Transcription factors (TFs) operate by the combined activity of their DNA-binding domains (DBDs) and effector domains (EDs) enabling the coordination of gene expression on a genomic scale. Here we show that in vivo delivery of an engineered DNA-binding protein uncoupled from the repressor domain can produce efficient and gene-specific transcriptional silencing. To interfere with RHODOPSIN (RHO) gain-of-function mutations we engineered the ZF6-DNA-binding protein (ZF6-DB) that targets 20 base pairs (bp) of a RHOcis-regulatory element (CRE) and demonstrate Rho specific transcriptional silencing upon adeno-associated viral (AAV) vector-mediated expression in photoreceptors. The data show that the 20 bp-long genomic DNA sequence is necessary for RHO expression and that photoreceptor delivery of the corresponding cognate synthetic trans-acting factor ZF6-DB without the intrinsic transcriptional repression properties of the canonical ED blocks Rho expression with negligible genome-wide transcript perturbations. The data support DNA-binding-mediated silencing as a novel mode to treat gain-of-function mutations.
Transcription factors (TFs) operate by the combined activity of their DNA-binding domains (DBDs) and effector domains (EDs) enabling the coordination of gene expression on a genomic scale. Here we show that in vivo delivery of an engineered DNA-binding protein uncoupled from the repressor domain can produce efficient and gene-specific transcriptional silencing. To interfere with RHODOPSIN (RHO) gain-of-function mutations we engineered the ZF6-DNA-binding protein (ZF6-DB) that targets 20 base pairs (bp) of a RHOcis-regulatory element (CRE) and demonstrate Rho specific transcriptional silencing upon adeno-associated viral (AAV) vector-mediated expression in photoreceptors. The data show that the 20 bp-long genomic DNA sequence is necessary for RHO expression and that photoreceptor delivery of the corresponding cognate synthetic trans-acting factor ZF6-DB without the intrinsic transcriptional repression properties of the canonical ED blocks Rho expression with negligible genome-wide transcript perturbations. The data support DNA-binding-mediated silencing as a novel mode to treat gain-of-function mutations.
Transcription factors (TFs) operate by entangling their DNA-binding and transcriptional activation or repression functions (Ptashne, 2014). However, in eukaryotes TF DNA binding and effector activities are typically structurally modular (Brent, 1985) consisting of a DNA-binding domain (DBD) controlling the TF topology on genomic targets and an effector domain (ED) (Brent, 1985; Kadonaga, 2004) that recruits co-activator or co-repressor complexes (Malik and Roeder, 2010; Perissi et al., 2010) resulting in either transcriptional activation or repression of gene regulatory networks (GRNs) (Neph et al., 2012). Engineered TFs mimic the design of natural TFs (Pavletich and Pabo, 1991; Beerli and Barbas, 2002). To generate target specificity the DBD module is engineered to recognize unique genome sites (Beerli and Barbas, 2002), whereas the transcriptional activation or repressor properties are conferred by the selection of the ED (Konermann et al., 2013). To silence gain-of-function mutations, while studying the features of genomic DNA-TF interactions, here we investigated the hypothesis that engineered DNA-binding proteins without canonical ED activity possess transcriptional repression properties. As a transcriptional repression target we selected the G-protein-coupled Receptor Rhodopsin (RHO) gene whose gain-of-function mutations are those most commonly associated with autosomal dominant retinitis pigmentosa (adRP), an incurable form of blindness (Dryja et al., 1990).We generated a DNA-binding protein targeted to a cis-regulatory element (CRE) of the human proximal RHO promoter region by deconstructing an engineered TF (synthetic) composed of a DBD (ZF6-DNA-binding protein, ZF6-DB) and the ED (Kruppel-associated box, KRAB repressor domain, KRAB), which we have shown to be effective in repressing specifically the human RHO transgene carried in an adRP mouse model (Mussolino et al., 2011a). The deletion of the ED resulted in a protein, ZF6-DB targeting 20 base pairs of genomic CRE, here named ZF6-cis, found at -84 bp to -65 bp from the transcription start site (TSS) of the human RHO gene (Figure 1a; Mitton et al., 2000). Genomic ZF6-cis is without apparent photoreceptor-specific endogenous transcription factor-binding sites (TFBS; Figure 1a), as reported (Kwasnieski et al., 2012). To study the CRE features of ZF6-cis that ZF6-DB would interfere with upon binding in the absence of KRAB-mediated co-repressor recruitment, we deleted the 20 bp genomic ZF6-cis sequence and assessed its function by eGFP reporter assay (Kwasnieski et al., 2012) in living porcine retina by AAV delivery. The 776 bp-long RHO promoter fragment carrying the ZF6-cis deletion upstream of the eGFP reporter gene (AAV-RHO-cis-del-EGFP), after delivery to the porcine retinal photoreceptor, showed loss of eGFP expression compared to the control vector (AAV-RHO-EGFP) (Figure 1b,c). This suggests that ZF6-cis CRE is necessary for RHO expression (at least for the 776 bp region used in the assay) and that binding of the synthetic ZF6-DB trans-acting counterpart of ZF6-cis, may indeed repress RHO transcription.
Figure 1.
Delivery of ZF6-DB DNA-binding synthetic trans-acting factor targeted to a 20 bp of RHO cis-acting regulatory element (CRE) dramatically reduces Rho expression in photoreceptors.
(a) Schematic representation of the chromosomal location of the RHO locus and its proximal promoter elements indicating the transcription start site (in green, +1) and the location of ZF6-DB binding site (in red, ZF6-Cis) and ZF6-DB (based on Mitton et Al., 12); BAT1, Bovine A/T-rich sequence1; NRE, NRL response element; TBP, TATA box binding protein. (b) qReal Time PCR of mRNA levels (2^-ΔCT) on the adult porcine retina 15 days after vector delivery of either AAV8-hRHO-eGFP (n=2) or AAV8-hRHO-cis-del-eGFP (n=2) subretinally administered at a dose of 1x1010, showed that AAV8-hRHO-cis-del-eGFP resulted in decreased transduction (about fifty fold) compared with hRHO. (c) Histology confirmed the decrease of eGFP expression in hRHO-cis-del-eGFP injected retina compared with the retina injected with hRHO-eGFP. Scale bar, 50 µm. (d) qReal Time PCR of mRNA levels (2^-ΔCT) of adult porcine retina injected subretinally with AAV8-CMV-ZF6-DB (n=6) at a vector dose of 1x1010 genomes copies (gc) compared with non-transduced area (n=7) of the same eye 15 days after vector delivery, resulted in robust transcriptional repression of the Rho transcript. pRHO, porcine Rhodopsin; Gnat1, Guanine Nucleotide Binding Protein1. (e) Rho Immunofluorescence (green) histological confocal analysis of AAV8-CMV-ZF6-DB treated porcine retina compared with non-transduced area. Scale bar, 100 um. The treatment with ZF6-DB determined collapse of the outer-segment (OS) with apparent retention of nuclei (stained with DAPI) in the outer nuclear layer (ONL). (f) Immunofluorescence triple co-localization staining of porcine retina shown in (b) with Rho (blue), rod specific protein Gnat1 (green) and HA (ZF6-DB, red) antibodies. White arrows indicate co-localization of both HA-tag-ZF6-DB and Gnat1 rods depleted of Rho, whereas yellow arrows showed residual Rho and Gnat1 positive cells lacking ZF6-DB. A magnification of the triple staining (box) is highlighted. Scale bar, 100 µm. OS, outer segment; IS, inner segment; ONL, outer nuclear layer; INL, inner nuclear layer. (g) Representative fluorescence-activated cell sorting (FACS) of porcine retina 15 days after injections of either AAV8-GNAT1-eGFP (dose 1x1012 gc) or co-injection with both AAV8-GNAT1-eGFP and AAV8-CMV-ZF6-DB (dose of eGFP, 1x1012 gc; ZF6-DB dose 5x1010 gc). eGFP positive sorted cells (AAV8-GNAT1-eGFP) corresponded to 17,3% of the analysed population (left panel; P2 area, green dots), whereas, 22,4% of eGFP positive cells in the retina that received both vectors (AAV8-GNAT1-eGFP and AAV8-CMV-ZF6-DB; right panel; P2 area, green dots). (h) qReal Time PCR on sorted rods treated with AAV8-GNAT1-eGFP (n=3) and AAV8-CMV-ZF6-DB (n=3) showed a repression of about 85% of total rhodopsin when compared with rods treated with eGFP (mRNA levels: 2^-ΔCT). Error bars, means +/- s.e.m. n =; *p<0.05, **p<0.01, ***p<0.001; two-tailed Student’s t test.
DOI:
http://dx.doi.org/10.7554/eLife.12242.003
(a) Alignment of RHODOPSIN proximal promoter between human, mouse and pig DNA sequences; in bold ZF6-cis sequence, underlined the sequence differences present in ZF6-cis bound by ZF6-DB. (b) qPCR ChIP analysis of RHO TSS region including ZF6-cis site), GNAT1, ARR3 and tubulin beta proximal promoters controls in transfected HEK293 cells (n=3 indipendent expermients). RHO-specific enrichment is shown on RHO TSS region. ***p<0.001; two-tailed Student’s t test.
DOI:
http://dx.doi.org/10.7554/eLife.12242.004
Delivery of ZF6-DB DNA-binding synthetic trans-acting factor targeted to a 20 bp of RHO cis-acting regulatory element (CRE) dramatically reduces Rho expression in photoreceptors.
(a) Schematic representation of the chromosomal location of the RHO locus and its proximal promoter elements indicating the transcription start site (in green, +1) and the location of ZF6-DB binding site (in red, ZF6-Cis) and ZF6-DB (based on Mitton et Al., 12); BAT1, Bovine A/T-rich sequence1; NRE, NRL response element; TBP, TATA box binding protein. (b) qReal Time PCR of mRNA levels (2^-ΔCT) on the adult porcine retina 15 days after vector delivery of either AAV8-hRHO-eGFP (n=2) or AAV8-hRHO-cis-del-eGFP (n=2) subretinally administered at a dose of 1x1010, showed that AAV8-hRHO-cis-del-eGFP resulted in decreased transduction (about fifty fold) compared with hRHO. (c) Histology confirmed the decrease of eGFP expression in hRHO-cis-del-eGFP injected retina compared with the retina injected with hRHO-eGFP. Scale bar, 50 µm. (d) qReal Time PCR of mRNA levels (2^-ΔCT) of adult porcine retina injected subretinally with AAV8-CMV-ZF6-DB (n=6) at a vector dose of 1x1010 genomes copies (gc) compared with non-transduced area (n=7) of the same eye 15 days after vector delivery, resulted in robust transcriptional repression of the Rho transcript. pRHO, porcine Rhodopsin; Gnat1, Guanine Nucleotide Binding Protein1. (e) Rho Immunofluorescence (green) histological confocal analysis of AAV8-CMV-ZF6-DB treated porcine retina compared with non-transduced area. Scale bar, 100 um. The treatment with ZF6-DB determined collapse of the outer-segment (OS) with apparent retention of nuclei (stained with DAPI) in the outer nuclear layer (ONL). (f) Immunofluorescence triple co-localization staining of porcine retina shown in (b) with Rho (blue), rod specific protein Gnat1 (green) and HA (ZF6-DB, red) antibodies. White arrows indicate co-localization of both HA-tag-ZF6-DB and Gnat1 rods depleted of Rho, whereas yellow arrows showed residual Rho and Gnat1 positive cells lacking ZF6-DB. A magnification of the triple staining (box) is highlighted. Scale bar, 100 µm. OS, outer segment; IS, inner segment; ONL, outer nuclear layer; INL, inner nuclear layer. (g) Representative fluorescence-activated cell sorting (FACS) of porcine retina 15 days after injections of either AAV8-GNAT1-eGFP (dose 1x1012 gc) or co-injection with both AAV8-GNAT1-eGFP and AAV8-CMV-ZF6-DB (dose of eGFP, 1x1012 gc; ZF6-DB dose 5x1010 gc). eGFP positive sorted cells (AAV8-GNAT1-eGFP) corresponded to 17,3% of the analysed population (left panel; P2 area, green dots), whereas, 22,4% of eGFP positive cells in the retina that received both vectors (AAV8-GNAT1-eGFP and AAV8-CMV-ZF6-DB; right panel; P2 area, green dots). (h) qReal Time PCR on sorted rods treated with AAV8-GNAT1-eGFP (n=3) and AAV8-CMV-ZF6-DB (n=3) showed a repression of about 85% of total rhodopsin when compared with rods treated with eGFP (mRNA levels: 2^-ΔCT). Error bars, means +/- s.e.m. n =; *p<0.05, **p<0.01, ***p<0.001; two-tailed Student’s t test.DOI:
http://dx.doi.org/10.7554/eLife.12242.003
Chromatin Immunoprecipitation (ChIP) of ZF6-DB and ZF6-KRAB.
(a) Alignment of RHODOPSIN proximal promoter between human, mouse and pig DNA sequences; in bold ZF6-cis sequence, underlined the sequence differences present in ZF6-cis bound by ZF6-DB. (b) qPCR ChIP analysis of RHO TSS region including ZF6-cis site), GNAT1, ARR3 and tubulin beta proximal promoters controls in transfected HEK293 cells (n=3 indipendent expermients). RHO-specific enrichment is shown on RHO TSS region. ***p<0.001; two-tailed Student’s t test.DOI:
http://dx.doi.org/10.7554/eLife.12242.004Chromatin immunoprecipitation (ChIP) experiments to evaluate binding to the ZF6-cis target genomic sequence showed occupancy by the DNA-binding protein ZF6-DB (Figure 1—figure supplement 1b). To evaluate whether ZF6-DB represses transcription of the RHO gene in a physiological genomic context, we used the porcine retina (Mussolino et al., 2011b), which shares 19 out of 20 DNA bp with the human genomic ZF6-cis sequence (Figure 1—figure supplement 1a). Subretinal delivery of a low AAV8 vector dose (1x1010 genome copies; gc) of ZF6-DB (AAV8-CMV-ZF6-DB) resulted in a 45% decrease of porcine Rho transcript levels at 15 days post-injection (Figure 1d). Immunofluorescence analysis showed depletion of Rho protein and consequent collapse of the rod outer segments in ZF6-DB positive cells (Figure 1e,f). Despite the lack of detectable Rho expression in most of the transduced rods, rows of photoreceptor nuclei were preserved from degeneration at this time point (Figure 1e). To further evaluate the extent of Rho silencing in rod photoreceptors by ZF6-DB, we performed FACS analysis on eGFP-labelled rod cells. Rod cells were isolated from porcine retina that had received a subretinal injection of an AAV vector encoding eGFP under the control of a rod-specific promoter (human Guanine Nucleotide Binding Protein1, GNAT1 promoter elements (Lee et al., 2010); AAV8-GNAT1-eGFP; dose 1x1012 gc) with or without the vector encoding ZF6-DB (5x1010 gc). Fifteen days after injection, the retina were disaggregated and FACS-sorted. The retina co-transduced with eGFP and ZF6-DB vector showed virtually a 'somatic knock-out' of Rho expression (~85% decrease of Rho transcript levels; Figure 1g,h).
Figure 1—figure supplement 1.
Chromatin Immunoprecipitation (ChIP) of ZF6-DB and ZF6-KRAB.
(a) Alignment of RHODOPSIN proximal promoter between human, mouse and pig DNA sequences; in bold ZF6-cis sequence, underlined the sequence differences present in ZF6-cis bound by ZF6-DB. (b) qPCR ChIP analysis of RHO TSS region including ZF6-cis site), GNAT1, ARR3 and tubulin beta proximal promoters controls in transfected HEK293 cells (n=3 indipendent expermients). RHO-specific enrichment is shown on RHO TSS region. ***p<0.001; two-tailed Student’s t test.
DOI:
http://dx.doi.org/10.7554/eLife.12242.004
To evaluate genome–wide transcriptional specificity, we analyzed the porcine retinal transcriptome by RNA sequencing (RNA-Seq) from retina harvested 15 days after subretinal injection of the AAV8 vector encoding ZF6-DB (Figure 2). For comparison we used the engineered TF with the ED, KRAB (AAV8-CMV-ZF6-KRAB). The low vector doses delivered to the porcine retina (1x1010 gc) resulted in about twenty-fold lower expression levels of the ZF6-DB and ZF6-KRAB transgenes compared to Crx and Nrl, two retina-specific TFs (Swaroop et al., 2010) (Figure 2a). Of note, despite these low expression levels, we observed robust Rho transcriptional repression (Figure 2b). We then analyzed the transcriptional perturbation in response to the AAV retinal gene transfer of ZF6-DB by determining the differentially expressed genes (DEGs). Remarkably, in vivo the ZF6-DB protein generated about ten-fold less transcriptional perturbation compared with the ZF6-KRAB protein (19 vs. 222 DEGs; Figure 2e). Notably, this magnitude of perturbation is twenty five-fold lower than that induced by the ablation of an endogenous rod-specific TF (NRL, 500 DEGs vs 19 DEGs, ZF6-DBD; [Roger et al., 2014]). Retinal-specific pathway analysis of DEGs showed that ZF6-DB–induced down-regulation is restricted to the Rho biochemical interactor Gnat1 (Palczewski, 2012), and the up-regulation of 2 genes associated with acute phase inflammatory response, alpha-2-macroglobulin (A2m) and glial fibrillary acidic protein (Gfap) (Figure 2c). ZF6-KRAB induced the de-regulation of 17 retinal network associated genes (Figure 2—figure supplement 1). These results suggest that both ZF6-DB and the consequent Rho down-regulation marginally interferes with photoreceptor specific pathways, apart from Gnat1 repression, and that the up-regulation of the inflammatory response genes may be due to the collapse of the retinal scaffold caused by Rho depletion. The intersection of retinal transcriptome changes between ZF6-DB and ZF6-KRAB showed that both drive similar perturbation in the expression of 16 genes, which represent 84% of the entire pool of ZF6-DB DEGs (Figure 2e). Consistently, both ZF6-DB and ZF6-KRAB generated similar functional effects, i.e. concordant up- or down- differential expression of these 16 shared genes (Figure 2d). These results suggest that both ZF6-DB and ZF6-KRAB bind to similar genomic targets. We next studied whether the differential transcriptional repression induced by ZF6-DB and ZF6-KRAB was due to similar biochemical binding properties for the ZF6-cis DNA target. Both ZF6-DB and ZF6-KRAB proteins bind the ZF6-cis RHO DNA target site with similar affinities (Figure 2—figure supplement 2). These data suggest that, despite the presence of an active canonical repressor domain, ZF6-KRAB generated Rho silencing by DNA binding. Indeed, ZF6-DB, being exclusively a DNA-binding protein identical to the DBD of ZF6-KRAB, showed similar Rho silencing effects but far less retinal transcriptional perturbations. This indicates that the specificity is conferred by both the engineered design of the DNA-binding on a genome-specific target (Beerli and Barbas, 2002) and the lack of the ED. In addition, this finding supports the notion that that ZF6-cis CRE is necessary for Rho expression genome-wide.
Figure 2.
Photoreceptor delivery of ZF6-DB resulted in reduced genome-wide transcript perturbations.
(a) RNA-Seq expression levels (Mean Normalized Counts) comparison between 2 endogenous TFs (Crx and Nrl) and the expression levels resulting from transduction of AAV8-CMV-ZF6-DB and AAV8-CMV-ZF6-KRAB, 15 days after retinal delivery (AAV8-CMV-ZF6-DB n= 6; AAV8-CMV-ZF6-KRAB n= 4 and 7 controls, non-transduced area). (b) Rho and rod Gnat1 and Cone Arrestin 3 expression levels in treated and control retina. (c) Ingenuity Pathway Analysis of DEGs after ZF6-DB AAV delivery in porcine retina showed a network of 13 genes. The 2 phototransduction genes RHO and GNAT1 are shown in green (down-regulated) whereas the 2 genes associated with primary inflammatory response network, A2M and GFAP, are up-regulated (red). (d) Transcriptional activation and repression concordances among Log Fold Changes of the genes in common (Swaroop et al., 2010) between ZF6-DB and ZF6-KRAB (Pearson Correlation Test; PC=0.9787; p value << 1x10-5). (e) Venn Diagrams, pairwise intersection of the 2 sets of Differentially Expressed Genes (DEGs). An adjusted p value (False Discovery Rate; FDR ≤ 0.1), without filtering on fold change levels, resulted in 19 and 222 DEGs, in ZF6-DBD and ZF6-KRAB treated retina, respectively. The intersection resulted significant by hypergeometric test (p value << 1x10-5).
DOI:
http://dx.doi.org/10.7554/eLife.12242.005
(a) Delivery of AAV8-CMV-ZF6-KRAB resulted in up-regulation of 10 genes associated with inflammatory responses (red, up-regulation) and the down-regulation (green) of 7 genes associated with the rod phototransduction cascade. (b) the ZF6-DB pathway analysis (Figure 2) is reported for comparison.
DOI:
http://dx.doi.org/10.7554/eLife.12242.006
(a) Gel mobility shift titrations of ZF6-KRAB and ZF6-DB with the hRHO 65 bp oligonucleotide (see 'Materials and methods'). (b) In the saturation binding experiments the nanomolar concentration of specific binding data was plotted against of nanomolar increasing concentration (130, 135, 145, 150, 165, 170, 175, 180, 190, and 200 nM, respectively) and (145, 150, 170, 175, 195, 210, 220, 225, 240, and 250 nM, respectively) of DNA ligand and Scatchard analysis of the gel shift binding data. The ratio of bound to free DNA is plotted versus the nanomolar concentration of bound DNA in the reaction mixture. The ZF6-KRAB and ZF6-DB apparent dissociation constants (Kd ZF6-KRAB = 108.00 ± 11.78 nM (R2 = 0.97) and Kd ZF6-DB = 41.94 ± 3.45 nM, R2 = 0.96), respectively) were determined. (c) combination of the a and b panels.
DOI:
http://dx.doi.org/10.7554/eLife.12242.007
Figure 2—figure supplement 1.
Ingenuity Pathway Analysis on DEGs of ZF6-KRAB treated retina.
(a) Delivery of AAV8-CMV-ZF6-KRAB resulted in up-regulation of 10 genes associated with inflammatory responses (red, up-regulation) and the down-regulation (green) of 7 genes associated with the rod phototransduction cascade. (b) the ZF6-DB pathway analysis (Figure 2) is reported for comparison.
DOI:
http://dx.doi.org/10.7554/eLife.12242.006
Figure 2—figure supplement 2.
Determination of the binding constants of ZF6-KRAB and ZF6-DB.
(a) Gel mobility shift titrations of ZF6-KRAB and ZF6-DB with the hRHO 65 bp oligonucleotide (see 'Materials and methods'). (b) In the saturation binding experiments the nanomolar concentration of specific binding data was plotted against of nanomolar increasing concentration (130, 135, 145, 150, 165, 170, 175, 180, 190, and 200 nM, respectively) and (145, 150, 170, 175, 195, 210, 220, 225, 240, and 250 nM, respectively) of DNA ligand and Scatchard analysis of the gel shift binding data. The ratio of bound to free DNA is plotted versus the nanomolar concentration of bound DNA in the reaction mixture. The ZF6-KRAB and ZF6-DB apparent dissociation constants (Kd ZF6-KRAB = 108.00 ± 11.78 nM (R2 = 0.97) and Kd ZF6-DB = 41.94 ± 3.45 nM, R2 = 0.96), respectively) were determined. (c) combination of the a and b panels.
DOI:
http://dx.doi.org/10.7554/eLife.12242.007
Photoreceptor delivery of ZF6-DB resulted in reduced genome-wide transcript perturbations.
(a) RNA-Seq expression levels (Mean Normalized Counts) comparison between 2 endogenous TFs (Crx and Nrl) and the expression levels resulting from transduction of AAV8-CMV-ZF6-DB and AAV8-CMV-ZF6-KRAB, 15 days after retinal delivery (AAV8-CMV-ZF6-DB n= 6; AAV8-CMV-ZF6-KRAB n= 4 and 7 controls, non-transduced area). (b) Rho and rod Gnat1 and Cone Arrestin 3 expression levels in treated and control retina. (c) Ingenuity Pathway Analysis of DEGs after ZF6-DB AAV delivery in porcine retina showed a network of 13 genes. The 2 phototransduction genes RHO and GNAT1 are shown in green (down-regulated) whereas the 2 genes associated with primary inflammatory response network, A2M and GFAP, are up-regulated (red). (d) Transcriptional activation and repression concordances among Log Fold Changes of the genes in common (Swaroop et al., 2010) between ZF6-DB and ZF6-KRAB (Pearson Correlation Test; PC=0.9787; p value << 1x10-5). (e) Venn Diagrams, pairwise intersection of the 2 sets of Differentially Expressed Genes (DEGs). An adjusted p value (False Discovery Rate; FDR ≤ 0.1), without filtering on fold change levels, resulted in 19 and 222 DEGs, in ZF6-DBD and ZF6-KRAB treated retina, respectively. The intersection resulted significant by hypergeometric test (p value << 1x10-5).DOI:
http://dx.doi.org/10.7554/eLife.12242.005
Ingenuity Pathway Analysis on DEGs of ZF6-KRAB treated retina.
(a) Delivery of AAV8-CMV-ZF6-KRAB resulted in up-regulation of 10 genes associated with inflammatory responses (red, up-regulation) and the down-regulation (green) of 7 genes associated with the rod phototransduction cascade. (b) the ZF6-DB pathway analysis (Figure 2) is reported for comparison.DOI:
http://dx.doi.org/10.7554/eLife.12242.006
Determination of the binding constants of ZF6-KRAB and ZF6-DB.
(a) Gel mobility shift titrations of ZF6-KRAB and ZF6-DB with the hRHO 65 bp oligonucleotide (see 'Materials and methods'). (b) In the saturation binding experiments the nanomolar concentration of specific binding data was plotted against of nanomolar increasing concentration (130, 135, 145, 150, 165, 170, 175, 180, 190, and 200 nM, respectively) and (145, 150, 170, 175, 195, 210, 220, 225, 240, and 250 nM, respectively) of DNA ligand and Scatchard analysis of the gel shift binding data. The ratio of bound to free DNA is plotted versus the nanomolar concentration of bound DNA in the reaction mixture. The ZF6-KRAB and ZF6-DB apparent dissociation constants (Kd ZF6-KRAB = 108.00 ± 11.78 nM (R2 = 0.97) and Kd ZF6-DB = 41.94 ± 3.45 nM, R2 = 0.96), respectively) were determined. (c) combination of the a and b panels.DOI:
http://dx.doi.org/10.7554/eLife.12242.007To test the functional activity of ZF6-DB in an adRP animal model, we used the RHO-P347S mouse (Li et al., 1996), which harbors the P347S RHO human mutant allele including the 20 DNA base pairs of the human genomic ZF6-cis sequence, whereas the murine Rho promoter sequence lacks the ZF6-Cis target (Figure 1—figure supplement 1a) (Li et al., 1996). Therefore, human-specific P347S RHO silencing by ZF6-DB (which does not affect murine Rho expression) may result in preservation of retinal function (Mussolino et al., 2011a). Strikingly, AAV8 vector delivery of ZF6-DB resulted in significantly higher functional protection in both the A- and B-wave components of electroretinography (ERG analysis) compared to ZF6-KRAB and AAV-GFP controls (Figure 3a). In addition, injection of either ZF6-KRAB or ZF6-DB in C57Bl/6 wild type retina did not produce detectable functional detrimental effects (Figure 3b). Thus, the higher ERG responses observed in ZF6-DB- compared to ZF6-KRAB-treated P347S mice should be further investigated.
Figure 3.
ZF6-DB DNA-binding protein preserves retinal function of the P347S adRP mouse model.
(a) Electroretinography (ERG) analysis on P347S mice mice subretinally injected at post natal day 14 (PD14) with AAV8-CMV-ZF6-DB (n=10), AAV8-CMV-ZF6-KRAB (n=10), or AAV8-CMV-eGFP (n=10) and analysed at P30. Retinal responses in both scotopic (dim light) and photopic (bright light) showed that both A- and B-waves amplitudes, evoked by increasing light intensities, were preserved in both AAV8-CMV-ZF6-DB and ZF6-KRAB compared to eGFP control (b) A- and B-wave are shown for injected C57Bl/6 mice with ZF6-DB (n=4), ZF6-KRAB (n=4) and eGFP (n=4), independently. No functional impairment is observed for each construct. Error bars, means +/- s.e.m. *p<0.05, **p<0.01, ***p<0.001; two-tailed Student’s t test.
DOI:
http://dx.doi.org/10.7554/eLife.12242.008
ZF6-DB DNA-binding protein preserves retinal function of the P347S adRP mouse model.
(a) Electroretinography (ERG) analysis on P347S mice mice subretinally injected at post natal day 14 (PD14) with AAV8-CMV-ZF6-DB (n=10), AAV8-CMV-ZF6-KRAB (n=10), or AAV8-CMV-eGFP (n=10) and analysed at P30. Retinal responses in both scotopic (dim light) and photopic (bright light) showed that both A- and B-waves amplitudes, evoked by increasing light intensities, were preserved in both AAV8-CMV-ZF6-DB and ZF6-KRAB compared to eGFP control (b) A- and B-wave are shown for injected C57Bl/6 mice with ZF6-DB (n=4), ZF6-KRAB (n=4) and eGFP (n=4), independently. No functional impairment is observed for each construct. Error bars, means +/- s.e.m. *p<0.05, **p<0.01, ***p<0.001; two-tailed Student’s t test.DOI:
http://dx.doi.org/10.7554/eLife.12242.008To determine the therapeutic potential of DNA-binding-mediated silencing, we carried out the silencing-replacement strategy (Kiang et al., 2005) by coupling ZF6-DB with RHO replacement (human RHO, hRHO CDS) in order to complement Rho transcriptional repression in porcine retina (Figure 4—figure supplement 1). To achieve simultaneous photoreceptor transduction of both ZF6-DB and hRHO, we cloned the two expression cassettes into a single vector (DNA-binding repression and replacement, DBR-R, construct; Figure 4a). The key variables to achieve highly differential expression required for balanced simultaneous RHO repression and replacement are the vector dose and promoter strength. Indeed, ZF6-DB (~200 counts; RNA-seq expression levels) generated a decrease of about 100,000 Rho RNA-seq counts after transduction (~250,000 counts in controls vs. ~150,000 after treatment; Figure 2a,b). Thus, to ensure high and rod-specific hRHO replacement, we opted for a high vector dose and the strength of the GNAT1 promoter (Figure 1h; [Lee et al., 2010]). To decrease ZF6-DB expression levels at high vector dose, while keeping rod-specificity, we both shortened the human RHO promoter and deleted the 5’ sequence of the ZF6-DB target ZF6-Cis (Figure 4—figure supplement 2). We used 1x1012 gc of vector of DBR-R (AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO) to administer to porcine retina. As an internal control the contralateral eye received the previously used ZF6-DB vector (AAV8-CMV-ZF6-DB; at 1x1010 gc; Figure 1). AAV8-CMV-eGFP was co-administrated to label the transduced area. Administration of the DBR-R vector resulted in rod-specific transcriptional repression of the porcine Rho (38%) and in concomitant replacement of the exogenous hRHO (68%), as assessed by transcripts, protein expression levels, and integrity of photoreceptor outer segments (Figure 4b–d and Figure 4—figure supplement 3). Notably, Gnat1 transcript and protein (data not shown) levels demonstrated complementation, supporting a secondary down-regulation of Gnat1 associated with Rho repression (Figure 4b).
Figure 4—figure supplement 1.
Outline of the DNA-binding repressor-replacement (DBR-R) strategy.
The DNA-binding protein, ZF6-DB, for transcriptional silencing of RHO is coupled to replacement, R, in the same AAV vector (left hexagon) to ensure simultaneous transduction of photoreceptors. The DNA-binding protein ZF6-DB operates on the regulatory region of the RHO promoter, in an allele and mutation independent manner i.e. ZF6 DNA binding on the endogenous promoter represses RHO transcription irrespectively of the mutated and WT alleles, preventing RHO expression (mutated RHO, green; and WT, blue). This strategy is designed to overcome the high heterogeneity of RHO mutations. Highlighted as a 'chromosome zoom-in' [Genome Browser] the ZF6-DB (orange squares) bound to the regulatory DNA-target sequence. Exogenously AAV vector delivered RHO (blue) for replacement is shown in the black box.
DOI:
http://dx.doi.org/10.7554/eLife.12242.010
Figure 4.
DNA-binding repression-replacement (DBR-R) of Rho in the porcine retina.
(a) AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO DBR-R construct features, including the two expression cassettes, RHOΔ-ZF6-DB encoding for both the DNA-binding repressor ZF6-DB (orange), and GNAT1-hRHO for human RHO for replacement (blue). The size (kb) of the construct is indicated as a bar. (b) qReal Time PCR, mRNA levels (2^-ΔCT) 2 months after vector delivery of either AAV8-CMV-ZF6-DB (DBR; orange bars) or AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO (DBR-R, blue bars) and non-transduced controls (green bars). pRho, porcine Rhodopsin; Gnat1, Guanine Nucleotide Binding Protein1; Arr3, Arrestin 3; hRHO, human Rhodopsin. The result is representative of two independent experiments. Error bars, means +/- s.e.m. ; *p<0.05, **p<0.01, ***p<0.001; two-tailed Student’s t test. (c) Western blot analysis on the retina showed in b, c and d. (d) Immunofluorescence double staining with Rho (green) and HA-ZF6-DB (red) antibodies. Left panel, non-transduced control retina; middle panel, AAV8-CMV-ZF6-DB treated retina; left panel, AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO DBR-R treated retina. OS, outer segment; IS, inner segment; ONL, outer nuclear layer; INL, inner nuclear layer; scale bar, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.12242.009
The DNA-binding protein, ZF6-DB, for transcriptional silencing of RHO is coupled to replacement, R, in the same AAV vector (left hexagon) to ensure simultaneous transduction of photoreceptors. The DNA-binding protein ZF6-DB operates on the regulatory region of the RHO promoter, in an allele and mutation independent manner i.e. ZF6 DNA binding on the endogenous promoter represses RHO transcription irrespectively of the mutated and WT alleles, preventing RHO expression (mutated RHO, green; and WT, blue). This strategy is designed to overcome the high heterogeneity of RHO mutations. Highlighted as a 'chromosome zoom-in' [Genome Browser] the ZF6-DB (orange squares) bound to the regulatory DNA-target sequence. Exogenously AAV vector delivered RHO (blue) for replacement is shown in the black box.
DOI:
http://dx.doi.org/10.7554/eLife.12242.010
(a) qReal Time PCR, mRNA levels (2^-ΔCT) on the adult murine retina 15 days after vector delivery of either AAV8-hRHO short-eGFP or AAV8-hRHO-s-ΔZF6-eGFP subretinally administered at a dose of 1x109, showed that AAV8-hRHO-s-ΔZF6-eGFP resulted in decreased transduction (about ten fold) compared with hRHO long. Error bars, means +/- s.e.m.; *p<0.05, **p<0.01; two-tailed Student’s t test. (b) Histology demonstrated maintenance of rod-specific expression by AAV8-RHOΔ-eGFP. Scale bar, 50 µm.
DOI:
http://dx.doi.org/10.7554/eLife.12242.011
Rod-specific expression of DBR-R (AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO) 2 month after vector delivery. Immunofluorescence double staining with human cone Arrestin 3 (hCAR; green) and HA-ZF6-DB (red) antibodies, showed rod specific transduction. Left panel, non-transduced control retina; right panel, AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO DBR-R treated retina. OS, outer segment; IS, inner segment; ONL, outer nuclear layer; INL, inner nuclear layer. Scale bar, 50 µm.
DOI:
http://dx.doi.org/10.7554/eLife.12242.012
Figure 4—figure supplement 2.
Strength and tissue specificity of RHOΔ promoter elements in murine retina.
(a) qReal Time PCR, mRNA levels (2^-ΔCT) on the adult murine retina 15 days after vector delivery of either AAV8-hRHO short-eGFP or AAV8-hRHO-s-ΔZF6-eGFP subretinally administered at a dose of 1x109, showed that AAV8-hRHO-s-ΔZF6-eGFP resulted in decreased transduction (about ten fold) compared with hRHO long. Error bars, means +/- s.e.m.; *p<0.05, **p<0.01; two-tailed Student’s t test. (b) Histology demonstrated maintenance of rod-specific expression by AAV8-RHOΔ-eGFP. Scale bar, 50 µm.
DOI:
http://dx.doi.org/10.7554/eLife.12242.011
Figure 4—figure supplement 3.
Cone morphological integrity after DNA-binding repression-replacement (DBR-R) subretinal delivery.
Rod-specific expression of DBR-R (AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO) 2 month after vector delivery. Immunofluorescence double staining with human cone Arrestin 3 (hCAR; green) and HA-ZF6-DB (red) antibodies, showed rod specific transduction. Left panel, non-transduced control retina; right panel, AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO DBR-R treated retina. OS, outer segment; IS, inner segment; ONL, outer nuclear layer; INL, inner nuclear layer. Scale bar, 50 µm.
DOI:
http://dx.doi.org/10.7554/eLife.12242.012
DNA-binding repression-replacement (DBR-R) of Rho in the porcine retina.
(a) AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO DBR-R construct features, including the two expression cassettes, RHOΔ-ZF6-DB encoding for both the DNA-binding repressor ZF6-DB (orange), and GNAT1-hRHO for human RHO for replacement (blue). The size (kb) of the construct is indicated as a bar. (b) qReal Time PCR, mRNA levels (2^-ΔCT) 2 months after vector delivery of either AAV8-CMV-ZF6-DB (DBR; orange bars) or AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO (DBR-R, blue bars) and non-transduced controls (green bars). pRho, porcine Rhodopsin; Gnat1, Guanine Nucleotide Binding Protein1; Arr3, Arrestin 3; hRHO, human Rhodopsin. The result is representative of two independent experiments. Error bars, means +/- s.e.m. ; *p<0.05, **p<0.01, ***p<0.001; two-tailed Student’s t test. (c) Western blot analysis on the retina showed in b, c and d. (d) Immunofluorescence double staining with Rho (green) and HA-ZF6-DB (red) antibodies. Left panel, non-transduced control retina; middle panel, AAV8-CMV-ZF6-DB treated retina; left panel, AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO DBR-R treated retina. OS, outer segment; IS, inner segment; ONL, outer nuclear layer; INL, inner nuclear layer; scale bar, 100 µm.DOI:
http://dx.doi.org/10.7554/eLife.12242.009
Outline of the DNA-binding repressor-replacement (DBR-R) strategy.
The DNA-binding protein, ZF6-DB, for transcriptional silencing of RHO is coupled to replacement, R, in the same AAV vector (left hexagon) to ensure simultaneous transduction of photoreceptors. The DNA-binding protein ZF6-DB operates on the regulatory region of the RHO promoter, in an allele and mutation independent manner i.e. ZF6 DNA binding on the endogenous promoter represses RHO transcription irrespectively of the mutated and WT alleles, preventing RHO expression (mutated RHO, green; and WT, blue). This strategy is designed to overcome the high heterogeneity of RHO mutations. Highlighted as a 'chromosome zoom-in' [Genome Browser] the ZF6-DB (orange squares) bound to the regulatory DNA-target sequence. Exogenously AAV vector delivered RHO (blue) for replacement is shown in the black box.DOI:
http://dx.doi.org/10.7554/eLife.12242.010
Strength and tissue specificity of RHOΔ promoter elements in murine retina.
(a) qReal Time PCR, mRNA levels (2^-ΔCT) on the adult murine retina 15 days after vector delivery of either AAV8-hRHO short-eGFP or AAV8-hRHO-s-ΔZF6-eGFP subretinally administered at a dose of 1x109, showed that AAV8-hRHO-s-ΔZF6-eGFP resulted in decreased transduction (about ten fold) compared with hRHO long. Error bars, means +/- s.e.m.; *p<0.05, **p<0.01; two-tailed Student’s t test. (b) Histology demonstrated maintenance of rod-specific expression by AAV8-RHOΔ-eGFP. Scale bar, 50 µm.DOI:
http://dx.doi.org/10.7554/eLife.12242.011
Cone morphological integrity after DNA-binding repression-replacement (DBR-R) subretinal delivery.
Rod-specific expression of DBR-R (AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO) 2 month after vector delivery. Immunofluorescence double staining with human cone Arrestin 3 (hCAR; green) and HA-ZF6-DB (red) antibodies, showed rod specific transduction. Left panel, non-transduced control retina; right panel, AAV8-RHOΔ-ZF6-DB-GNAT1-hRHO DBR-R treated retina. OS, outer segment; IS, inner segment; ONL, outer nuclear layer; INL, inner nuclear layer. Scale bar, 50 µm.DOI:
http://dx.doi.org/10.7554/eLife.12242.012In this study, we showed that photoreceptor genomic binding of a 20 bp-long DNA sequence by a synthetic DNA-binding protein dramatically reduces Rho expression. The combination of Rho transcriptional silencing and the restricted transcriptome perturbation induced by ZF6-DB, without the intrinsic repression activity contained in an ED, indicate that the local binding to ZF6-cis per se is the determinant of transcriptional repression, whereas the high specificity observed may result by both DNA-binding specificity (biochemical affinity) of ZF6-DB and the rod genomic context. The transcriptional repression mechanism of ZF6-DB binding likely relies on the interference occurring between TFs and local DNA sequence features within the RHO proximal promoter region (Mitton et al., 2000), which we showed here to be necessary to control Rho expression at the genomic level. The lack of known TFBSs and the low level of expression of ZF6-DB expressed in the photoreceptors, which was twenty-fold below the levels of photoreceptor specific TFs (Crx and Nrl), suggest that the molecular determinant of silencing may not be the simple displacement of key RHO TFs (Mao et al., 2011). We propose a model in which the molecular features of the DNA (loop, twisting, bending, for instance) may contribute to Rhodopsin transcriptional output. In this context, the DNA may be envisaged as not being exclusively the source of storage of functional information (protein coding and non-coding transcripts) or an inert DNA-binding protein harbor (i.e. positional information for TFs DNA binding), but also as an intrinsically active operator of the transcriptional function. This contribution of DNA is supported by both the transcriptional repression upon the ZF6-cis deletion of 20 bp of DNA and intereference in trans by using a synthetic DNA binding protein that, not being encoded by the genome, may occupy a protein-free portion of the genome. It follows that in terms of signaling, the information source, the DNA, generates an output signal the RNA and eventually a protein (TF), whose final output functional activity is completed back by the DNA. Thus the information source, the DNA, becomes also integral part of the signaling (Rhodopsin transcriptional output). In this vision, to act (interfere) upstream the DNA, an external function is necessary, which is, in this study, the synthetic ZF6-DB carried by the vector.From a therapeutic prospective, a relevant property of ZF6-DB DNA binding interference is the high rate of transcriptional silencing observed after in vivo gene transfer, which is consistent with canonical TFs mode of action (Kiang et al., 2005). DNA binding interference via ZF6-DB in transduced retina generated 45% Rho transcriptional repression, which reached 85% when rods were sorted, supporting its use for diseases requiring correction of a large number of affected cells, such as adRP and other Mendelian disorders due to gain-of-function mutations. Furthermore, Rho transcriptional silencing and its complete RHO replacement support in principle the use of the DBR-R constructs for treatment of any RHO mutation including those caused by a dominant negative mechanism (Mao et al., 2011). However, the 38% silencing and replacement observed may not yet be sufficient to achieve therapeutic efficacy/benefit in patients with adRP. Therefore, further development of this proof-of-concept will include optimization of the design of the silencing and replacement double construct (tuning the strength of the promoter elements), vector selection and dose, and the surgical approach. In conclusion, in vivo retinal gene transfer of an AAV vector (Doria et al., 2013; Liang et al., 2001; Scatchard, 1949) carrying a 22 kDa orthogonal (Surace et al., 2005) and gene-extrinsic noise-resistant (the permissive rod photoreceptor cell-specific environment; [Li et al., 2011]) synthetic protein acts as a transcriptional repressor, which results in a potent and specific silencing of the Rho gene upon binding to an essential Rho DNA element.
Materials and methods
Plasmid construction
The ZF6-DNA-binding domain (NΔ96 deletion mutant, ZF6-DB) was amplified by PCR from AAV2.1 CMV-ZF6-KRAB (Mussolino et al., 2011a) using primers ZF6-DBfw (TTGCGGCCGCATGATCGATCTGGAACCTGGCG) and ZF6-DBrv (AAGCTTTCAAGATGCATAGTCT). The PCR product was digested using NotI and HindIII restriction enzymes and cloned in pAAV2.1. The hGNAT1 promoter was synthetized by Eurofins MWG based on Lee et al. 2010 adding the 5’UTR. The fragment was cloned in pAAV2.1 using NheI and NotI restriction enzymes. The human Rhodopsin CDS was amplified by PCR from human retina cDNA using the hRHOfw (GCGGCCGCATGAATGGCACAGAAGGCCC) e hRHOrv (AAGCTTTTAGGCCGGGGCCACCTG) primers and the PCR fragment was digested using NotI and HindIII restriction enzymes and cloned in pAAV2.1 plasmid under the control of hGNAT1 promoter. The human rhodopsin short promoter (hRHO-short-(s), 164 bp from the transcription starting site (TSS) + 5’UTR), the human rhodopsin long promoter (hRHO-long, 796 bp from the TSS + 5’UTR), the human rhodopsin long promoter mutated of the ZF6-cis (hRHO-cis-del, 776 bp from the TSS lacking the bases -82 -62 from the TSS) and the human rhodopsin muted promoter (hRHO-s-ΔZF6, lacking the bases -84 -77 from the TSS) were generated by gene synthesis of Eurofins MWG and cloned in pAAV2.1 using NheI and NotI restriction enzymes. For the generation of DBR-R plasmid the Eurofins MWG synthetized the expression cassette RHOΔ-ZF6-DB-bGHpolyA (bovine growth hormone polyA) that we cloned in pAAV2.1 hGNAT1-hRHO using NheI restriction enzyme.
AAV vector preparations
AAV vectors were produced by the TIGEM AAV Vector Core, by triple transfection of HEK293 cells followed by two rounds of CsCl2 purification (Auricchio et al., 2001). For each viral preparation, physical titers [genome copies (GC)/mL] were determined by averaging the titer achieved by dot-blot analysis (Doria et al., 2013) and by PCR quantification using TaqMan (Applied Biosystems, Carlsbad, CA, USA).
Vector administration and animal models
All procedures were performed in accordance with institutional guidelines for animal research and all of the animal studies were approved by the authors. P347S+/+ animals (Mussolino et al., 2011a; Li et al., 1996) were bred in the animal facility of the Biotechnology Centre of the Cardarelli Hospital (Naples, Italy) with C57Bl/6 mice (Charles Rivers Laboratories, Calco, Italy), to obtain the P347S+/- mice.
Mice
Intraperitoneal injection of ketamine and medetomidine (100 mg/kg and 0.25 mg/kg respectively), then AAV vectors were delivered sub-retinally via a trans-scleral transchoroidal approach as described by Liang et al. (Liang et al., 2001).
Pigs
Eleven-week-old Large White (LW) female piglets were utilized. Pigs were fasted overnight leaving water ad libitum. The anesthetic and surgical procedures for pigs were previously described (Mussolino et al., 2011b). AAV vectors were inoculated sub-retinally in the avascular nasal area of the posterior pole between the two main vascular arches, as performed in Mussolino et al. (Mussolino et al., 2011b). This retinal region is crossed by a streak-like region that extends from the nasal to the temporal edge parallel to the horizontal meridian, where cone density is high, reaching 20,000 to 35,000 cone cells mm2. Each viral vector was injected in a total volume of 100 µl, resulting in the formation of a subretinal bleb with a typical ‘dome-shaped’ retinal detachment, with a size corresponding to 5 optical discs.
Cloning and Purification of the proteins
DNA fragments encoding the sequence of the engineered transcription factors and ZF6-KRAB, to be expressed as maltose-binding protein (MBP) fusion were generated by PCR using the plasmids pAAV2.1 CMV-ZF6-KRAB and pAAV2.1 CMV-ZF6-DB as a DNA template. The following oligonucleotides were used as primers: primer 1, (GGAATTCCATATGGAATTCCCCATGGATGC) and primer 2, (CGGGATCCCTATCTAGAAGTCTTTTTACCGGTATG), for ZF6-KRAB primer 3, (GGAATTCCATATGCTGGAACCTGGCGAAAAACCG) and primer 4,(CGGGATCCCTATCTAGAAGTCTTTTTACCGGTATG) for ZF6-DB. All the PCR products were digested with the restriction enzymes NdeI and BamH1 and cloned into NdeI BamH1-digested pMal C5G (New England Biolabs, Ipswich, MA) bacterial expression vector. All the plasmids obtained were sequenced to confirm that there were no mutations in the coding sequences. The fusion proteins were expressed in the Escherichia coli BL21DE3 host strain. The transformed cells were grown in rich medium plus 0.2% glucose (according to protocol from New England Biolabs) at 37°C until the absorbance at 600 nm was 0.6–0.8, at which time the medium was supplemented with 200 µM ZnSO4, and protein expression was induced with 0.3 mM isopropyl 1-thio-β-D-galactopyranoside and was allowed to proceed for 2 hr. The cells were then harvested, resuspended in 1X PBS (pH 7.4), 1 mM phenylmethylsulfonyl fluoride, 1 µM leupeptin, 1 µM aprotinin, and 10 µg/ml lysozyme, sonicated, and centrifuged for 30 min at 27,500 relative centrifugal force. The supernatant was then loaded on amylose resin (New England Biolabs) according to the manufacturer’s protocol. To remove the MBP from the proteins, bound fusion proteins as cleaved in situ on the amylose resin with Factor Xa (1 unit/20 µg of MBP fusion protein) in FXa buffer (20 mM Tris, pH 8.0, 100 mM NaC1, 2 mM CaC12) for 24–48 hr at 4°C and collected in the same buffer after centrifugation at 500 relative centrifugal force for 5 min. The supernatant containing the protein without the MBP tag was then recovered.
Gel mobility shift analysis
The affinity binding costant of proteins for hRHO proximal promoter sequence was measured by a gel mobility shift assay by performing a titration of the proteins with the oligonucleotides. The purified proteins were incubated for 15 min on ice with hRHO 65 bp duplex oligonucleotide in the presence of 25 mM Hepes (pH 7.9), 50 mM KCl, 6.25 mM MgCl2, 1% Nonidet P-40, 5% glycerol. After incubation, the mixture was loaded on a 5% polyacrylamide gel (29:1 acrylamide/bisacrylamide ratio) and run in 0.5 TBE at 4°C (200 V for 4 hr). Protein concentration was determined by a modified version of the Bradford procedure. After electrophoresis, the gel was stained with the fluorescent dyes SYBR Green I Nucleic acid gel stain (Invitrogen, Carlsbad, CA) to visualize DNA. 2.5 µM of the ZF6-KRAB protein was incubated with increasing concentrations (130, 135, 145, 150, 165, 170, 175, 180, 190, and 200 nM, respectively) of the duplex hRHO 65 bp, an apparent higher protein concentration (2.5 µM) was required likely because not all the protein sample was correctly folded. In the case of ZF6-DB, 1.5 µM of the protein was incubated with increasing concentrations (145, 150, 170, 175, 195, 210, 220, 225, 240, and 250 nM, respectively) of the duplex hRho 65 bp. Scatchard analysis of the gel shift binding data was performed to obtain the Kd values (25). All numerical values were obtained by computer quantification of the image using a Typhoon FLA 9500 biomolecular imager (GE Healthcare Life Sciences).
qReal time PCR
RNAs from tissues were isolated using RNAeasy Mini Kit (Qiagen, Germany), according to the manufacturer protocol. cDNA was amplified from 1 μg isolated RNA using QuantiTect Reverse Transcription Kit (Qiagen), as indicated in the manufacturer instructions.The PCRs with cDNA were carried out in a total volume of 20 μl, using 10 μl LightCycler 480 SYBR Green I Master Mix (Roche, Switzerland) and 400 nM primers under the following conditions: pre-Incubation, 50°C for 5 min, cycling: 45 cycles of 95°C for 10 s, 60°C for 20 s and 72°C for 20 s. Each sample was analysed in duplicate in two-independent experiments. Transcript levels of pig retinae were measured by quantitative Real Time PCR using the LightCycler 480 (Roche) and the following primers: pRho_forward (ATCAACTTCCTCACGCTCTAC) and pRho_reverse (ATGAAGAGGTCAGCCACTGCC), pGnat1_forward (TGTGGAAGGACTCGGGTATC) and pGnat1_reverse (GTCTTGACACGTGAGCGTA), pArr3_forward (TGACAACTGCGAGAAACAGG) and pArr3_reverse (CACAGGACACCATCAGGTTG). humanRho_forward (TCATGGTCCTAGGTGGCTTC), humanRho_reverse (ggaagttgctcatgggctta) and eGFP_forward (ACGTAAACGGCCACAAGTTC) and eGFP_reverse (AAGTCGTGCTGCTTCATGTG). All of the reactions were standardized against porcine Actβ using the following primers: Act_Forward (ACGGCATCGTCACCAACTG) and Act_reverse (CTGGGTCATCTTCTCACGG).
Immunostaining
Frozen retinal sections were washed once with PBS and then fixed for 10 min in 4% PFA. Sections were immerse in a retrieval solution (0,01 M citrate buffer, pH 6.0) and boiled three times in a microwave. After the blocking solution (10% FBS, 10% NGS, 1% BSA) was added for 1 hr. The primary antibody mouse anti-HA (1:300, Covance) was diluted in a blocking solution and incubated overnight at 4°C. The secondary antibody (Alexa Fluor® 594, anti-mouse 1:1000, Molecular Probes, Invitrogen, Carlsbad, CA) has been incubated for 1 hr. Vectashield (Vector Lab Inc., Peterborough, UK) was used to visualize nuclei. Frozen retinal sections were permeabilized with 0.2% Triton X-100 and 1% NGS for 1 hr, rinsed in PBS, blocked in 10% normal goat serum (NGS), and then incubated overnight at 4°C with rabbit human cone arrestin (hCAR) antibody, kindly provided by Dr. Cheryl M. Craft (Doheny Eye Institute, Los Angeles, CA) diluted 1:10000 in 10% NGS. After three rinses with 0.1 M PBS, sections were incubated in goat anti-rabbit IgG conjugated with Texas red (Alexa Fluor 594, anti-rabbit 1:1000, Molecular Probes, Invitrogen, Carlsbad, CA) for 1 hr followed by three rinses with PBS. Frozen retinal sections were permeabilized with 0.1% Triton X-100, rinsed in PBS, blocked in 20% normal goat serum (NGS), and then incubated overnight at 4°C in a mouse anti-1D4 rhodopsin antibody diluted 1:500 in 10% NGS. After three rinses with 0.1 M PBS, sections were incubated in goat anti-mouse IgG conjugated with Texas red (Alexa Fluor® 594, anti-mouse 1:1000, Molecular Probes, Invitrogen, Carlsbad, CA) for 1 hr followed by other three rinses with PBS. Sections were photographed using either a Zeiss 700 Confocal Microscope (Carl Zeiss, Oberkochen, Germany) or a Leica Fluorescence Microscope System (Leica Microsystems GmbH, Wetzlar, Germany). Triple-immunostaining for anti-HA, anti-GNAT1, and anti-Rhodopsin antibody. Frozen retinal sections were washed once with PBS and then fixed for 10 min in 4% PFA. Sections were immerse in a retrieval solution (0,01 M sodium citrate buffer, pH 6.0) and boiled three times in a microwave. After the blocking solution (10% FBS, 10% NGS, 1% BSA) was added for 1 hr. The two primary antibody mouse anti-HA (1:300, Covance) and rabbit GαT1 (Santacruz Biotechnology), were diluted in a blocking solution and incubated overnight at 4°C. The secondary antibodies (Alexa Fluor 594, anti-mouse 1:800, Molecular Probes, and Alexa Fluor 488, anti-rabbit 1:500, Molecular Probes, Invitrogen, Carlsbad, CA) have been incubated for 1 hr, followed by three rinses with PBS. After the slides were incubated in blocking solution (10% NGS) for 1 hr and then incubated O.N. with primary antibody mouse- 1D4 (1:500, Abcam). The secondary antibodies (Alexa Fluor 405, anti-mouse 1:200, Molecular Probes, Invitrogen). Sections were photographed using a Leica Fluorescence Microscope System (Leica Microsystems GmbH, Wetzlar, Germany).
Western blot analyses
Western blot analysis was performed on retinae, which were harvested. Samples were lysed in hypotonic buffer (10 mM Tris-HCl [pH 7.5], 10 mM NaCl, 1,5 mM MgCl2, 1% CHAPS, 1 mM PMSF, and protease inhibitors) and 20 µg of these lysates were separated by 12% SDS-PAGE. After the blots were obtained, specific proteins were labeled with anti-1D4 antibody anti-Rhodopsin-1D4 (1:1000; Abcam, Cambridge, MA), and anti-β-tubulin (1:10000; Sigma-Aldrich, Milan, Italy) antibodies.
Chromatin immunoprecipitation experiments (ChIP)
For ChIP experiments, HEK293 cells were transfected by CaCl2 with pAAV2.1 CMV-ZF6-KRAB, pAAV2.1 CMV-ZF6-DB or pAAV2.1 CMV-eGFP. The cells are harvested after 48 hr. ChIP was performed as follow: cells were homogenized mechanically and cross linked using 1% formaldehyde in PBS at room temperature for 10 min, then quenched by adding glycine at final concentration 125 mM and incubated at room temperature for 5 min. Cells were washed three times in cold PBS 1X then cells were lysed in cell lysis buffer (Pipes 5 mM pH 8.0, Igepal 0.5%, KCl 85 mM) for 15 min. Nuclei were lysed in nuclei lysis buffer (Tris HCl pH8.0 50 mM, EDTA 10 mM, SDS 0.8% ) for 30 min. Chromatin was shared using Covaris s220. The shared chromatin was immunoprecipitated over night with anti HA ChIP grade (Abcam, ab 9110, Cambridge, MA). The immunoprecipitated chromatin was incubated 3 hr with magnetic protein A/G beads (Invitrogen, Carlsbad, CA). Beads were than washed with wash buffers and DNA eluted in elution buffer (Tris HCl pH 8 50 mM, EDTA 1 mM, SDS 1%). Then Real Time PCR was performed using primers on rhodopsin TSS, hRHOTSSFw (TGACCTCAGGCTTCCTCCTA) and hRHOTSSRv (ATCAGCATCTGGGAGATTGG), trasducin 1 TSS, hGNAT1TSSFw (CAGCCCTGACCCTACTGAAC) and hGNAT1TSSRv (CAACCGCTGACTCTGCACT), arrestin 3 TSS, hArr3TssFw (CCTGCTGTGCACATAAGCTG) and hArr3TssRv (CGTGTCCCACTCCAATCTCT), and β-tubulin TSS, hTUBTSSFw (TCCTGTACCCCCAAGAACTG) and hTUBTSSRv (GCTGCAAAATGAAGTGACGA).
FACS rods sorting
Co-injected porcine retina with AAV8-CMV-ZF6-DB (dose 5x1010 gc)and AAV8-GNAT1-eGFP (dose 1x1012 gc) were disaggregated using Papain Dissociation System (Worthington biochemical corporation) following the manufacturers protocol. Dissociated retinal cells were analysed using BD FACSAria at IGB (Institute of Genetic and Biophysic “A. Buzzati-Traverso”) FACS Facility and sorted, dividing eGFP positive cells (rods) from eGFP negative fraction.
Electrophysiological testing
The method is as described (Surace et al., 2005). Brifley, mice were dark reared for 3 hr and anesthetized. Flash electroretinograms (ERGs) were evoked by 10-ms light flashes generated through a Ganzfeld stimulator (CSO, Costruzione Strumenti Oftalmici, Florence, Italy) and registered as previously described. ERGs and b-wave thresholds were assessed using the following protocol. Eyes were stimulated with light flashes increasing from −5.2 to +1.3 log cd*s/m2 (which correspond to 1×10−5.2 to 20.0 cd*s/m2) in scotopic conditions. The log unit interval between stimuli was 0.3 log from −5.4 to 0.0 log cd*s/m2, and 0.6 log from 0.0 to +1.3 log cd*s/m2. For ERG analysis in scotopic conditions the responses evoked by 11 stimuli (from −4 to +1.3 log cd*s/m2) with an interval of 0.6 log unit were considered. To minimize the noise, three ERG responses were averaged at each 0.6 log unit stimulus from −4 to 0.0 log cd*s/m2 while one ERG response was considered for higher (0.0−+1.3 log cd*s/m2) stimuli. The time interval between stimuli was 10 s from −5.4 to 0.7 log cd*s/m2, 30 s from 0.7 to +1 log cd*s/m2, or 120 s from +1 to +1.3 log cd*s/m2. a- and b-waves amplitudes recorded in scotopic conditions were plotted as a function of increasing light intensity (from −4 to +1.3 log cd*s/m2, Figure 3). The photopic ERG was recorded after the scotopic session by stimulating the eye with ten 10 ms flashes of 20.0 cd*s/m2 over a constant background illumination of 50 cd/m2.
RNASeq library preparation, sequencing and alignment
The 17 libraries were prepared using the TruSeq RNA v2 Kit (Illumina, San Diego, CA) according to manufacturer’s protocol. Libraries were sequenced on the Illumina HiSeq 1000 platform and in 100-nt paired-end format to obtain approximately 30 million read pairs per sample. Sequence Reads were trimmed using Trim Galore! software (v.0.3.3), that trims low-quality ends and removes adapter from reads, using a Default Phred score of 20. To obtain a precise estimation of this yet uncharacterized tissue, the 17 libraries were aligned against the full transcriptome for Sus scrofa (Pig) as provided by ENSEMBL (SusScrofa 10.2.73). The GTF included the sequences for the 20 canonical chromosomes plus 4563 scaffolds, and counted 30.567 transcripts plus the sequences for the 3 exogenes used in the analysis (the 2 TRs and eGFP). Alignment was performed with RSEM (v.1.2.11) (Li et al., 2011) with default parameters. The resulting expected counts (the sum of the posterior probability of each read coming from a specific transcript over all reads) were used for subsequent analysis.
Differential expression analysis
The dataset was composed of 17 samples and 25.325 genes, divided in 3 experimental groups: 7 Controls, 4 ZF6-KRAB-treated, 6 ZF6-DB-treated.We analyzed the data following the standard Differential Expression Analysis Pipeline with DESeq2 R/Bioconductor package (v.1.8.1) (Love et al., 2014), filtering and normalizing all libraries together. We filtered low tag counts retaining those which had 1 CPM in at least 3 samples.We fitted a unique Generalized Linear Model (GLM) with 1 factor and 3 levels (Control, ZF6-KRAB-treated, ZF6-DB-treated). Differentially expressed genes were obtained out of the 2 contrasts (each treatment compared to the controls), an adjusted pvalue (FDR) of less than or equal to 0.1 was considered significant. We observed the expected upregulation of the exogenous genes used for the treatment (ZF6-KRAB, ZF6-DB, eGFP) and for further evaluations we didn’t take into account their differential expression.
Functional concordance
The 16 genes in common between the ZF6-DB and ZF6-KRAB DEGs were tested for functional concordance using Pearson product moment correlation coefficient (cor.test, R package stats v.3.2.0) (Huber et al., 2015; R Core Team, 2015).Two named numeric vectors, one for each condition, containing the Log fold changes values of the 16 genes were tested for association with cor.test default function, method = 'Pearson'.
Heatmap
A manually curated list of Human Gene IDs including representative Retinal Markes and a subset of Retina Disease Genes (Daiger BR et al., 1998) was used to show the interference power of the 2 TRs with the overall regulatory circuitry. The Human IDs were used to retrieve their homolog Porcine genes, if present. Genes with duplicated homolog in the Sus scrofa genome were included in the list (genes tagged with_1 in Figure 2).
Data management
All the analyses, except for the reads quality filtering, alignment and expression estimates, were performed in the R statistical environment (v.3.2.0) (Huber et al., 2015; R Core Team, 2015). Plots were generated with ggplot2 R/Bioconductor package (v.1.0.1) (Wickham, 2009).
Statistical analyses
Data are presented as mean ± Error bars indicate standard error mean (SEM). Statistical significance was computed using the Student’s two-sided t-test and p-values <0.05 were considered significant. No statistical methods were used to estimate the sample size and no animals were excluded.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your work entitled "Gene-targeted transcriptional silencing by DNA-binding" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor (Jeremy Nathans) and a Senior Editor.The following individual involved in review of your submission has agreed to reveal their identity: Eric Pierce (peer reviewer).The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.The manuscript has been reviewed by three expert reviewers, and their assessments together with my own (Reviewing editor), form the basis of this letter.All of the reviewers were impressed with the importance and novelty of your work, and we would like to see a revision that addresses the issues raised.I am including the three reviews (lightly edited) at the end of this letter, as there are some specific and useful suggestions in them that will not be repeated in the summary here. Also, we think that this manuscript would be a better fit as a "Tools and Resources" paper rather than a regular research paper.The main issues, which I have extracted from the reviews and the subsequent discussion between the reviewers and me, are:1) Revisions to the text that focus the story on use of the ZF6-DB to suppress RHO expression. This could be accomplished by changing the title, and revising the Introduction and Discussion. We would favor moderating the claims about potential clinical use of this approach since the repression-replacement approach wasn't tested in a disease model.2) There is a question of ZF6-DB specificity and efficiency. Please provide the porcine, human, and mouse RHO TSS sequences for comparison, since it appears that the ZF6-DB recognizing hRHO TSS was used in these models regardless of any differences between the sequences. Does ZF6-DB recognize the porcine and mouse sequence? As to clinical therapeutic potential, how do the pig and human repression efficiencies compare? Is the 35% repression of Rho expression sufficient for dominant disease? These are important questions that could be addressed by supplying the sequences and the related data.3) It is unclear why cone arrestin increases in Arr3. This suggests that there may be off-target effects. Does ZF6-DB also bind to the Arr3 TSS region? ChIP data should be supplied to address off-target issues.4) Figure 3 would benefit from the presentation of wild type mouse data. For example, eGFP, ZF6-KRAB, and ZF6-DB treatments of wild type mice to serve as a point of comparison and investigate the efficiency of ZF6-DB suppression of human and mouse rhodopsin respectively.5) Regarding the repression-replacement experiment described in Figure 4, it is not clear why a different promoter (CMV) was used in the control ZF6-DB vector than that used for the ZF6-DB cassette (modified RHO promoter) in the in the experimental ZF6-DB – RHO expression vector.6) The level of repression of the RHO gene achieved in the repression-replacement experiment described in Figure 4 is moderate. It is likely that greater than 35% suppression of a mutant RHO allele would be needed to have a therapeutic effect for patients affected by retinal degeneration due to gain-of-function mutations in RHO. While the data reported in Figure 1 suggest that repression of RHO expression in transduced photoreceptor cells is closer to 90%, it is unclear if suppressing RHO expression in 35% of photoreceptor cells would be therapeutic. Additional experiments to optimize the dose response and evaluate the potential of this approach for therapeutic use are needed to support the claim that a ZF6-DB based approach has the potential to be used clinically.7) Clarity of presentation as indicated below by reviewers #2 and #3.We look forward to receiving the revised version of your manuscript.Reviewer #1:Summary: Botta et al. report a method for gene-specific transcriptional silencing using an engineered DNA-binding domain, "ZF6-DB." AAV-mediated expression of ZF6-DB in photoreceptors resulted in blockade of Rho expression, leading to therapeutic effects in animal models with gain-of-function cis- Rho mutations, such as autosomal dominant retinitis pigmentosa.Feedback:Experiment 1-showed the 20 bp in ZF6-cis is required for Rho expression via eGFP reporter assay. ChIP showed ZF6-DB binds well to CRE. Put ZF6-DB into porcine retina using AAV and measured Rho transcripts, which were decreased. Finally, they compared ZF6-DB with eGFP expression levelsCriticism: n = 2 is a low number. They should supplement their claims with additional data points.Experiment 2-Compared Rho transcription levels between ZF6-KRAB and ZF6-DB, found greater repression using ZF6-DB and less transcriptional perturbation.Criticism: They claim that ZF6-KRAB and ZF6-DB bind to same genomic targets, but they didn't explain or otherwise address the possibility that the difference in the transcription perturbations may in fact be caused by off-targeting effects or the down-regulation of RHO expression. Should perform ChIP to confirm the two are binding to the same region (as well as Crx and Nrl). Figure 2C is confusing: comparing before and after ZF6-DB treatments, rather than different constructs would be more helpful.Experiment 3-Compared the ERG a and b waves in the P347S RP murine model and saw much greater rescue in ZF6-DB compared with ZF6-KRAB or eGFP.Criticism: they should further explore the reason that ZF6-DB has such a greater rescue than ZF6-KRAB despite their similar binding affinity (according to Figure 2—figure supplement 2). This is a surprising discrepancy that merits exploration and explanation. It would also be helpful for them to repeat this experiment in wild type animals to see if ZF6-DB also represses RHO expression and compare the percentage of repression in wild type and R347S alleles.Experiment 4-Created construct with ZF6-DB and hRHO and found suppression of mutant mouse Rho and expression of the hRHO.Criticism: unclear why they didn't consistently use the CMV promoter and opted for the truncated Rho promoter, despite similar repression levels of RHO. Any rescue beyond P30?Reviewer #2:This manuscript describes the use of a synthetic DNA binding protein to interfere with expression of the RHO gene. The experiments described build on prior work in which a hybrid protein consisting of a DNA binding domain coupled to a KRAB repressor domain was used to repress expression of the RHO gene. In this study, the activity of the DNA binding domain alone was evaluated.It seems that the manuscript attempts to achieve two goals, and does not completely succeed for either. One focus is the potentially general idea that DNA binding proteins alone targeted to regulatory elements can be used to regulate expression of target genes. The data presented regarding the ZF6-DB for RHO support this idea, but without testing this hypothesis for other genes, the potential to use this approach more generally remains in question. The second focus is the idea that repression of RHO could be used therapeutically in patients with retinal degeneration caused by dominant, gain-of-function mutations in this gene. Since the ZF6-DB mediated repression of RHO expression isn't specific for the mutant allele, a repression-replacement strategy would be needed in patients. The tests of this approach described in the manuscript show some efficacy, but fall short of being convincing.Specific comments are as follows:1) Additional studies of the ZF6-DB approach with 1 or more additional genes would be needed to support the hypothesis that DNA binding proteins can be used broadly to regulate gene expression. Such data needs to be added to the manuscript, or the manuscript needs to be revised to focus on the specific application of this approach to the RHO gene.2) The level of repression of the RHO gene achieved in the repression-replacement experiment described in Figure 4 is moderate. It is likely that greater than 35% suppression of a mutant RHO allele would be needed to have a therapeutic effect for patients affected by retinal degeneration due to gain-of-function mutations in RHO. While the data reported in Figure 1 suggest that repression of RHO expression in transduced photoreceptor cells is closer to 90%, it is unclear if suppressing RHO expression in 35% of photoreceptor cells would be therapeutic. Additional experiments to optimize the dose response and evaluate the potential of this approach for therapeutic use are needed to support the claim that a ZF6-DB based approach has the potential to be used clinically.3) Along these lines, the experiment testing the activity of the ZF6-DB in the transgenic RHO-P347S mice is helpful, but does not support the use of the ZF6-DB mediated RHO repression approach in patients, since the mutant human transgene is present on a mouse background. It would be better to test the activity of the ZF6-DB in a model with a mutant mouse allele, and include the complete repression-replacement approach in these studies.4) The ChIP experiment is helpful to show occupancy of the RHO CRE by ZF6-DB. It would be helpful to report what other sequences were detected in the ChIP experiment. That is, what else does the RHO ZF6-DB bind to? Additional ChIP data to address the question of what proteins normally occupy the RHO regulatory element would also be helpful.5) The repression of GNAT1 expression observed following treatment with the RHO ZF6-DB is interesting. Is there a similar CRE upstream of the GNAT1 gene? Or is some other mechanism responsible to the linked regulation of expression, as suggested by the data in Figure 4? Further exploration of this issue is warranted.6) The relative specificity of the ZF6-DB activity compared to that observed using the hybrid ZF6-DB-KRAB ED protein is impressive. Other studies have used more than 30 million sequence reads to sample gene expression by the neural retina thoroughly. It would be helpful to know why 30 million reads were used in this study, and if this provides complete sampling of retinal transcripts.7) The discussion about the mechanism of ZFN-DB activity is interesting, but is beyond the data available in the current manuscript. The Discussion would be better focusing on interpreting the data in the manuscript.Reviewer #3:Botta and colleagues report on in vivo targeted silencing of rhodopsin expression by transcription factor proteins -with and without effector domain (ED)- engineered to recognize a 20 bp-cis-regulatory element of the proximal region of the rhodopsin promoter. They provide data which support the view that both engineered transcription factor proteins, with and without ED, suppresses rhodospin expression by DNA binding with similar affinities to the 20 bp-cis-regulatory element. They show that the engineered transcription factor lacking the effector domain silences rather specifically the expression of rhodopsin gene as determined by transcriptome analyses. They report that AAV-based delivery of the engineered rhodopsin-specific transcription factor protein without ED to the retina of a transgenic mouse with a human rhodopsin gene harboring a dominant negative RHO mutation prevented retinal degeneration. Finally, as a first step towards the use of this original strategy in the clinics, they nicely demonstrate that AAV-based delivery of pig-specific rhodospin silencing transcription factor protein without ED and of human Rhodopsin permitted preservation of retinal cells which deprived of pig-rhodopsin expressed the human counterpart.This is very nicely designed and executed study with real therapeutic promises. I have no major concern regarding the scientific aspects of this sound work.I have however a major critic regarding the writing of the manuscript which makes this beautiful piece of work sometimes very hard to follow. Here are some points to clarify:1) Figure 1A: I would suggest to show clearly which nucleotide corresponds to +1 and which is the -84 -65 ZF6-cis sequence and to provide a legend mentioning each of the CRE that appear on the scheme.2) Figures 1C and 1E are a little confusing as in 1C the green corresponds to the e-GFP whereas in 1E that is just below the green labels the rhodopsin.3) Anti-HA is used both in immunochemistry and CHIP analysis but it is not clearly mentioned that the constructs which were used encode this flag.4) CHIP-seq analysis: I would suggest to precise before giving the results a short sentence describing what was done, i.e. AAV-based delivery of constructs encoding eGFP or silencing transcription factor protein with or without ED in HEK293 cells, immunoprecipitation using the HA tag and RT-PCR amplification using primers flanking (where are they by the way?). The supporting figure is obscure. What are the MOCKs? Why is there no mention of the results using the CMV-ZF6-KRAB construct?In these experiments AAV2.1vectors were used whereas some others used AAV8. Not all the readers are aware of their tropism differences.5) Transcriptomic analyses. Despite the importance of this analysis I have been unable to find in the manuscript reference to what was exactly done. How were the transduced cells collected? Were the transduced regions microdissected and then the rods FACs sorted? How were the mRNA outputs from the transduced versus the untransduced regions matched?Overall, I would suggest the authors to submit their revised manuscript to a colleague that is not involved in this work to ensure clarity.[Editors' note: further revisions were requested prior to acceptance, as described below.]Thank you for resubmitting your work entitled "RHODOPSIN-targeted transcriptional silencing by DNA-binding" for further consideration at eLife. Your revised article has been favorably evaluated by a Senior editor and Jeremy Nathans as the Reviewing editor. The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:It looks substantially improved, but there is one aspect of the writing that needs work: various words or phrases that imply an absolute or extreme conclusion are over-stating the data. For example, in the Abstract is the phrase "complete gene silencing". The data do not support the use of the word "complete" – indeed, quantitative biological data only rarely support the use of that word. The best one can say of any observation of this type is that the signal is below the limit of detection. I suggest substituting the word "efficient" for "complete". Similarly, in the title of the legend to Figure 1 is the phrase "abolishes Rho expression". I suggest changing this to "dramatically reduces Rho expression". Please go through the manuscript carefully to make changes of this sort. My view is that your data speaks for itself, and that the manuscript should be carefully written so as to avoid over-stating the data.The main issues, which I have extracted from the reviews and the subsequent discussion between the reviewers and me, are: 1) Revisions to the text that focus the story on use of the ZF6-DB to suppress RHO expression. This could be accomplished by changing the title, and revising the Introduction and Discussion. We would favor moderating the claims about potential clinical use of this approach since the repression-replacement approach wasn't tested in a disease model.We changed the title, revisited the Abstract and the Discussion to focus on RHO transcriptional repression by DNA binding. In addition, we now moderated the claim about the potential clinical use in both the Abstract and the Discussion.2) There is a question of ZF6-DB specificity and efficiency. Please provide the porcine, human, and mouse RHO TSS sequences for comparison, since it appears that the ZF6-DB recognizing hRHO TSS was used in these models regardless of any differences between the sequences. Does ZF6-DB recognize the porcine and mouse sequence? As to clinical therapeutic potential, how do the pig and human repression efficiencies compare? Is the 35% repression of Rho expression sufficient for dominant disease? These are important questions that could be addressed by supplying the sequences and the related data.We provided the porcine, human, and mouse RHO TSS sequences for comparison (Figure 1—figure supplement 1). As shown now in the figure (Figure 1—figure supplement 1) human and porcine RHO TSS share 19 out of 20 DNA bp whereas, the mouse RHO TSS sequence diverges from that of human. The differences in sequence present in the mouse RHO TSS make it resistant to the activity of the ZF6-DB. As now shown (Figure 3B), the use of the ZF6-DB in wild-type mice did not result in any detectable effects as assessed by ERG analysis, thus supporting the specificity of the effect of ZF6-DB on both the human RHO promoter (present as a transgene in the P347S mouse model of adRP) and on the porcine RHO promoter.Regarding the 35% repression of Rho expression in the whole porcine retina we agree that it might not be sufficient to treat a dominant disease such as adRP, although in singularly transduced cell (sorted rods) the repression almost reached 90%. We stated in the Discussion that the study provided a proof of concept and there is room of improvement the efficiency of the strategy on the whole retina scale in order to ensure therapeutic benefit.We added one additional retinal sample in the silencing and replacement experiment which now has n= 3 (Figure 4B).We added one additional rod sorted sample in the silencing experiment which now has n= 3 (Figure 1H).3) It is unclear why cone arrestin increases in Arr3. This suggests that there may be off-target effects. Does ZF6-DB also bind to the Arr3 TSS region? ChIP data should be supplied to address off-target issues.The increase of cone arrestin in Arr3 data did not show a statistically significant difference compared to other experimental groups. However, as suggested we performed ChIP analysis amplifying the proximal promoter region of Arr3 after pull down. As shown in Figure 1—figure supplement 1 we did not observe pull-down enrichment of Arr3 promoter fraction after PCR amplification, thus confirming the apparent lack of physical binding of ZF-DB on the Arr3 proximal promoter. RNA-seq data also confirmed the lack of differential expression of the Arr3 transcript in the samples.In addition, after adding a further sample in the silencing and replacement experiment (as stated in response to comment #2) the Arr3 levels do not appear to be different from the control.4)As stated in response to comment #2, we added data on eGFP, ZF6-KRAB, and ZF6-DB treatments of wild type mice. As now shown in Figure 3 the ERG analysis did not show any detectable effects compared to untreated controls. This suggests that the absence of binding of ZF6-DB does not result in any detrimental effects (the mouse RHO TSS sequence diverges and lacks the ZF6-DB binding site).5) Regarding the repression-replacement experiment described in –RHO expression vector.We used the CMV that was used in the previous experiments (Figure 1D) as an internal control for the experiment using the ZF6-DB-RHO expression vector (silencing and replacement). As shown in Figure 4B-D, the expression of ZF6-DB driven by both the CMV and the mutant RHO promoters both generated similar porcine Rho repression (RT-PCR experiment) and ZF6-DB rod nuclei expression, as assessed by anti-HA immunostaining, respectively. Currently, we are testing a series of mutant promoter elements with different strengths at a fixed vector dose to determine the impact on expression of ZF6-DB and in turn on Rho repression levels with the final aim of improving the overall suppression of Rho on the whole retina. We believe that these experiments will serve better as part of a separate study.6) The level of repression of the RHO gene achieved in the repression-replacement experiment described inAs stated in responses to comment #1 and #2 we agree that the 35% (which has now become 38%) of whole retinal transduction may not be therapeutically effective. Accordingly, as with comment 1, we changed the claim regarding the therapeutic effect and we stated in the Discussion: “Therefore, a further development of this proof-of-concept will include optimization of the design of the silencing and replacement double construct (tuning the strength of the promoter elements), vector selection and dose, and the surgical approach”.7) Clarity of presentation as indicated below by reviewers #2 and #3.Done accordingly.[Editors' note: further revisions were requested prior to acceptance, as described below.]It looks substantially improved, but there is one aspect of the writing that needs work: various words or phrases that imply an absolute or extreme conclusion are over-stating the data. For example, in the Abstract is the phrase "complete gene silencing". The data do not support the use of the word "complete" – indeed, quantitative biological data only rarely support the use of that word. The best one can say of any observation of this type is that the signal is below the limit of detection. I suggest substituting the word "efficient" for "complete". Similarly, in the title of the legend toAccording to the suggestions, we went through the manuscript carefully to mitigate absolute conclusions that may not be supported by the data.The point-by-point changes are as follow:In the Abstract: “efficient” replaced “complete”.In the section “Photoreceptor genomic binding of a 20 bp-long DNA sequence by a synthetic DNA-binding protein turns off Rhodopsin expression”:“complete” was removed, resulting in the sentence that states: “showed loss of EGFP expression compared[…]”.“complete” was removed, resulting in the sentence that states: “Immunofluorescence analysis showed depletion of Rho protein[…]”.“strongly” was removed, resulting in the sentence that states: “These data suggest that, despite the presence of an active canonical repressor domain[…]”.“exclusively” was removed, resulting in the sentence that states: “ZF6-KRAB generated Rho silencing by DNA binding[…]”.“any” was substituted with “detectable”, resulting in the sentence that states: “ZF6-DB in C57Bl/6 wild type retina did not produce detectable functional detrimental effects[…]”.“balance” was removed resulting in the sentence that states: “transcriptional repression of the porcine Rho (38%) and in concomitant replacement of the exogenous hRHO (68%)[…]”.“full recovery” is now substituted with “complementation” resulting in the sentence that states: “Notably, Gnat1 transcript and protein (data not shown) levels demonstrated complementation[…]”.In the first sentence of the discussion we substituted “turn off” with “dramatically reduces”.The following sentence: “The retina co-transduced with eGFP and ZF6-DB vector showed virtually a “somatic knock-out” of Rho expression (~85% decrease of Rho transcript levels)”, may appear an over-stating claim. However, we believe that “virtually” counterbalances the strong “somatic knock-out”, highlighting the impact of the finding.In the title of the legend to Figure 1 the sentence "abolishes Rho expression" is in now changed with "dramatically reduces Rho expression".We changed the sentence: “We propose a model in which the molecular features of the DNA (loop, twisting, bending, position, for instance) may contribute to the transcriptional interference observed” with: “We propose a model in which the molecular features of the DNA (loop, twisting, bending, position, for instance) may contribute to Rhodopsin transcriptional output”.We added the following sentence that we believe completes the theoretic thinking in the Discussion:“It follows that in terms of signaling, the information source, the DNA, generates an output signal the RNA and eventually a protein, whose final output functional activity is completed back by the DNA. Thus the information source, the DNA, becomes also integral part of the signaling (Rhodopsin transcriptional output)”.Regarding the impact statement, I would favor the concise message of “turns off”: “Photoreceptor genomic binding of a 20 bp-long DNA sequence by a synthetic DNA-binding protein turns off Rhodopsin expression”.
Authors: Jamie C Kwasnieski; Ilaria Mogno; Connie A Myers; Joseph C Corbo; Barak A Cohen Journal: Proc Natl Acad Sci U S A Date: 2012-11-05 Impact factor: 11.205
Authors: T P Dryja; T L McGee; L B Hahn; G S Cowley; J E Olsson; E Reichel; M A Sandberg; E L Berson Journal: N Engl J Med Date: 1990-11-08 Impact factor: 91.245
Authors: C Mussolino; M della Corte; S Rossi; F Viola; U Di Vicino; E Marrocco; S Neglia; M Doria; F Testa; R Giovannoni; M Crasta; M Giunti; E Villani; M Lavitrano; M L Bacci; R Ratiglia; F Simonelli; A Auricchio; E M Surace Journal: Gene Ther Date: 2011-03-17 Impact factor: 5.250
Authors: Silvana Konermann; Mark D Brigham; Alexandro Trevino; Patrick D Hsu; Matthias Heidenreich; Le Cong; Randall J Platt; David A Scott; George M Church; Feng Zhang Journal: Nature Date: 2013-08-23 Impact factor: 49.962
Authors: Pingjuan Li; Benjamin P Kleinstiver; Mihoko Y Leon; Michelle S Prew; Daniel Navarro-Gomez; Scott H Greenwald; Eric A Pierce; J Keith Joung; Qin Liu Journal: CRISPR J Date: 2018-02
Authors: Artur V Cideciyan; Raghavi Sudharsan; Valérie L Dufour; Michael T Massengill; Simone Iwabe; Malgorzata Swider; Brianna Lisi; Alexander Sumaroka; Luis Felipe Marinho; Tatyana Appelbaum; Brian Rossmiller; William W Hauswirth; Samuel G Jacobson; Alfred S Lewin; Gustavo D Aguirre; William A Beltran Journal: Proc Natl Acad Sci U S A Date: 2018-08-20 Impact factor: 11.205
Authors: Wen-Hsuan Wu; Yi-Ting Tsai; I-Wen Huang; Chia-Hua Cheng; Chun-Wei Hsu; Xuan Cui; Joseph Ryu; Peter M J Quinn; Salvatore Marco Caruso; Chyuang-Sheng Lin; Stephen H Tsang Journal: Mol Ther Date: 2022-02-10 Impact factor: 12.910
Authors: Karen Clauß; Achim P Popp; Lena Schulze; Johannes Hettich; Matthias Reisser; Laura Escoter Torres; N Henriette Uhlenhaut; J Christof M Gebhardt Journal: Nucleic Acids Res Date: 2017-11-02 Impact factor: 16.971
Authors: Salvatore Botta; Nicola de Prisco; Elena Marrocco; Mario Renda; Martina Sofia; Fabiola Curion; Maria Laura Bacci; Domenico Ventrella; Cathal Wilson; Carlo Gesualdo; Settimio Rossi; Francesca Simonelli; Enrico Maria Surace Journal: JCI Insight Date: 2017-12-21