Liver receptor homolog 1 (Lrh1, also known as Nr5a2) belongs to the orphan nuclear receptor superfamily and has diverse functions in development, metabolism, and cell differentiation and death. Lrh1 regulates the expression of Oct4, which is a key factor of early embryonic differentiation. However, the role of Lrh1 in early development of mammalian embryo is unknown. In the present study, the localization, Lrh1 mRNA expression, and LRH1 protein levels in porcine early parthenotes were examined by immunofluorescence and real-time reverse-transcription polymerase chain reaction. To determine the role of Lrh1 in porcine early embryo development, the parthenotes were treated with the specific LRH1 antagonist 505601. The immunofluorescence signal for LRH1 was only observed in the nucleus of blastocysts. The blastocyst developmental rate in the presence of 50 and 100 μM 505601 was significantly lower than that in the control group. The blastocyst hatching rate was also reduced in the presence of 50 and 100 μM 505601 than that under control conditions. The latter effect was possibly due to the decreased expression of hatching-related genes such as Fn1, Itgα5, and Cox2 upon the inhibition of Lrh1. Incubation with the LRH1 antagonist also increased the number of apoptotic cells among the blastocysts. Moreover, LRH1 inhibition enhanced the expression of the pro-apoptotic genes Bax and Casp3, and reduced the expression of the anti-apoptotic gene Bcl2. Lrh1 inhibition also led to significant decrease in the expression levels of Oct4 mRNA and octamer-binding transcription factor 4 (OCT4) protein in the blastocysts. In conclusion, Lrh1 affects blastocyst formation and hatching in porcine embryonic development through the regulation of OCT4 expression and cell apoptosis.
Liver receptor homolog 1 (Lrh1, also known as Nr5a2) belongs to the orphan nuclear receptor superfamily and has diverse functions in development, metabolism, and cell differentiation and death. Lrh1 regulates the expression of Oct4, which is a key factor of early embryonic differentiation. However, the role of Lrh1 in early development of mammalian embryo is unknown. In the present study, the localization, Lrh1 mRNA expression, and LRH1 protein levels in porcine early parthenotes were examined by immunofluorescence and real-time reverse-transcription polymerase chain reaction. To determine the role of Lrh1 in porcine early embryo development, the parthenotes were treated with the specific LRH1 antagonist 505601. The immunofluorescence signal for LRH1 was only observed in the nucleus of blastocysts. The blastocyst developmental rate in the presence of 50 and 100 μM 505601 was significantly lower than that in the control group. The blastocyst hatching rate was also reduced in the presence of 50 and 100 μM 505601 than that under control conditions. The latter effect was possibly due to the decreased expression of hatching-related genes such as Fn1, Itgα5, and Cox2 upon the inhibition of Lrh1. Incubation with the LRH1 antagonist also increased the number of apoptotic cells among the blastocysts. Moreover, LRH1 inhibition enhanced the expression of the pro-apoptotic genes Bax and Casp3, and reduced the expression of the anti-apoptotic gene Bcl2. Lrh1 inhibition also led to significant decrease in the expression levels of Oct4 mRNA and octamer-binding transcription factor 4 (OCT4) protein in the blastocysts. In conclusion, Lrh1 affects blastocyst formation and hatching in porcine embryonic development through the regulation of OCT4 expression and cell apoptosis.
Blastocyst hatching from the zona pellucida is a critical event during the attachment of the blastocyst to the
uterine epithelium before implantation [1]. Any dysregulation of the
hatching process causes implantation failure, which leads to infertility [2]. Blastocyst hatching is controlled by an extremely complicated interplay of various cellular factors
and biomolecules, which are regulated in a defined spatio-temporal fashion [3].Liver receptor homolog 1 (Lrh1, also known as Nr5a2) belongs to the orphan
nuclear receptor superfamily and has diverse functions in the development, metabolism, and cell differentiation
and death. Lrh1 plays important roles in bile acid biosynthesis [4], cholesterol metabolism [5], and glucose sensing [6] in the liver. In the ovaries, Lrh1 regulates steroid
synthesis [7], pregnancy time course [8], maturation of ovarian follicles, and ovulation [9].
Lrh1 is also a critical factor in embryonic development. Mice with a homozygous null mutation
of the Lrh1 gene die on around embryonic day 7.5 and exhibit pathological features typical of
visceral endoderm dysfunction [10].Several studies have demonstrated that Lrh1 is highly expressed in embryonic stem cells (ESCs).
In cooperation with its partner Dax1, Lrh1 activates the transcription of
Oct4, which encodes the key factor for maintaining the pluripotency of mouse ESCs [11-13]. Lrh1 acts
upstream of Oct4 and regulates Oct4 expression during the epiblast stage of
mouse embryonic development [14]. In addition, Lrh1 not
only increases the reprogramming efficiency, but also substitutes for exogenous Oct4 in
reprogramming mouse embryonic fibroblasts to induced pluripotent stem cells (iPSCs), which further underscores the
relationship between the two genes and highlights the important role of Lrh1 in regulating
Oct4 and maintaining pluripotency [15]. On the other
hand, Oct4 is essential for porcine embryo development, as can be inferred from the effects of
Oct4 small interfering RNA treatment on porcine blastocyst formation [16]. Overexpression of Oct4 enhances the proliferation of porcine embryos
[17], however, the function of Lrh1 in porcine
blastocyst formation is still unknown. We hypothesized that Lrh1 plays a critical role in porcine
early embryonic development by regulating the expression of the octamer-binding transcription factor 4 (OCT4).Several studies have addressed the function of Lrh1 in the regulation of ESC pluripotency and
differentiation, however little information is available on the actions of Lrh1 in porcine early
embryo development. It has been demonstrated that porcine parthenogenetic diploids can develop to the blastocyst
stage just as in fertilized porcine embryos [18]. Furthermore, researchers
have shown the successful development of parthenogenetic porcine embryos to the post-implantation stage [19]. However, porcine embryos of homogeneous quality are difficult to obtain
because of the relatively high incidence of polyspermy during in vitro fertilization (IVF) [20]. Therefore, parthenogenetic diploids could be used as model embryos for
early development studies in pigs [21]. To investigate the developmental
role of Lrh1, parthenotes were treated with a specific LRH1 antagonist and the blastocyst
formation and OCT4 expression levels were analyzed. We demonstrated that Lrh1 may play an
important role in blastocyst formation and hatching through the regulation of OCT4 and apoptosis. Therefore,
Lrh1 is possibly a critical factor in early porcine embryo development.
Materials and Methods
Oocyte collection, in vitro maturation, and embryo culture
Ovaries from prepubertal gilts were obtained from a local slaughterhouse, maintained in saline at 37°C, and
transported to the laboratory. Cumulus oocyte complexes (COCs) were isolated from follicles and washed three
times in Tyrode’s lactate-4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid. The COCs were cultured in tissue
culture medium 199 (TCM 199) supplemented with 10% porcine follicular fluid, 0.1 g/l sodium pyruvate, 0.6 mM
L-cysteine, 10 ng/ml epidermal growth factor, 10 IU/ml luteinizing hormone, and 10 IU/ml follicle stimulating
hormone at 38.5°C for 44 h in a humidified atmosphere of 5% CO2 and 95% air. After maturation,
cumulus cells were removed by treatment with 0.1% hyaluronidase for 2–3 min and repeated pipetting. For
parthenogenetic activation, oocytes with polar bodies were selected and activated by two direct current (DC)
pulses of 1.1 kV/cm for 60 µsec and then incubated in the porcine zygote medium (PZM-5) containing 7.5 μg/ml
of cytochalasin B for 3 h. Finally, the embryos were cultured in PZM-5 medium for 8 days at 38.5°C in a
humidified atmosphere of 5% CO2 and 95% air. On the fifth day, fetal bovine serum (FBS) was added
to the medium to a total concentration of 4%. To observe the effect of LRH1 on porcine early embryo
development, the LRH1 antagonist 505601 (Merck Millipore, Darmstadt, Germany) was added to the medium used for
parthenogenic activation to obtain final concentrations of 50 or 100 μM.
Twenty oocytes and 40 embryos were collected initially (at 0 h) and after culturing the oocytes for 48 h. The
oocytes had been activated for 24, 30, 43, or 144 h corresponding to the GV, MII, one-cell, two-cell,
four-cell, and blastocyst stages, respectively. mRNA was extracted from 10 oocytes per group with a Dynabeads
mRNA Direct Kit (DynalAsa, Oslo, Norway) according to the manufacturer’s instructions. cDNA was obtained by
reverse transcription of the mRNA using the Oligo (dT)12-18 primer and SuperScript TM III Reverse
Transcriptase (Invitrogen, Grand Island, NY, USA). The amplification cycles used were as follows: 95°C for 3
min followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec, and 72°C for 20 sec, and a final extension at
72°C for 5 min. The relative quantification of gene expression was normalized to internal porcine
Gapdh mRNA levels using the 2−ΔΔCT method. The primers used to amplify each gene
are shown in Table 1.
Table 1.
List of primers used for real-time reverse-transcription polymerase chain reaction
Gene
Primer Sequence (5′–3′)
Annealing temperature (°C)
Product size (bp)
Lrh1
F:GGTACCACTATGGGCTCCTCACR:TCGGCCCTTACCGCTTCT
60
193
Fn1
F:AGGGCGATGAACCACAGTR:GCTCCAGCGAACGACAAT
60
221
Itgα5
F:TGATGACAGTTATTTGGGCTACR:CAAAGTCCTCGCTGCTCT
60
100
Cox2
F:GGCTGCGGGAACATAATAGAR:GCAGCTCTGGGTCAAACTTC
55
183
Bcl2
F:GCCGAAATGTTTGCTGACR:GCCGATCTCGAAGGAAGT
60
154
Bax
F:GATCGAGCAGGGCGAATGR:GGGCCTTGAGCACCAGTTTA
60
277
Casp3
F:GACGGACAGTGGGACTGAAGAR:GCCAGGAATAGTAACCAGGTGC
60
101
Oct4
F: CCCCGCCCTATGACTTCTR: TAGGAGCTTGGCAAATTGTTC
60
269
F-actin
F:AGTTCACCATCACACCACCTACAR:CTTGGCAGTTTGGGCTTCATTC
60
146
Gapdh
F: TTCCACGGCACAGTCAAGR: ATACTCAGCACCAGCATCG
60
117
Immunofluorescence and confocal microscopy
Oocytes and embryos were fixed in 3.7% paraformaldehyde for 20 min at room temperature, permeabilized with
phosphate buffered saline/polyvinyl alcohol (PBS/PVA) containing 1.0% Triton X-100 at 37°C for 1 h, and then
incubated in PVA-PBS containing 3.0% bovine serum albumin at 37°C for 1 h. Subsequently, the oocytes and
embryos were incubated overnight at 4°C with an anti-LRH1 antibody (ab153944, 1:100; Abcam, Cambridge, UK) and
an anti-OCT4 antibody (sc8628, 1:100; Santa Cruz Biotechnology, CA, USA). After washing three times in
PBS/PVA, the oocytes and embryos were incubated at 37°C for 1 h with either goat anti-rabbit IgG or rabbit
anti-goat IgG. The oocytes and embryos were then stained with Hoechst 33342 for 5 min, washed three times in
PBS/PVA, mounted onto slides, and examined using a confocal microscope (Zeiss LSM 710 META, Jena, Germany).
Images were processed using Zen software (version 8.0, Zeiss, Jena, Germany).
After the oocytes were treated with different concentrations of the LRH1 antagonist, the blastocysts were
collected. The blastocysts were fixed in 3.7% paraformaldehyde for 30 min at room temperature and then
permeabilized by incubation in 1% Triton X-100 for 1 h at 37°C. The embryos were incubated with
fluorescein-conjugated dUTP and the terminal deoxynucleotidyltransferase enzyme (In Situ Cell
Death Detection Kit, Roche, Mannheim, Germany) for 1 h at 37°C and then washed three times in PBS/PVA. Embryos
were treated with Hoechst 33342 for 5 min to stain the DNA, washed three times in PBS/PVA, and mounted onto
glass slides. Images were captured using a confocal microscope.
Statistical analysis
All data were analyzed with a one-way analysis of variance and differences between the treatment groups were
assessed by the least significant difference test using Statistical Package for the Social Sciences (SPSS)
software. Each experiment was performed at least in triplicate and differences were considered to be
significant if P < 0.05.
Results
Expression and localization of Lrh1 in porcine embryos
Before investigating the function of Lrh1 in early embryo development, the expression level
and subcellular localization of this protein were initially examined. As shown in Fig. 1A, Lrh1 mRNA was expressed throughout porcine oocyte maturation and the early embryo
developmental stages, although, these expression levels were significantly higher at the blastocyst stage than
during other embryonic stages. To investigate the subcellular localization of the LRH1 protein, porcine
embryos at different stages were cultured and processed for immunofluorescent staining. An anti-LRH1 antibody
was used to detect LRH1 localization (Fig. 1B). An LRH1
immunofluorescence signal was only observed in the nucleus of the blastocysts, but not during other stages. On
the basis of these findings, we concluded that Lrh1 may play a role during the
pre-implantation stage.
Fig. 1.
Lrh1 mRNA expression and localization in porcine oocytes and early embryos at various
developmental stages. (A) mRNA was collected during different phases of porcine embryo development. (B)
Laser scanning confocal microscopy images of liver receptor homolog 1 immunostaining during the MII, 2C,
4C, and blastocyst stages. GV, MII, 1C, 2C, 4C, and BL indicate germinal vesicle, meiosis II, one-cell
stage, two-cell stage, four-cell stage, and the blastocyst, respectively. ** indicates statistically
significant difference (P < 0.01) from GV. Data are presented as the mean (± standard deviation of
the mean) of three independent experiments.
Lrh1 mRNA expression and localization in porcine oocytes and early embryos at various
developmental stages. (A) mRNA was collected during different phases of porcine embryo development. (B)
Laser scanning confocal microscopy images of liver receptor homolog 1 immunostaining during the MII, 2C,
4C, and blastocyst stages. GV, MII, 1C, 2C, 4C, and BL indicate germinal vesicle, meiosis II, one-cell
stage, two-cell stage, four-cell stage, and the blastocyst, respectively. ** indicates statistically
significant difference (P < 0.01) from GV. Data are presented as the mean (± standard deviation of
the mean) of three independent experiments.
Effect of Lrh1 on the development of porcine parthenotes
In order to investigate the functions of Lrh1 in development, parthenotes were treated with
different concentrations of the LRH1-specific antagonist 505601. No significant differences in the
developmental rates for the two-cell and four-cell stages were observed between the treatment and control
groups. However, the blastocyst development rates in the presence of 50 and 100 μM of 505601 (37.30 ± 3.67%
and 20.10 ± 2.81%, respectively) were significantly lower than that of the control group (53.43 ± 3.67%, Fig. 2A). The blastocyst hatching rates were also reduced (P < 0.01) by the treatment with 50 or 100 μM
505601 (12.66 ± 3.13% and 20.10 ± 2.81%, respectively) from the hatching rate in the control (40.59 ±
0.59%).
Fig. 2.
The effect of liver receptor homolog 1 (LRH1) inhibition on the embryo development. The parthenotes
were treated with the specific LRH1 antagonist 505601 in concentrations of 50 or 100 μM. (A) The
percentages of those in the two-cell, four-cell, blastocyst, and hatching blastocyst stages are shown by
bars. (B) The images of embryos treated with different concentrations of 505601 are shown. (C)
Expression of Fn1, Itgα5, and Cox2 mRNA in hatching
blastocysts in the presence or absence of the LRH1 antagonist. Statistical significance of the
differences from the control group is indicated as follows: * P < 0.05, ** P < 0.01, and *** P
< 0.001. Data are presented as the mean (± standard deviation of the mean) of three independent
experiments.
The effect of liver receptor homolog 1 (LRH1) inhibition on the embryo development. The parthenotes
were treated with the specific LRH1 antagonist 505601 in concentrations of 50 or 100 μM. (A) The
percentages of those in the two-cell, four-cell, blastocyst, and hatching blastocyst stages are shown by
bars. (B) The images of embryos treated with different concentrations of 505601 are shown. (C)
Expression of Fn1, Itgα5, and Cox2 mRNA in hatching
blastocysts in the presence or absence of the LRH1 antagonist. Statistical significance of the
differences from the control group is indicated as follows: * P < 0.05, ** P < 0.01, and *** P
< 0.001. Data are presented as the mean (± standard deviation of the mean) of three independent
experiments.In order to detect the mechanism of Lrh1’s influence on blastocyst hatching, the expression
of hatching-related genes was examined. As illustrated in Fig. 2C,
the expression levels of the hatching-related genes Fn1, Itgα5, and
Cox2 were significantly lower in the treatment group than in the control group (P <
0.01).
Effect of Lrh1 on the porcine blastocyst quality
The quality of the blastocysts was further evaluated based on Gardner’s criteria [22]. Blastocysts were graded on a scale of 1 to 6 and the grade depended on their degree of
expansion and hatching status as follows: 1, an early blastocyst without a full blastocoel volume, which
occupies less than a half of the embryo; 2, a blastocyst with a blastocoel volume, which occupies at least
half (or more) of the embryo; 3, a full blastocyst with a blastocoel completely filling the embryo; 4, an
expanded blastocyst with a blastocoel, which is larger than the volume of the early embryo, with a thinning
zona pellucida; 5, a hatching blastocyst with the trophectoderm, which begins to hatch from the zona
pellucida; and 6, a hatched blastocyst, which completely escaped from the zona pellucida. The distribution of
the blastocyst quality scores is shown in Fig. 3A. In the present study, there was a significant decrease in the number of high quality blastocysts and
an increase in the number of low quality blastocysts following the inhibition of LRH1 (Fig. 3B). A blastocyst score from 4 to 6 was a sign of a high quality blastocyst.
Blastocysts of lower quality received scores from 1 to 3. The fraction of high quality blastocysts was
significantly lower in the presence of 50 and 100 μM of 505601 (32.48 ± 0.81%; 34.85 ± 1.5%, respectively)
than that fraction in the control group (56.41 ± 6.41%).
Fig. 3.
Effect of pharmacological inhibition of liver receptor homolog 1 (LRH1) on porcine blastocysts. (A)
Blastocyst quality was examined in the presence or absence of the LRH1 antagonist. Black and white bars
indicate high and low quality blastocysts, respectively (P < 0.05). (B) Blastocysts were graded on a
scale from 1 to 6 as illustrated. Different scores were indicated by the respective numbers. Ctrl,
control; 50, 50 μM; 100, 100 μM.
Effect of pharmacological inhibition of liver receptor homolog 1 (LRH1) on porcine blastocysts. (A)
Blastocyst quality was examined in the presence or absence of the LRH1 antagonist. Black and white bars
indicate high and low quality blastocysts, respectively (P < 0.05). (B) Blastocysts were graded on a
scale from 1 to 6 as illustrated. Different scores were indicated by the respective numbers. Ctrl,
control; 50, 50 μM; 100, 100 μM.
Effect of Lrh1 on apoptosis in porcine blastocysts
Previous studies showed that blastocyst hatching was influenced by the blastocyst cell number [23], therefore the effect of Lrh1 on this parameter was
investigated (Fig. 4A). The total blastocyst cell number in the control group (40.67 ± 2.84) was significantly higher (P <
0.05) than that observed in the presence of 50 (28.25 ± 2.53) or 100 μM of 505601 (27.00 ± 4.95). Thus, the
blastocyst hatching after treatment with an LRH1 antagonist may be associated with the total blastocyst cell
number.
Fig. 4.
Effect of liver receptor homolog 1 (LRH1) on apoptosis. (A) The total number of blastocyst cells and
the fraction of apoptotic cells were examined. (B) Laser scanning confocal microscopy images of nuclei
and fragmented DNA in samples from the control group and the LRH1-antagonist-treated group. (C)
Expression of Bax, Bcl2, and Casp3 mRNA in porcine
blastocysts during in vitro culturing with or without the LRH1 antagonist. Statistical
significance of differences from the control group is indicated as follows: * P < 0.05, ** P <
0.01. Data are presented as the mean (± standard deviation of the mean) of three independent
experiments. Ctrl, control; 50, 50 μM; 100, 100 μM.
Effect of liver receptor homolog 1 (LRH1) on apoptosis. (A) The total number of blastocyst cells and
the fraction of apoptotic cells were examined. (B) Laser scanning confocal microscopy images of nuclei
and fragmented DNA in samples from the control group and the LRH1-antagonist-treated group. (C)
Expression of Bax, Bcl2, and Casp3 mRNA in porcine
blastocysts during in vitro culturing with or without the LRH1 antagonist. Statistical
significance of differences from the control group is indicated as follows: * P < 0.05, ** P <
0.01. Data are presented as the mean (± standard deviation of the mean) of three independent
experiments. Ctrl, control; 50, 50 μM; 100, 100 μM.Since the inhibition of LRH1 by 505601 decreased the total blastocyst cell number, we next investigated if
this pharmacological manipulation affected apoptosis. The number of apoptotic cells per blastocyst was checked
on the eighth day after parthenogenetic activation in the treatment and control groups. The number of
apoptotic cells was significantly lower (P < 0.05) in the control group (3.00 ± 0.82) than in the groups
treated with 50 (6.00 ± 0.71) or 100 μM (6.00 ± 0.75) of 505601 (Fig.
4B). Therefore, we concluded that the inhibition of LRH1 increased the apoptotic rate of the
blastocysts.In order to understand the mechanism by which Lrh1 exerts this effect on apoptosis, the
expression of three critical apoptotic genes, Bax, Casp3, and
Bcl2, was analyzed. LRH1 inhibition enhanced the expression of the pro-apoptotic genes
Bax and Casp3 (P < 0.05) and reduced the expression of the
anti-apoptotic gene Bcl2 (P < 0.01). Thus, Lrh1 could regulate apoptosis
via modulation of the expression of the apoptosis-related genes Bax, Casp3,
and Bcl2.
Effect of Lrh1 on the expression of OCT4 in porcine blastocysts
The expression levels of OCT4 mRNA and protein were analyzed following treatment with the LRH1 antagonist
505601. The Oct4 mRNA expression was significantly lower in the LRH1 antagonist-treated
embryos than in the control, untreated embryos (P < 0.001, Fig.
5A). Consistent with the data on mRNA expression, weaker expression of the OCT4 protein was observed at
the blastocyst stage in the LRH1 antagonist-treated embryos than in the untreated embryos (Fig. 5B).
Fig. 5.
The mRNA and protein expression levels of octamer-binding transcription factor 4 (OCT4). Relative
Oct4 mRNA expression level and laser scanning confocal microscopy images of
immunostaining for the OCT4 protein in porcine blastocysts during treatments with different
concentrations of the liver receptor homolog 1 (LRH1) antagonist. *** indicates statistically
significant difference (P < 0.001) from the control group. Data are presented as the mean (± standard
deviation of the mean) of three independent experiments. Ctrl, control; LRH1i, inhibition of LRH1; 50,
50 μM; 100, 100 μM.
The mRNA and protein expression levels of octamer-binding transcription factor 4 (OCT4). Relative
Oct4 mRNA expression level and laser scanning confocal microscopy images of
immunostaining for the OCT4 protein in porcine blastocysts during treatments with different
concentrations of the liver receptor homolog 1 (LRH1) antagonist. *** indicates statistically
significant difference (P < 0.001) from the control group. Data are presented as the mean (± standard
deviation of the mean) of three independent experiments. Ctrl, control; LRH1i, inhibition of LRH1; 50,
50 μM; 100, 100 μM.
Discussion
In mammals, blastocysts must hatch from the zona pellucida before implantation for further development.
Blastocyst hatching is an essential event for the subsequent viability and development of the embryo [24]. Although it is vital to understand the mechanism of hatching in detail,
in-depth studies of this critical process are still scarce. In the present study, we discovered that the
activity of Lrh1, a novel transcription factor, affects blastocyst hatching. It has been
reported previously that mice bearing a homozygous null mutation in the Lrh1 gene die on
embryonic days 6.5–7.5. This observation shows that Lrh1 is likely to play an important role in
embryo development [10]. The structure-based discovery of LRH1
antagonists has identified ligands that inhibit Lrh1 transcriptional activity and diminish the
expression of the receptor’s target genes [25, 26]. Therefore, several studies have used LRH1 antagonists to investigate the receptor’s
biological function[25]. In the present study, the treatment of porcine
parthenotes with an LRH1-specific antagonist had a negative effect on blastocyst formation and quality;
therefore, our data support the notion that Lrh1 affects the developmental capacity of the
embryo. Furthermore, decrease in the hatching rate that we observed upon LRH1 inhibition can lead to
implantation failure.. In the present study, the mRNA expression levels of several hatching-related genes, i.e.
Fn1, Itgα5, and Cox2, were significantly smaller in the
experimental groups treated with an LRH1 antagonist than in the control, untreated groups. The FN1 protein is
produced by the trophoblast cells of the blastocyst, and the interaction of this protein with integrins is
critically important for the attachment of the embryo to the maternal endometrium during successful implantation
[27]. FN1 is an important bridging ligand providing the Arg-Gly-Asp
integrin recognition site for apically-expressed integrins in the endometrium and the embryo [28]. Itgα5 is a major fibronectin receptor, and
Cox2 is another key factor for blastocyst hatching. Prostacyclin synthesized by
Cox2 plays an important role in embryo development during preimplantation and blastocyst
hatching [29]. The selective pharmacological inhibition of
Cox2 completely blocks blastocyst hatching [30].
Hence, we postulate that Lrh1 regulates blastocyst hatching through its effect on the
expression of Fn1, Itgα5, and Cox2, which are followed by the
attachment of the embryo to the uterine endometrium.There is a direct correlation between blastocyst quality and blastocyst hatching [22]. In the presence of an LRH1 antagonist in the culture medium, the fraction of good
quality blastocysts was smaller than that in control conditions. Furthermore, blastocyst hatching is influenced
by the blastocyst cell number [23], and apoptosis in the early embryo has
an important impact on embryo development [31]. It is possible that LRH1
inhibition caused a failure of embryo competence because of the enhancement of the apoptotic rate. In support of
this, LRH1 inhibition upregulated the expression of the proapoptotic genes Bax and
Casp3 and decreased the expression levels of Bcl2, an anti-apoptotic
gene. These observations suggest that the natural activity of intact Lrh1 is
to enhance blastocyst vitality.Blastocysts escape from the zona pellucida and form a compact inner cell mass (ICM) [32]. Oct4 is a key factor in ICM formation. It should be noted that mouse
embryos with a homozygous null mutation in the Oct4 gene die around the time of the
implantation stage [33]. Previous studies have demonstrated that the
expression of the Oct4 gene was regulated by Lrh1, as knockdown of the
Lrh1 gene decreased Oct4 expression [15]. In the present study, the pharmacological inhibition of LRH1 during early porcine embryonic
development resulted in decreased expression of OCT4 protein and mRNA. Regulation of the Oct4
expression level by Lrh1 may be mediated by a canonical Wnt/β-catenin-dependent pathway, which
has been shown to be involved in the hatching of pigblastocysts [34,
35]. Therefore, we hypothesized that Lrh1 affects
blastocyst hatching through the regulation of Oct4 expression via the Wnt/β-catenin signaling
pathway.In summary, we revealed an important role of Lrh1, an orphan nuclear receptor superfamily
member, in early porcine embryo development, especially during blastocyst formation and hatching. The present
study demonstrated that Lrh1 influenced early embryo development by regulating apoptosis and
OCT4 expression. In the future, further experiments will be necessary to understand the pathways involved in the
Lrh1 regulation of blastocyst hatching; this will be particularly necessary to validate the
application of LRH1 antagonists to improve porcine IVF cycles suffering from hatching problems.
Authors: Maaike H Oosterveer; Chikage Mataki; Hiroyasu Yamamoto; Taoufiq Harach; Norman Moullan; Theo H van Dijk; Eduard Ayuso; Fatima Bosch; Catherine Postic; Albert K Groen; Johan Auwerx; Kristina Schoonjans Journal: J Clin Invest Date: 2012-07-09 Impact factor: 14.808
Authors: Rajesha Duggavathi; David H Volle; Chikage Mataki; Maria C Antal; Nadia Messaddeq; Johan Auwerx; Bruce D Murphy; Kristina Schoonjans Journal: Genes Dev Date: 2008-07-15 Impact factor: 11.361
Authors: Kathy K Niakan; Emily C Davis; Robert C Clipsham; Meisheng Jiang; Deborah B Dehart; Kathleen K Sulik; Edward R B McCabe Journal: Mol Genet Metab Date: 2006-02-08 Impact factor: 4.797
Authors: Chikage Mataki; Benjamin C Magnier; Sander M Houten; Jean-Sébastien Annicotte; Carmen Argmann; Charles Thomas; Henk Overmars; Wim Kulik; Daniel Metzger; Johan Auwerx; Kristina Schoonjans Journal: Mol Cell Biol Date: 2007-10-01 Impact factor: 4.272
Authors: Cong Zhang; Michael J Large; Raj Duggavathi; Francesco J DeMayo; John P Lydon; Kristina Schoonjans; Ertug Kovanci; Bruce D Murphy Journal: Nat Med Date: 2013-06-30 Impact factor: 53.440