and UAS-5-HT1B RNAi25833 respectively, both of which led to decreased phagocytosis of E. coli and S. aureus (Figure 7A–D). To test whether the hemocyte-specific knockdown of 5-HT dampened phagocytosis in general, or whether there was a lack of inducibility after immune challenge, we injected flies with PBS or 5-HT and then latex beads. When flies were injected with PBS, all flies showed similar phagocytic capacity. However, when flies were injected with 5-HT, knocking down 5-HT failed to enhance latex beads phagocytosis as controls (Figure 7E). After injection with S. aureus, the flies expressing 5-HT RNAi in their blood cells were much weaker than the control flies (Figure 7F–I). Our RNAi data indicate that the increased susceptibility to bacteria in 5-HT mutants is due to 5-HT1B malfunction in hemocytes.
Figure 7.
Knockdown of 5-HT1B in hemocytes affects Drosophila phagocytosis and survival.
(A) Quantification of in vivo phagocytosis of E. coli in WT/UAS-1B RNAi, hml> UAS-1B RNAi and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice, (B) Quantification of in vivo phagocytosis of E. coli in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice. (C) Quantification of in vivo phagocytosis of S. aureus in WT/UAS-1B RNAi, hml> UAS-1B RNAi, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice, (D) Quantification of in vivo phagocytosis of S. aureus in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice. (E) Quantification of in vivo phagocytosis of red fluorescently labeled latex beads in WT/UAS-1B RNAi, hml>UAS-1B RNAi, and hml/WT flies after a 30 min preinjection of either PBS or 1μg/μl 5-HT. Approximately six flies per genotype were used in each experiment. Experiments were done twice, (F) Representative survival curves of WT/UAS-1B RNAi, hml>UAS-1B RNAi, and hml/WT male flies after injection of S. aureus. n=19–22 flies. Data are representatives of three independent experiments. Each experiment was performed in triplicate. (G) Representative survival curves of WT/UAS-5-HT, and hml/WT male flies after injection of S. aureus. n=19–21 flies. Data are representatives of two independent experiments. Each experiment was performed in triplicate. (H) Comparison of the S. aureus (OD 0.4) recovered in WT/UAS-1B RNAi, hml>UAS-1B RNAi and hml/WT flies 0, and 18 hr post infection. Bacterial load was measured in eight individual male flies per genotype at each time point in each experiment. Experiments were performed in triplicate. (I) Comparison of the S. aureus (OD 0.4) recovered in WT/UAS-5-HT, and hml/WT flies 0 and 18 hr post infection. Bacterial load was measured in eight individual male flies per genotype at each time point in each experiment. Experiments were performed in triplicate. One-way ANOVA followed by Tukey’s multiple comparison test for A, B, C, D, E, H, and I. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05.
DOI:
http://dx.doi.org/10.7554/eLife.12241.013
Knockdown of 5-HT1B in hemocytes affects Drosophila phagocytosis and survival.
(A) Quantification of in vivo phagocytosis of E. coli in WT/UAS-1B RNAi, hml> UAS-1B RNAi and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice, (B) Quantification of in vivo phagocytosis of E. coli in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice. (C) Quantification of in vivo phagocytosis of S. aureus in WT/UAS-1B RNAi, hml> UAS-1B RNAi, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice, (D) Quantification of in vivo phagocytosis of S. aureus in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice. (E) Quantification of in vivo phagocytosis of red fluorescently labeled latex beads in WT/UAS-1B RNAi, hml>UAS-1B RNAi, and hml/WT flies after a 30 min preinjection of either PBS or 1μg/μl 5-HT. Approximately six flies per genotype were used in each experiment. Experiments were done twice, (F) Representative survival curves of WT/UAS-1B RNAi, hml>UAS-1B RNAi, and hml/WT male flies after injection of S. aureus. n=19–22 flies. Data are representatives of three independent experiments. Each experiment was performed in triplicate. (G) Representative survival curves of WT/UAS-5-HT, and hml/WT male flies after injection of S. aureus. n=19–21 flies. Data are representatives of two independent experiments. Each experiment was performed in triplicate. (H) Comparison of the S. aureus (OD 0.4) recovered in WT/UAS-1B RNAi, hml>UAS-1B RNAi and hml/WT flies 0, and 18 hr post infection. Bacterial load was measured in eight individual male flies per genotype at each time point in each experiment. Experiments were performed in triplicate. (I) Comparison of the S. aureus (OD 0.4) recovered in WT/UAS-5-HT, and hml/WT flies 0 and 18 hr post infection. Bacterial load was measured in eight individual male flies per genotype at each time point in each experiment. Experiments were performed in triplicate. One-way ANOVA followed by Tukey’s multiple comparison test for A, B, C, D, E, H, and I. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05.DOI:
http://dx.doi.org/10.7554/eLife.12241.013To investigate the role of 5-HT2B in Drosophila hemocyte phagocytosis, we also knocked down 5-HT expression in blood cells by RNAi using two independent UAS-5-HT RNAi lines. Unlike the results found in P. rapae, the reduced levels of 5-HT in Drosophila hemocytes led to a defect in the phagocytosis of E. coli and S. aureus (Figure 8A–D). Moreover, the flies expressing 5-HT RNAi in their hemocytes took up significantly fewer latex beads than did control flies after 5-HT injection (Figure 8E). 5-HT2B knockdown flies had higher bacterial loads than controls (Figure 8I) and increased susceptibility to S. aureus (Figure 8E–G). Taken together, our experiments demonstrate that both 5-HT1B and 5-HT2B play important roles in host defense against bacterial infection.
Figure 8.
Knockdown of 5-HT2B in hemocytes affects Drosophila phagocytosis and survival.
(A) Quantification of in vivo phagocytosis of E. coli in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice, (B) Quantification of in vivo phagocytosis of E. coli in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice. (C) Quantification of in vivo phagocytosis of S. aureus in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice, (D) Quantification of in vivo phagocytosis of S. aureus in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice. (E) Quantification of in vivo phagocytosis of red fluorescently labeled latex beads in WT/UAS-5-HT, and hml/WT flies after a 30 min preinjection of either PBS or 1μg/μl 5-HT. Approximately six flies per genotype were used in each experiment. Experiments were done twice. (F) Representative survival curves of WT/UAS-5-HT, and hml/WT male flies after injection of S. aureus. n=20–21 flies. Data are representatives of two independent experiments. Each experiment was performed in triplicate. (G) Representative survival curves of WT/UAS-5-HT, and hml/WT male flies after injection of S. aureus. n=19–21 flies. Data are representatives of two independent experiments. Each experiment was performed in triplicate. (H) Comparison of the S. aureus (OD 0.4) recovered in WT/UAS-5-HT, and hml/WT flies 0, and 18 hr post infection. Bacterial load was measured in eight individual male flies per genotype at each time point in each experiment. Experiments were performed in triplicate. (I) Comparison of the S. aureus (OD 0.4) recovered in WT/UAS-5-HT, and hml/WT flies 0, and 18 hr post infection. Bacterial load was measured in eight individual male flies per genotype at each time point in each experiment. Experiments were performed in triplicate. One-way ANOVA followed by Tukey’s multiple comparison test for A, B, C, D, E, H, and I. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05.
DOI:
http://dx.doi.org/10.7554/eLife.12241.014
Knockdown of 5-HT2B in hemocytes affects Drosophila phagocytosis and survival.
(A) Quantification of in vivo phagocytosis of E. coli in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice, (B) Quantification of in vivo phagocytosis of E. coli in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice. (C) Quantification of in vivo phagocytosis of S. aureus in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice, (D) Quantification of in vivo phagocytosis of S. aureus in WT/UAS-5-HT, and hml/WT flies. Approximately six flies per genotype were used in each experiment. Experiments were performed twice. (E) Quantification of in vivo phagocytosis of red fluorescently labeled latex beads in WT/UAS-5-HT, and hml/WT flies after a 30 min preinjection of either PBS or 1μg/μl 5-HT. Approximately six flies per genotype were used in each experiment. Experiments were done twice. (F) Representative survival curves of WT/UAS-5-HT, and hml/WT male flies after injection of S. aureus. n=20–21 flies. Data are representatives of two independent experiments. Each experiment was performed in triplicate. (G) Representative survival curves of WT/UAS-5-HT, and hml/WT male flies after injection of S. aureus. n=19–21 flies. Data are representatives of two independent experiments. Each experiment was performed in triplicate. (H) Comparison of the S. aureus (OD 0.4) recovered in WT/UAS-5-HT, and hml/WT flies 0, and 18 hr post infection. Bacterial load was measured in eight individual male flies per genotype at each time point in each experiment. Experiments were performed in triplicate. (I) Comparison of the S. aureus (OD 0.4) recovered in WT/UAS-5-HT, and hml/WT flies 0, and 18 hr post infection. Bacterial load was measured in eight individual male flies per genotype at each time point in each experiment. Experiments were performed in triplicate. One-way ANOVA followed by Tukey’s multiple comparison test for A, B, C, D, E, H, and I. Error bars indicate ± s.e.m., ***p<0.001, **p<0.01, *p<0.05.DOI:
http://dx.doi.org/10.7554/eLife.12241.014
A schematic diagram of serotonin signaling on hemocyte phagocytosis.
LPS enhances the expression of TPH, which catalyzes tryptophan into 5-HT via 5-HTP. 5-HT, which secreted from hemocytes, activates the hemocyte-membrane receptor 5-HT1B and 5-HT2B. The immune responses of P. rapae are labeled in purple: activation of 5-HT1B promotes hemocyte phagocytosis and activation of 5-HT2B lead to opposite effects. LPS increases 5-HT1B expression but decreases that of 5-HT2B. The immune responses of Drosophila are labeled in green arrows: activation of 5-HT1B promotes hemocyte phagocytosis and activation of 5-HT2B lead to the same effects.DOI:
http://dx.doi.org/10.7554/eLife.12241.015
Discussion
Our study demonstrates the ubiquity of serotonergic receptor signaling pathway in immune function. This paper is the first to demonstrate that insect hemocytes express TPH and can synthesize 5-HT, like human macrophages (Nakamura et al., 2008). The exposure of hemocytes to LPS led to an induction of TPH expression and a release of 5-HT. Moreover, the secreted 5-HT appears to be an important autocrine stimulus. It promotes phagocytosis: inhibition of TPH either by a competitive inhibitor or siRNA silencing resulted in significantly decreased hemocyte phagocytosis.Chemicals that act as neurotransmitters in the nervous system can also modulate immune function (Meredith et al., 2005). 5-HT is one of these classical neurotransmitters that is also an important immune regulatory molecule in both insects and mammals. Recent research has made progress in determining 5-HT modulated mammalian immune responses, especially regarding the machinery to produce, store, release, and respond to 5-HT in immune cells (Ahern, 2011). 5-HT was also reported to mediate immune responses, such as hemocyte phagocytosis, nodule formation and hemocyte population in insects (Baines et al., 1992; Kim et al., 2009; Kim and Kim, 2010), but the signaling pathway is unclear. DrosophilaTPH homolog gene Henna was found to be one hit in a genome-wide RNAi screen for genes that affect phagocytosis of Candida albicans by hemocytes (Stroschein-Stevenson et al., 2006). Examining the basic interactions between serotonin receptor-medicated second messenger systems and immune-related intracellular signaling pathways in insects may shed light on their interactions and functions in mammals.Second, our findings show that naive hemocytes express 5-HT1B, 5-HT2B, and 5-HT7 receptors, but only 5-HT1B and 5-HT2B appear to have functional roles. Using selective antagonists and RNAi, we found that inhibition of 5-HT1B decreases hemocyte phagocytosis. However, inhibition of 5-HT2B enhances hemocyte phagocytosis. It seems that activation of these two receptors affects hemocytes in opposite ways. Interestingly, we found that 5-HT1B is dramatically up-regulated following hemocyte activation, but 5-HT2B is significantly down-regulated. Therefore, even though the two receptors have opposite functions upon activation, the overall effects of 5-HT signaling induced by immune challenge are favorable for hemocyte phagocytosis (Figure 7). Mammalian DCs also express 5-HT1B and 5-HT2B, via which 5-HT induces chemotaxis and in vivo migration of DCs to draining lymph nodes (Müller et al., 2009). Even though insect plasmatocytes are macrophage-like cells, 5-HT activates macrophage cells via 5-HT1A (Nakamura et al., 2008) and 5-HT2C (Mikulski et al., 2010), which are different from the receptor sub-types found in insect hemocytes. The 5-HT7 receptor plays a critical role in the immune response in the gut of mice (Kim et al., 2013). Although our results indicated that 5-HT7 receptors were not involved in insect hemocyte phagocytosis, they may be critical for other immune activities.Many neurotransmitter receptors are found on mammalian immune cells and regulate innate immune response, however, it is still unclear about their general role at the organismal level because most studies are conducted in vitro (Sternberg, 2006). However, it is relatively easy to test immunity in insects in vivo (Lemaitre and Hoffmann, 2007). We found that the 5-HT deficiency flies were more vulnerable to bacterial infections due to their poor phagocytic ability. Hemocyte-specific RNAi experiments showed similar results, indicating that the 5-HT1B-mediated hemocyte phagocytosis is important for insects to defend themselves against pathogens. Surprisingly, the flies expressing 5-HT2B RNAi in their hemocytes were more susceptible to bacterial infections, suggesting that activation of 5-HT2B may promote phagocytosis in Drosophila, different from the results in P. rapae.In conclusion, we found that insect hemocytes can synthesis and release 5-HT, which regulates phagocytosis via 5-HT1B and 5-HT2B receptors on the membrane of the hemocyte. We also used the genetic model Drosophila to further confirm the roles of 5-HT1B and 5-HT2B in vivo. These findings suggest that serotonin, an ancient signaling molecule, modifies immune function in animals across phyla. Exploring the interactions between serotonin receptor-mediated pathways and immune-related pathways may be easier to initiate in insects, which have a simpler immune system.
Materials and methods
Insects
P. rapae larvae were collected primarily from cabbage fields in the experimental farmland of Zhejiang University, Hangzhou, China and the laboratory colony of P. rapae was reared at 25 ± 1°C and 70% relative humidity under a photoperiod of 14 hr light: 10 hr dark in a greenhouse as previously described by Zhang et al. (2005).The following fly stocks were from the Bloomington Drosophila Stock Center: HmlΔ-Gal4 (30139); UAS-5-HT (27634, 25833); UAS-5-HT (25874, 60488). The 5-HT control and 5-HTflies were generous gifts from Leslie Vosshall (Gasque et al., 2013).
Reagents
Serotonin hydrochloride, forskolin, G418 disulfate salt and SB-269970 hydrochloride were obtained from Sigma-Aldrich (St Louis, MO). SB 216641 and RS 127445 were purchased from Tocris Bioscience (Bristol, UK).
Hemocytes isolation, culture and immune induction
Fifth-instar larvae of P. rapae were surface sterilized with 70% ethanol. The proleg was cut with a pair of scissors and the hemolymph was collected in Grace’s Insect Medium (1:10, v/v; Invitrogen, Carlsbad, CA). The diluted hemolymph was added to 12-well tissue culture plates (Nunc, Roskilde, Denmark) at a density of 2× 106 cells per well. Hemocytes were treated with 100 ng/ml LPS (Escherichia coli 0111:B4; Sigma Aldrich) for 15 min, 1 hr, 2 hr, and 4 hr (Ngkelo et al., 2012; Wu et al., 2015). The hemocyte culture was collected and centrifugated. The supernatants were collected for 5-HT detection. The hemocytes that adhered to the plate were harvested for RNA isolation.
5-HT detection
The hemolymph from three first day of fifth instar larvae was collected and mixed. The combined hemolymph (30 μl) was mixed with 170 μl Grace’s Insect Medium (Invitrogen) containing 50 μg/ml tetracycline and 2 μl saturated 2-phenylthiourea (PTU). The diluted hemolymph was added to each well of a 8-well chambered coverglasses (Lab-Tek, Nunc, Thermo Fisher Scientific, Rochester, USA) and hemocytes were allowed to adhere to the slide for 20 min at 27°C to form monolayers. Then, hemocytes were fixed with 4% paraformaldehyde. 5-HT was labeled with 5-HT antisera (72 hr, room temperature; S-5545; Sigma) followed by biotinylated anti- rabbit Ig (24 hr, 4°C) and SA-Alexa Fluor 546 (1 hr, room temperature; Invitrogen). For use as a negative control, 5-HT antisera was preabsorbed with 5-HT (10 mM, 24 hr, 4°C). The nuclei of hemocytes were stained with 1 μg/ml of 4′-6-diamidino-2-phenylindole (DAPI, Beyotime Biotech, Jiangsu, China) for 5 mins and hemocytes were observed by fluorescent microscope (Zeiss, Göttingen, Germany).We performed ELISA to quantify the amount of 5-HT produced in the hemocyte culture supernatants using the 5-Hydroxytryptamine (serotonin ) assay kit (Li et al., 2014) (Jiancheng, Nanjing, China).
Cloning of 5-HT receptors, TRH and TPH
Total RNA was isolated from P. rapae nerve cord with Trizol reagent (Invitrogen, Carlsbad, CA, USA). Single-strand cDNA, synthesized from the RNA using a ReverTra Ace-α- kit (Toyobo, Osaka, Japan), was used as a template for PCRs. We performed transcriptome sequencing of nerve cord of P. rapae. Through transcriptome sequencing, several putative serotonin receptors were annotated using BlastX (National Center for Biotechnology Information [NCBI], Bethesda, MD). The full length was obtained using the 5’-Full rapid-amplification of cDNA ends (RACE) Kit (Takara, Dalian, China) and 3’-Full RACE Kit (Takara, Dalian, China) (Supplementary file 1A). To amplify the complete sequence, we use the forward primer located upstream of the putative start codon initiator, and the reverse primer located downstream of the putative stop codon (Supplementary file 1A).
qPCR and RT-PCR
Total RNA was extracted from P. rapae hemocytes with high pure RNA isolation kit (Roche) in accordance with the manufacturer’s instructions. To collect RNA from larval fly blood cells, approximately 30 larvae were carefully lacerated with tweezers on their anterior end in 100 μl of nuclease-free water. The RNA quantity and quality was measured by using a Nanodrop 2000 spectrophotometer (Thermo Scientific Inc., Bremen, Germany). Reverse transcription was performed with 1 μg of RNA by using a ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan). For conventional reverse transcription- polymerase chain reaction (RT-PCR) cDNA was amplified using KOD- Plus- (Toyobo, Osaka, Japan). Real-time quantitative PCR was performed on cDNA preparations using the SsoFast Eva Green Supermix with Low Rox (Bio-Rad, Hercules, CA) and Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems by Life Technologies, Carlsbad, CA) following the manufacturer’s instructions. The quantification of transcript level of different gene was conducted according to the 2−ΔΔCT method (Livak and Schmittgen, 2001). Comparable quantities of cDNA were ensured by amplification of 18s rRNA, as a stably expressed reference gene (Wu et al., 2013) in P. rapae. The primers are listed in Supplementary file 1A.
Phagocytosis assay
Hemocyte phagocytosis assays in vitro
The assay for phagocytosis was performed according to the method described by Cuttell et al., (2008), with minor modifications. After isolation of hemocytes, they were prepared in a 96-well tissue culture plate (CoStar, Washington). Cells were incubated for 1 hr counterstained with 20 μM Cell Tracker Blue CMAC (Molecular Probes) (Life Technologies, Carlsbad, CA) and then washed in PBS. 5 μl of the drug solution were mixed with 45 μl of Grace’s medium were added into each well for 30 min. Bacterial phagocytosis assays using pHrodo E. coli (Invitrogen, Carlsbad, CA) were performed according to the manufacturer’s instructions. The proportion of cells that had phagocytosed labeled E. coli was determined under a florescence microscope (Nikon Eclipse TS100, Nikon, Japan) at 200 × in five different fields.
Fly phagocytosis assays in vivo
To assay E. coli and S. aureus phagocytosis in adults, approximately eight to ten flies with an equal distribution of females and males per genotype were injected with ~0.2 μl of 1 mg/mL pHrodo greenE. coli or pHrodo redS. aureus (Invitrogen, Carlsbad, CA) using a FemtoJet microinjection system (Eppendorf). They were then incubated for 1 hr at room temperature. Fluorescently labeled particles were visualized through the cuticle using a florescence microscope (Nikon AZ100M, Nikon, Japan). We use Image J software to quantify the results. Relative fluorescence calculated as: [fluorescence]dorsal vein area/[fluorescence]adjacent area.To assay phagocytosis of beads, flies were first injected with approximately 36.8 nl PBS or 1 μg/μl 5-HT dissolved in PBS using a Drummond Scientific Nanoject II. Flies were incubated at room temperature for 30 min and then injected with approximately 27 nl of 1.0 μm Red Fluorescent Carboxylate Modified FluoSpheres diluted 1: 2 (Invitrogen), incubated at room temperature for 10 min, injected with 36.8 nl 0.4% Trypan blue (Invitrogen), and then mounted and visualized as described above.
Hemocytes RNAi
Small interfering RNA (siRNA) molecules were designed from the nucleotide sequence obtained from P. rapae using Invitrogen siRNA design software (http://rnaidesigner.thermofisher.com/rnaiexpress/) (Supplementary file 1B) and were synthesized by Invitrogen. siRNA for the negative control was used in transfection experiments as a control. Hemocytes were isolated as described above and were attached to the surface of 96-well tissue culture plates and incubated in Grace’s medium. The monolayers of hemocytes were treated with 2.4 ng siRNA and 0.7 μl siRNA transfection reagent INTERFERin (Polyplus-transfection SA, France) according to the instructions from the manufacturer, and incubated at 27°C.
Polyclonal antibody preparation
We use the forward primer Pr5-HT1B- BamHI 5′- CGGGATCCCAAACAGCTAGGAAAAGAAT -3′ and the reverse primer Pr5-HT1B- XholI 5′- CCCTCGAGTTATGTCTTTGCCGCTTTCC -3′ to amplify the third intracellular loop cDNA fragment of Pr5-HT1B. Purified PCR products was cloned into vector pET-28a (+) and confirmed by DNA sequencing. The expression product was 17 kDa which carried a His-tag. The construct was used to transform Escherichia coliBL21 (DE3) and the cells inoculated into 2 l of Luria–Bertani (LB) medium containing kanamycin (50 mg/ml) at 37°C. Until A600 reached 0.8, the cultures were added with 0.5 mM isopropyl-β-d-thiogalactopyranoside (IPTG) and incubated overnight at 28°C. The cells were collected by centrifugation and disrupted by sonication. The insoluble recombinant protein was purified through Ni-chelating affinity column (TransGen Biotech, Beijing, China) under denaturing conditions. To confirm the identity of the recombinant protein, proteins were separated by SDS-PAGE, transferred to PVDF (Bio-Rad) and detected with an anti-His polyclonal antibody HRP (HuaAn Biotechnology, Hangzhou, China) conjugate by ECL (Thermo Scientific). Then the purified protein was submitted to Hangzhou HuaAn Biotechnology Company as an antigen for immunization in male New Zealand rabbits. The antibody to Pr5-HT1B was purified from antiserum which had been done by the company.Polyclonal antibody against Pr5-HT2B was generated by Hangzhou HuaAn Biotechnology Company using peptide antigen for antibody development. Epitopes are predicted by GenScript Optimum Antigen design tool. Peptide sequence synthesized for Pr5-HT2B antibody development is SAAAKTSKGTNISEC. The amino acid cysteine (C), which locates at the end of the peptide, is used for carrier protein conjugation.
Western blot and immunofluorescence
Hemocytes were lysed in ice-cold buffer (1% Triton X-100, 150 mM NaCl, 10 mM Tris-HCl pH 7.5, 5 mM EDTA, 1 mM sodiumo-vanadate) containing protease inhibitors phenylmethyl sulfonylfluoride (PMSF, Sangon Biotech, P0754, Shanghai, China). For membrane proteins, debris was sedimented by centrifugation (15,500 g, 10 min, 4°C), supernatants were collected and their protein concentration was determined by Bradford reagent (Sangon Biotech, Shanghai, China). Samples were diluted in 4 × Protein SDS PAGE Loading Buffer (Takara Biotechnology, Japan), then boiled for 10 min. Samples were separated in a denaturing polyacrylamide gel and transferred to a PVDF membrane. After blocking (5% Tris-buffered saline; pH 7.0; containing 0.1% Tween 20) and washing, membranes were then incubated overnight with primary antibodies against Pr5-HT1B and Pr5-HT2B (1: 500). Membranes were then incubated with secondary antibody horseradishperoxidase–conjugated goat anti-rabbit IgG diluted 1:5,000 in Tris-buffered saline with Tween-20. Membranes were rinsed five times with wash buffer and then incubated with the ECL western blotting substrate (Promega, Wisconsin). Membranes were stripped and reprobed with anti-β- actin (Cell Signaling Technology, Beverly, MA) for 2 hr at room temperature, followed by incubation with secondary antibody.Immunofluorescence was performed using the same methods as used for 5-HT detection except that the primary antibody was different.
Construction of expression plasmids
An expression plasmid containing the Kozak consensus sequence (Kozak, 1987) was constructed by PCR with specific primers (Supplementary file 1A). The PCR product was double digested. The digested DNA fragments were purified by PCR Clean-Up Kit (Axygen, Union City, CA) and then subcloned into pcDNA3.0 vector (Invitrogen). The correct insertion was confirmed by DNA sequencing.
HEK 293 cell culture, transfection, and creation of stable cell lines
HumanEmbryonic Kidney 293 (HEK 293) cells were obtained from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). The cell line identity has been authenticated by short tandem repeat (STR) profiling, and the cells were free from the mycoplasma contamination. HEK-293 cells were grown in Dulbecco’s modified Eagle’s medium (D-MEM) (Gibco BRL, Gaithersburg, MD) supplemented with 10% fetal bovine serum (FBS) (Gibco BRL) and antibiotics at 37°C and 5% CO2. After transfection of plasmid into the cells using Lipofectamine 2000 (Invitrogen), the antibiotic G418 (0.8 mg/mL) was added to the medium to select for cells that stably expressed the receptors. After 2 weeks of G418 selection, G418- resistant colonies were trypsinized in cloning cylinders and transferred to 12-well plastic plates for expansion. These individual cell lines were analyzed for integration of the receptor DNA by RT-PCR and localization of the protein by immunofluorescence (data not shown). The clonal cell line that most efficiently expressing 5-HT receptor was chosen for this study.
cAMP assay
Intracellular cAMP concentration ([cAMP]i) was determined as previously described (Huang et al., 2007). Cells were plated into 12-well tissue culture plates (Nunc, Roskilde, Denmark) at a density of 1× 106 cells per well and incubated at 37°C with 10% CO2 in a humidified incubator. The cells were pre-incubated in Dulbecco’s phosphate-buffered saline (DPBS; Gibco-Invitrogen) containing 100 uM phosphodiesterase inhibitor IBMX for 20 min at room temperature. After the preincubation, a 50-μl aliquot of D-PBS containing various concentrations of reagents was added. The culture was then incubated for 20 min at room temperature. The reaction was stopped by aspirating the solution and then adding 250 μl ice-cold cell lysis buffer immediately to lysis the cells. The cell lysate was scraped into 1.5 ml Eppendorf tubes for collections and stored at –70°C until use. The solution was centrifugated and [cAMP]i in the supernatant was determined using a cAMP ELISA kit (R&D Systems, Minneapolis, MN).
Ca2+ imaging
Intracellular calcium concentration ([Ca2+]i) was estimated and analyzed with a calcium imaging system. Fresh hemocytes from fifth-instar larvae were seeded on the coverslip with Grace’s medium and incubated for 30 min at 27°C. Then, the cells were loaded with the fluorescent probe Fura 2-AM (Dojindo Laboratories, Kumamoto, Japan) using 0.2% Cremophor EL (Sigma–Aldrich) for 30 min at 27°C. The cells were subsequently washed twice with a bathing solution (152 mM NaCl, 5.4 mM KCl, 5.5 mM glucose, 1.8 mM CaCl2, 0.8 mM MgCl2, and 10 mM HEPES, pH 7.4). The coverslips were transferred to a microscopic chamber that was constantly perfused with the bathing solution at ≈ 2 ml/min (Huang et al., 2012). The fluorescence at 510 nm by excitation at 340 or 380 nm with a xenon lamp was measured with individual cells using an Easy Ratio Pro calcium imaging system (Photon Technology International, Birmingham, NJ). Each experiment was repeated three times or more. EC50 values were estimated by fitting to a dose-dependent curve in Origin Pro (Origin Lab, Northampton, MA).
Survival following infection
The tetracycline-resistant S. aureus was grown overnight in a shaking incubator at 37ºC shaking at 225 rpm. Cultures were spun down. The resuspended cells were diluted in sterile PBS to achieve an optical density (OD) of 0.4. Five to seven days post-eclosion, flies were injected with 32.2 nl of the bacterial resuspension using a Drummond Scientific Nanoject II. Flies were kept at 25°C. Flies that died within 6 hr were considered dead and were removed from the count. Flies were transferred every day to new food and death was recorded every 12 hr.
Bacterial load
The tetracycline-resistant S. aureus was cultured in LB broth overnight at 37ºC shaking at 225 rpm, and subcultured to an OD of 0.4. Approximately 24 female flies per genotype were injected with 23 nl of the bacterial suspension. Eight flies from each group were then immediately homogenized in individual tubes with 100 μl sterile PBS. The material was serially diluted to 1:10, twice, in sterile PBS, and then plated on LB plates containing tetracycline. After 6 and 18 hr of infection at 25°C, eight additional flies from each genotype per time point were assayed as above with the exception that each sample was serially diluted 1:10 five times. The plates were incubated at 37°C for 8 to 10 hr. Bacterial colonies were counted when the colonies remain small and discrete.
Statistical analysis
Data had a normal distribution and are expressed as means ± standard error (s.e.m.). Data were analyzed using analysis of variance (ANOVA) with Tukey-Kramer post-hoc test and Student t tests. Log rank tests were used to determine whether survival curves of male flies were significantly different from one another. Gehan-Breslow-Wilcoxon test were used to determine whether survival curves of female flies were significantly different from one another. All curve fitting and statistical calculations were performed with Origin 8.0 (Origin Lab, Northampton, MA) and GraphPad Prism 5.0 (San Diego, CA).In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your work entitled "Serotonin modulates insect hemocyte phagocytosis via two different serotonin receptors" for consideration by eLife. Your article has been favorably evaluated by three reviewers, including Dan Hultmark and a member of our Board of Reviewing Editors, and the evaluation was overseen by K VijayRaghavan as the Senior editor.The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.Summary:In Qi et al., the authors present evidence that the neurotransmitter serotonin is secreted by activated hemocytes in the caterpillar Pieris rapae. Inhibition of serotonin production decreased hemocyte phagocytosis. The authors identified two serotonin receptors expressed in hemocytes, Pr5-HT and Pr5-HT. Blocking the activity of each of these receptors demonstrates that Pr5-HT promotes phagocytosis, while Pr5-HT inhibits it. However, upon activation by LPS, the authors observed that Pr5-HT expression is up-regulated while Pr5-HT is down-regulated, resulting in a net increase in phagocytosis during activation. The authors wanted to test the if inhibition of serotonin signaling decreases hemocyte phagocytosis in vivo, so they performed bacterial infection assays in Drosophila melanogaster, comparing wild-type flies to 5-HT1B receptor mutants. They found decreased phagocytosis of both gram-negative and gram-positive bacteria in 5-HT1B receptor mutants as well as decreased survival upon infection. Overall, the authors argue that serotonin signaling plays an important role in insect innate immunity.Essential revisions:The work done in the caterpillar is well done and nicely controlled. There are similar results already published for other insect species (Kim GS, Nalini M, Kim Y, Lee DW, Arch Insect Biochem Physiol. 2009; Kim GS and Kim Y, J Insect Physiol. 2010) and these need to be acknowledged up front in the introductory section with a sentence justifying why this study is still relevant. The reviewers found that the butterfly experiments are more detailed than in the older literature and that the extension to Drosophila opens up new possibilities for extending this research. Unfortunately, it is the fruit fly results that are not substantial enough to warrant an eLife publication. If some more characterization is presented in terms of phenotype and mechanisms, then this will achieve that goal. The authors are the best judges of the experiments that will further consolidate the fruit fly story. The manuscript will benefit from such addition. Of course, if necessary changes will take longer than 2 months, the authors could resubmit an expanded manuscript. The following major questions are provided as examples of questions that need to be addressed.1) Is the receptor 5-HT1B required autonomously in hemocytes?Does hemocyte-autonomous RNAi of 5-HT1B affect the phagocytosis response, CFU after infection, and overall survival after infection? The authors could use Hml∆-GAL4 and ideally two independent UAS-RNAi lines. For suitable readouts of CFU and phagocytosis see below.2) Does 5-HT1B indeed mediate phagocytic behavior in hemocytes and bacterial clearance as measured by CFU (or other hemocyte response/s)?Regarding the quantification of CFU after bacterial infection, it is unclear if bacterial strains with a resistance gene were used? This is not mentioned in the methods and needs to be clarified. Use of bacteria with a resistance marker is needed so injected bacteria can be distinguished from the naturally occurring bacterial load.To carefully evaluate phagocytosis the authors should, at a minimum, use the trypan blue phagocytosis assay as described by Elrod-Erickson et al. Curr. Biol. 2000.3) Does infection or LPS challenge indeed trigger an increased phagocytic hemocyte response through 5-HT1B?Does hemocyte-specific kd of 5-HT1B dampen phagocytosis in general, or is there indeed a lack of inducibility, e.g. after LPS challenge? Comparison of injecting fluorescent beads -/+LPS would allow to address this. A wt control should be used in parallel to confirm inducibility by the immune challenge here. The experiment could also be performed by injecting fluorescent beads with -/+ 5-HT.4) Do 5-HT levels increase upon bacterial infection in Drosophila? It would be easy to perform a hemolymph ELISA (as in Figure 1D) to see if 5-HT levels increase upon infection in flies.5) Both 5-HT1B and 5-HT2B seem to be expressed in hemocytes of uninfected adult Drosophila (Figure 6A). But the entire focus of the infection study phenotype is limited to the 1B mutant. What effects, if any, does inhibition/reduction of 2B have on phagocytosis and the lifespan of immune challenged animals? Would it be the same as in the caterpillar? If there is no mutant for 2B, the authors could minimally check levels of 2B expression in the hemocytes of infected animals, and perhaps one would see a down regulation similar to that in the caterpillar. There are MiMIC and TRiP lines available at BDSC, and minimally, 2B RNAi lines could be used to determine if this leads to increased phagocytosis and increased survival when challenged with bacterial infection.Essential revisions:The work done in the caterpillar is well done and nicely controlled. There are similar results already published for other insect species (Kim GS, Nalini M, Kim Y, Lee DW, Arch Insect Biochem Physiol. 2009; Kim GS and Kim Y, J Insect Physiol. 2010) and these need to be acknowledged up front in the introductory section with a sentence justifying why this study is still relevant. The reviewers found that the butterfly experiments are more detailed than in the older literature and that the extension to Drosophila opens up new possibilities for extending this research. Unfortunately, it is the fruit fly results that are not substantial enough to warrant an eLife publication. If some more characterization is presented in terms of phenotype and mechanisms, then this will achieve that goal. The authors are the best judges of the experiments that will further consolidate the fruit fly story. The manuscript will benefit from such addition. Of course, if necessary changes will take longer than 2 months, the authors could resubmit an expanded manuscript. The following major questions are provided as examples of questions that need to be addressed. 1) Is the receptor 5-HTWe thank the reviewers for raising this point. As the reviewers suggested, we have used Hml∆-GAL4 and two independent UAS-5-HT RNAi lines to address this question. As show in Figure 7, hemocyte-specific knockdown of 5-HT1B decreased hemocyte phagocytic capacity, increased the bacterial load and susceptibility to S. aureus.2) Does 5-HTTo carefully evaluate phagocytosis the authors should, at a minimum, use the trypan blue phagocytosis assay as described by Elrod-Erickson et al. Curr. Biol. 2000.We appreciate the reviewers’ constructive comments and suggestions. We are sorry for the unclear information regarding the bacterial strains we used. The bacterial strain S. aureus is resistant to tetracycline and the LB plates contain tetracycline. We have added the information in the Methods.The bacteria we used to evaluate phagocytosis are E. coli and S. aureus labeled with pHrodo, a dye that fluoresces in the acidic environment of a mature phagosome upon fusion with lysosomes. This method reduces signal variability and improves assay reproducibility since wash steps and quencher dyes are not needed. It is now widely used in mammals (Fiala M et al., Proc Natl Acad Sci USA. 104:12849-12854, 2007; Berger SB et al., Nat Immunol.11:920-927,2010; Neaga A et al., J Immunol Methods. 2011) and insects including Drosophila (Cuttell L et al., Cell 135, 524-534, 2008; Ulvila J et al., J Leukoc Biol. 89(5): 649-59, 2011; Stone EFet al., PLoS Pathog. 8(1): e1002445, 2012; Lombardo Fet al., PLoS Pathog. 9(1): e1003145, 2013; Regan JC et al., PLoS Pathog. 9(10): e1003720, 2013; Garg A and Wu LP. Cell Microbiol. 16(2): 296-310, 2014). Besides, we also tested the classical trypan blue phagocytosis assay described by Elrod-Erickson et al. (Curr. Biol. 2000) to check the hemocyte phagocytic difference between 5-HT null flies and control flies. The results are in Author response image 1 and similar to that by the pHrodo dye assays (Figure 6D). Thus, we still used the pHrodo dye in phagocytosis assays of this paper.Quantification of in vivo phagocytosis of E. coli.3) Does infection or LPS challenge indeed trigger an increased phagocytic hemocyte response through 5-HTDoes hemocyte-specific kd of 5-HTWe thank the reviewers for this valuable comment. Following the reviewers’ suggestion, we used latex beads with -/+ 5-HT to address this question. Flies injected with PBS all show similar phagocytic capacity. However, when flies are injected with 5-HT, the flies expressing 5-HT1B RNAi in blood cells take up significantly less latex beads than the control (Figure 7E). These results indicate that hemocyte-specific knockdown of 5-HT1B flies do not have a more limited phagocytic capacity, but instead become unable to enhance phagocytosis upon exposure to 5-HT.4) Do 5-HT levels increase upon bacterial infection in Drosophila? It would be easy to perform a hemolymph ELISA (as inWe thank the reviewers for this suggestion. However, we have tried many times with different protocols but still failed to culture hemocytes in the medium without contamination for a longer time (>30 min). The small body size makes the Drosophila larvae extremely difficult to isolate clean hemolymph like we did on the caterpillar.5) Both 5-HTFollowing these comments, we have used Hml∆-GAL4 and two independent UAS-5-HT RNAi lines to investigate the role of 5-HT2B in phagocytosis and the lifespan of immune challenged animals. As Figure 8 shows, the reduced levels of 5-HT2B in hemocyte led to the defect in phagocytosis of E. coli and S. aureus (Figure 8A-D) and that was associated with higher bacterial load (Figure 8I) and increased susceptibility to S. aureus (Figure 8E-G) in the flies. The results suggest that activation of 5-HT2B may promote phagocytosis in Drosophila, different from the results in the caterpillar.
Authors: Olle Terenius; Alexie Papanicolaou; Jennie S Garbutt; Ioannis Eleftherianos; Hanneke Huvenne; Sriramana Kanginakudru; Merete Albrechtsen; Chunju An; Jean-Luc Aymeric; Andrea Barthel; Piotr Bebas; Kavita Bitra; Alejandra Bravo; François Chevalier; Derek P Collinge; Cristina M Crava; Ruud A de Maagd; Bernard Duvic; Martin Erlandson; Ingrid Faye; Gabriella Felföldi; Haruhiko Fujiwara; Ryo Futahashi; Archana S Gandhe; Heather S Gatehouse; Laurence N Gatehouse; Jadwiga M Giebultowicz; Isabel Gómez; Cornelis J P Grimmelikhuijzen; Astrid T Groot; Frank Hauser; David G Heckel; Dwayne D Hegedus; Steven Hrycaj; Lihua Huang; J Joe Hull; Kostas Iatrou; Masatoshi Iga; Michael R Kanost; Joanna Kotwica; Changyou Li; Jianghong Li; Jisheng Liu; Magnus Lundmark; Shogo Matsumoto; Martina Meyering-Vos; Peter J Millichap; Antónia Monteiro; Nirotpal Mrinal; Teruyuki Niimi; Daniela Nowara; Atsushi Ohnishi; Vicencio Oostra; Katsuhisa Ozaki; Maria Papakonstantinou; Aleksandar Popadic; Manchikatla V Rajam; Suzanne Saenko; Robert M Simpson; Mario Soberón; Michael R Strand; Shuichiro Tomita; Umut Toprak; Ping Wang; Choon Wei Wee; Steven Whyard; Wenqing Zhang; Javaregowda Nagaraju; Richard H Ffrench-Constant; Salvador Herrero; Karl Gordon; Luc Swevers; Guy Smagghe Journal: J Insect Physiol Date: 2010-11-20 Impact factor: 2.354
Authors: Magda Said A Abdeltawab; S A Rifaie; E Y Shoeib; H A Abd El-Latif; M Badawi; W H Salama; A A Abd El-Aal Journal: Parasitol Res Date: 2019-11-30 Impact factor: 2.289
Authors: K Makay White; Melinda K Matthews; Rachel C Hughes; Andrew J Sommer; Joel S Griffitts; Peter D Newell; John M Chaston Journal: G3 (Bethesda) Date: 2018-03-28 Impact factor: 3.154