Literature DB >> 26958640

Data defining markers of human neural stem cell lineage potential.

Lotta E Oikari1, Rachel K Okolicsanyi1, Lyn R Griffiths1, Larisa M Haupt1.   

Abstract

Neural stem cells (NSCs) and neural progenitor cells (NPCs) are self-renewing and multipotent cells, however, NPCs are considered to be more lineage-restricted with a reduced self-renewing capacity. We present data comparing the expression of 21 markers encompassing pluripotency, self-renewal (NSC) as well as neuronal and glial (astrocyte and oligodendrocyte) lineage specification and 28 extracellular proteoglycan (PG) genes and their regulatory enzymes between embryonic stem cell (ESC)-derived human NSCs (hNSC H9 cells, Thermo Fisher) and human cortex-derived normal human NPCs (nhNPCs, Lonza). The data demonstrates expression differences of multiple lineage and proteoglycan-associated genes between hNSC H9 cells and nhNPCs. Data interpretation of markers and proteoglycans defining NSC and neural cell lineage characterisation can be found in "Cell surface heparan sulfate proteoglycans as novel markers of human neural stem cell fate determination" (Oikari et al. 2015) [1].

Entities:  

Keywords:  Characterisation; Lineage; Neural progenitor cells; Neural stem cells; Proteoglycans

Year:  2016        PMID: 26958640      PMCID: PMC4773572          DOI: 10.1016/j.dib.2016.02.030

Source DB:  PubMed          Journal:  Data Brief        ISSN: 2352-3409


Specifications Table The data provides an extensive panel of markers for better characterisation of human NSCs and NPCs. The data demonstrates significant and specific differences in expression of pluripotency, NSC self-renewal and neural cell lineage markers between hNSCs and hNPCs. The marker profile data could be used to identify and differentiate between the two cell types to improve their efficacy in research or therapeutic applications. The data provides information on the proteoglycan profile of human NSCs and NPCs providing potential new additional markers defining lineage progression of NSCs to NPCs.

Data

We compared the expression of 49 selected genes between human NSCs (hESC-derived hNSC H9 cells, Thermo Fisher) and normal human progenitor cells (nhNPCs, Lonza) following short-term culture under basal growth conditions. Q-PCR data was obtained for pluripotency genes, NSC, neuronal, astrocyte and oligodendrocyte lineage defining genes (n=21; Table 1.) (Fig. 1) with several of these markers also detected through immunofluorescence (IF) (Fig. 2) using specific antibodies (Table 3). In addition, Q-PCR data was obtained for 28 heparan and chondroitin sulphate proteoglycan biosynthesis enzymes and core protein genes (Table 2) ubiquitous to the neural niche [1], [2], [3], [4], [5], [6], [7] in hNSC H9 cells and nhNPCs (Fig. 3, Fig. 4). The data presented provides information on self-renewal and multilineage potential as well as proteoglycan expression differences between the two neural stem/progenitor cell types.
Table 1

Primer sequences of NSC and neural lineage related genes.

GeneSymbolForward primerReverse primerRefSeqRef
CD44CD44AGCAACTGAGACAGCAACCAAGACGTACCAGCCATTTGTGTNM_000610.3
DoublecortinDcxTATGCGCCGAAGCAAGTCTCTACAGGTCCTTGTGCTTCCGNM_178152.2
Enolase 2ENO2TGCACAGGCCAGATCAAGACACAGCACACTGGGATTACGGNM_001975.2
Forkhead box A2FOXA2CTGGTCGTTTGTTGTGGCTGGGAGGAGTAGCCCTCGGNM_021784.4
GalactosylceramidaseGalCGCCAAGCGTTACCATGATTTTTTCACTCGCTGGAGACCTTNM_001201402.1[8]
Glial fibrillary acidic proteinGFAPGAGGTTGAGAGGGACAATCTGGGTGGCTTCATCTGCTTCCTGTCNM_002055.4
Human telomerasehTERTGACGTGGAAGATGAGCGTGGACGACGTACACACTCATCNM_001193376.1 NM_198253.2[9]
Microtubule associated protein 2MAP2GACTGCAGCTCTGCCTTTAGAAGTAAATCTTCCTCCACTGTGACNM_002374.3
Mushahi IMSI ITGACCAAGAGATCCAGGGGTCGATTGCGCCAGCACTTTATNM_002442.3
Nanog homeoboxNANOGACCTCAGCTACAAACAGGTGAAAAAGGCTGGGGTAGGTAGGTNM_024865.2
NestinNESCTCAGCTTTCAGGACCCCAAGTCTCAAGGGTAGCAGGCAANM_006617.1
Neurofilament MNEFMTGCAGTCCAAGAGCATCGAGGGATGGTGTCCTGGTAGCTGNM_005382.2
Neurogenin 2NEUROG2AGAGCCAACTAAGATGTTCGTCACGATCCGAGCAGCACTAACANM_024019.3
Oligodendrocyte transcription factor 1OLIG1GTCATCCTGCCCTACTCAGCCTGCCCAGCAGTAGGATGTAGNM_138983.2[8]
Oligodendrocyte transcription factor 2OLIG2GACAAGCTAGGAGGCAGTGGCGGCTCTGTCATTTGCTTCTNM_005806.3[8]
POU Class 5 homeobox 1 (OCT3/4)OCT3/4ATCTTCAGGAGATATGCAAAGCAGATGATCTGCTGCAGTGTGGGTNM_002701.4
SRY box 1SOX1CAACCAGGACCGGGTCAAACCCTCGGACATGACCTTCCACNM_005986.2
SRY box 2SOX2CCACCTACAGCATGTCCTACTCGGGGAGGAAGAGGTAACCACAGGNM_003106.3[10]
S100 Calcium binding protein BS100BTTCTGGAAGGGAGGGAGACACTCCTGCTCTTTGATTTCCTCTNM_006272.2
VimentinVIMGGACCAGCTAACCAACGACAAACGCATTGTCAACATCCTGTCTGNM_003380.3
βIII tubulinTUBB3GGCCAAGTTCTGGGAAGTCATCTCGAGGCACGTACTTGTGANM_06086.3
Fig. 1

Q-PCR analysis of pluripotency, NSC self-renewal, neuronal and glial lineage marker genes in hNSC H9 cells and nhNPCs. Relative expression in hNSC H9 cells and nhNPCs of: (A) pluripotency markers; (B) NSC self-renewal markers; (C) neuronal lineage defining markers; and (D) glial lineage defining markers. Relative expression normalised to 18 S, error bars=SD, statistical significance: ⁎p<0.05, ⁎⁎p<0.01, ⁎⁎⁎p<0.001.

Fig. 2

Phenotypic and IF examination of NSC and neural lineage markers in hNSC H9 cells and nhNPCs. Phase-contrast images (20× magnification with 10× magnification inset, scale bar 130 μM) of: (A) hNSC H9 cells at P3 and (B) nhNPCs attached to surface (CC2 chamber slide) during expansion. Immunofluorescence (20× magnification, scale bar 130 μM) in hNSC H9 P3 cells and nhNPCs of stemness and lineage markers: (C) NSC self-renewal markers Nestin (FITC/green) and SOX2 (Cy3/yellow); and (D) neuronal marker MAP2 (FITC/green), astrocyte marker GFAP (Cy3/yellow) and oligodendrocyte marker O1 (AF594/red).

Table 3

Antibodies used for immunofluorescence.

Primary antibodiesDilutionCompany (Cat#)
Anti-Nestin (Mouse IgG)1:200Abcam (ab22035)
Anti-SOX2 (Rabbit IgG)1:1000Millipore (2003600)
Anti-MAP2 (Mouse IgG)1:200Abcam (ab36447)
Anti-GFAP (Rabbit IgG)1:250Abcam (ab7260)
Anti-O1 (Mouse IgM)1:500Abcam (ab34164)
Isotype ControlsDilutionCompany (Cat#)
Mouse IgG1:250Millipore (PP54-100UG)
Rabbit IgG1:250Millipore (PP64-100UG)
Mouse IgM1:500Millipore (2003599)
Secondary antibodiesDilutionCompany (Cat#)
Donkey Anti-Mouse IgG (FITC, green)1:250Millipore (AP192F)
Donkey Anti-Rabbit (H+L) (Cy3, yellow)1:250Millipore (AP182C)
Donkey Anti-Mouse IgM (AlexaFluor 594, red)1:500Jackson Immunoresearch (#715-585-020)
Table 2

Primer sequences of proteoglycan associated genes.

GeneSymbolForward primerReverse primerRefSeqRef
AggrecanAGGTGCATTCCACGAAGCTAACCTTCGCCTCGCCTTCTTGAAATGTNM_001135
C5-EpimeraseC5-EPAGCTGTCAAGCCAACCAAAATAACTTACTAGCCAATCACTAGCAGCAAAY635582
carbohydrate (chondroitin 6) sulfotransferase 3CHST3GGTTTTTGTGGTGATAGTTTTTGTCTTGCTGGGTCGGTGCTGTTGNM_004273
carbohydrate (chondroitin 4) sulfotransferase 11CHST11CTGCTGGAAGTGATGAGGATGAGATGTCCACACCAAAGGGATTCNM_018413
DecorinDCNTCCTGATGACCGCGACTTGAGTTGTGTCAGGGGGAAGANM_001920.3
Exostose 1EXT1TGACAGAGACAACACCGAGTATGAGCAAAGCCTCCAGGAATCTGAAGNM_000127.2
Exostose 2EXT2CAGTCAATTAAAGCCATTGCCCTGGGGATCAGCGGGAGGAAGAGNM_000401
Glypican 1GPC1GGACATCACCAAGCCGGACATGTCCACGTCGTTGCCGTTGTNM_002081
Glypican 2GPC2TGATCAGCCCCAACAGAGAAACCACTTCCAACTTCCTTCAAACCNM_152742
Glypican 3GPC3GATACAGCCAAAAGGCAGCAAGCCCTTCATTTTCAGCTCATGNM_004484.
Glypican 4GPC4GGTGAACTCCCAGTACCACTTTACAGCTTCAGCTGCTCCGTATACTTGNM_001448
Glypican 5GPC5GCTCACCTCAATGGACAAAAATTGTTGGCAAGCGTCTCTTCACTNM_004466
Glypican 6GPC6CAGCCTGTGTTAAGCTGAGGTTTGATGTGTGTGCGTGGAGGTATGTNM_005708.
HeparanaseHPSETCACCATTGACGCCAACCTCTTTGCAGAACCCAGGAGGATNM_006665.5
Heparan sulphate 2-O sulfotransferase 1HS2ST1TCCCGCTCGAAGCTAGAAAGCGAGGGCCATCCATTGTATGNM_012262
Heparan sulphate 6-O sulfotransferase 1HS6ST1AGCGGACGTTCAACCTCAAGTGCGTAGTCGTACAGCTGCATGTNM_004807
Heparan sulphate 6-O sulfotransferase 2HS6ST2TCTGGAAAGTGCCAAGTCAAATCATGGCGAAATAAAGTTCATGTTGAANM_147175
Heparan sulphate 6-O sulfotransferase 3HS6ST3ACATCACGCGGGCTTCTAACGTGGCGGTCCCTCTGGTGCTCTANM_153456
N-deacetylase/N-sulfotransferase 1NDST1TGGTCTTGGATGGCAAACTGCGCCAAGGTTTTGTGGTAGTCNM_001543
N-deacetylase/N-sulfotransferase 2NDST2CCTATTTGAAAAAAGTGCCACCTACTGCAGGGTTGGTGAGCACTGTNM_003635
N-deacetylase/N-sulfotransferase 3NDST3ACCCTTCAGACCGAGCATACTCCCCGGGACCAAACATCTCTTNM_004784
N-deacetylase/N-sulfotransferase 4NDST4ATAAAGCCAATGAGAACAGCTTACCGGTAATATGCAGCAAAGGAGATTGANM_022569
PerlecanPERTGGACACATTCGTACCTTTCTGACCTCGGACACCTCTCGAAACTNM_005529
Syndecan 1SDC1CTGGGCTGGAATCAGGAATATTTCCCATTGGATTAAGTAGAGTTTTGCBC008765.2
Syndecan 2SDC2AGCTGACAACATCTCGACCACTTGCGTCGTGGTTTCCACTTTTNM_002998.3
Syndecan 3SDC3CTTGGTCACACTGCTCATCTATCGGCATAGAACTCCTCCTGCTTGTCAF248634
Syndecan 4SDC4CCACGTTTCTAGAGGCGTCACTCTGTCCAACAGATGGACATGCTBC030805.1
VersicanVCNTGGAATGATGTTCCCTGCAAAAGGTCTTGGCATTTTCTACAACAGNM_004385.4
Fig. 3

Q-PCR analysis of proteoglycan biosynthesis enzyme gene expression in hNSC H9 cells and nhNPCs. Relative expression in hNSC H9 cells and nhNPCs of: (A) HS chain synthesising and modifying enzymes; (B) HS chain N-deacelylating/N-sulfating enzymes; (C) HS chain sulfating enzymes; and (D) CS chain sulfating enzymes. Relative expression normalised to 18 S, error bars=SD, statistical significance: ⁎p<0.05, ⁎⁎p<0.01, ⁎⁎⁎p<0.001.

Fig. 4

Q-PCR analysis of proteoglycan core protein gene expression in hNSC H9 cells and nhNPCs. Relative expression in hNSC H9 cells and nhNPCs of: cell surface HSPGs (A) syndecans; (B) glypicans; and extracellular CSPGs and HSPGs (C) aggrecan, versican, perlecan and decorin. Relative expression normalised to 18 S, error bars=SD, statistical significance: ⁎p<0.05, ⁎⁎p<0.01, ⁎⁎⁎p<0.001.

Experimental design, materials and methods

Cell culture

Gibco® human neural stem cells derived from NIH-approved H9 (WA09) embryonic stem cells (hNSC H9 cells) were cultured as a monolayer on Geltrex® coated culture dishes in StemPro® NSC serum-free medium (NSC SFM) containing KnockOUT™ DMEM/F-12 supplemented with 2% StemPro® Neural Supplement, 20 ng/ml FGFb and EGF and 2 mM GlutaMAX™ (cells and culture reagents obtained from Thermo Fisher). hNSC H9 cells were cultured in p35 (10 cm2) dishes with culture medium changed every two days and cells passaged at 90% confluence using TrypLE. hNSC H9 cells were passaged twice and harvested for RNA at passage 3 (P3). Normal Human Neural Progenitor Cells (nhNPCs) isolated from the human brain cortex were cultured as neurospheres in Neural Progenitor Maintenance Bulletkit™ medium (NPMM) containing 200 mL of Neural Progenitor Basal Medium supplemented with 0.4 mL rhFGF-B, 0.4 mL rhEGF, 4 mL Neural Survival Factor-1 and 0.4 mL Gentamicin/Amphotericin (cells and culture reagents obtained from Lonza). nhNPC neurosphere cultures were established by defrosting the cell ampule according to the manufacturer’s instructions and dividing the cells into two T75 (75 cm2) flasks containing 20 mL of NPMM. hNSC H9 and nhNPCs cultures were maintained in 5% CO2 at 37 °C in a humidified atmosphere with phenotype of the cells monitored under an Olympus IX81 inverted phase-contrast microscope.

RNA extraction

RNA was harvested from cultured cells using TRIzol® reagent (Invitrogen) using the Direct-zol™ RNA miniprep kit (Zymo Research) according to the manufacturer’s instructions with samples treated in-column with DNase I (Zymo Research). RNA was eluted in RNase-free H2O and concentration and quality of RNA determined with a NanoDrop spectrophotometer (Thermo Scientific).

cDNA synthesis

For conversion of RNA into cDNA, 150 ng of RNA was incubated with 200 ng of Random Primer (New England BioLabs) at 65 °C for 10 min in a reaction made up to 20 μl with Milli-Q-H2O. Samples were then incubated with 10 U of Transcriptor Reverse Transcriptase (Roche) and 1 mM dNTPs (New England Biolabs), 20 U of RNaseOUT (Invitrogen) in 1x RT reaction buffer in a total reaction volume of 30 μl. For the reverse transcription reaction samples were incubated at 25 °C for 10 min, then at 55 °C for 30 min and finally at 85 °C for 5 min. Concentration and quality of cDNA was measured on a NanoDrop spectrophotometer and cDNA was diluted to 40 ng/mL working concentrations.

Quantitative real-time PCR

Relative gene expression was detected using quantitative real-time PCR (Q-PCR). The 10 μl reaction volume contained 5 μl of SYBR®-Green PCR Master Mix (Promega), 200 ng of forward and reverse primer, 0.1 μl CXR reference dye (Promega) and 120 ng cDNA template. Amplification was monitored on an Applied Biosystems 7900HT Fast Real-Time PCR system with an enzyme activation of 2 min at 50 °C and 3 min at 95 °C followed by 50 cycles of 3 s at 95 °C and 30 s at 60 °C. The cycle threshold (Ct) values were normalised against the endogenous control 18 S (forward primer TTCGAGGCCCTGTAATTGGA, reverse primer GCA GCAACTTAATATACGCTAT) Ct values (ΔCt value) included in each run, and relative gene expression was determined by the ΔΔCt value (2(−Δ). For ease of graphic presentation of relative gene expression, ΔΔCt values were multiplied by 106. Primer sequences for detected NSC and neural lineage genes are presented in Table 1 and primer sequences for heparan and chondroitin sulphate proteoglycan associated genes are presented in Table 2.

Immunofluorescence (IF)

Expression of selected NSC and neural lineage marker proteins were detected via IF using an Olympus IX81 inverted phase-contrast fluorescent microscope and images acquired using Volocity software (Perkin-Elmer) on a Hamamatsu Orca camera. For imaging, cells were plated on 8-well CC2-coated chamber slides (Lab-Tek) at 20–30×104 cells/well and cells were cultured for 3–4 days before fixing and staining. Briefly, culture medium was removed, cells rinsed with 1× PBS with Ca2+ and Mg2+ and fixed with 4% paraformaldehyde. After this cells were blocked (5% Donkey serum, 1% BSA in PBS with or without 0.1% Triton-X to allow permeabilisation) and primary antibodies were incubated overnight at 4 °C. Isotype control antibodies were used as a negative control. After 24 h incubation, primary antibodies were removed, cells rinsed with 1× PBS with Ca2+ and Mg2+ and cells incubated with secondary antibodies for 2 h at room temperature. Finally, cells were rinsed with 1× PBS with Ca2+ and Mg2+ and slides mounted with DAPI (ab104139, Abcam). Antibodies and dilutions used are presented in Table 3.

Statistical analysis

For Q-PCR analysis each gene was detected in quadruplicate per sample. Paired t-test was used to determine statistical significance and defined as * p<0.5, ** p<0.01 and *** p<0.001. Error bars represent SD.
Subject areaCell biology
More specific subject areaHuman neural stem cell (hNSC) and human neural progenitor cell (hNPC) marker characterisation
Type of dataText file, graphs and immunofluorescence images
How data was acquiredin vitro culture/expansion and phase-contrast fluorescence microscopy data for phenotypic analysis was obtained on an Olympus IX81 inverted fluorescent microscope via Volocity Imaging package; raw Q-PCR data was obtained on Applied Biosystems 7900HT Fast Real-Time PCR system
Data formatAnalysed
Experimental factorshNSC H9 and nhNP cells were cultured under basal medium conditions
Experimental featureshNSC H9 cells (Thermo Fisher) were cultured as a monolayer and nhNP cells (Lonza) were cultured as neurospheres in standard maintenance medium provided by the manufacturer. RNA was harvested and transcribed to cDNA and gene expression of a panel of 49 genes examined by Q-PCR. Specific neural cell lineage markers were further detected through immunofluorescence (IF)
Data source locationInstitute of Health and Biomedical Innovation, Queensland University of Technology, Brisbane, Queensland Australia
Data accessibilityData is provided in this article
  10 in total

1.  Cell surface heparan sulfate proteoglycans as novel markers of human neural stem cell fate determination.

Authors:  Lotta E Oikari; Rachel K Okolicsanyi; Aro Qin; Chieh Yu; Lyn R Griffiths; Larisa M Haupt
Journal:  Stem Cell Res       Date:  2015-12-17       Impact factor: 2.020

2.  Sulfation patterns of glycosaminoglycans encode molecular recognition and activity.

Authors:  Cristal I Gama; Sarah E Tully; Naoki Sotogaku; Peter M Clark; Manish Rawat; Nagarajan Vaidehi; William A Goddard; Akinori Nishi; Linda C Hsieh-Wilson
Journal:  Nat Chem Biol       Date:  2006-07-30       Impact factor: 15.040

Review 3.  Proteoglycans in the central nervous system: role in development, neural repair, and Alzheimer's disease.

Authors:  Hao Cui; Craig Freeman; Glenn A Jacobson; David H Small
Journal:  IUBMB Life       Date:  2013-01-07       Impact factor: 3.885

4.  Regulation of glioblastoma multiforme stem-like cells by inhibitor of DNA binding proteins and oligodendroglial lineage-associated transcription factors.

Authors:  Yanjue Wu; Jean-Philippe Richard; Shervin D Wang; Prakash Rath; John Laterra; Shuli Xia
Journal:  Cancer Sci       Date:  2012-04-04       Impact factor: 6.716

Review 5.  Functions of chondroitin sulfate and heparan sulfate in the developing brain.

Authors:  N Maeda; M Ishii; K Nishimura; K Kamimura
Journal:  Neurochem Res       Date:  2010-11-26       Impact factor: 3.996

6.  Telomere length analysis of human mesenchymal stem cells by quantitative PCR.

Authors:  Rebekah M Samsonraj; Michael Raghunath; James H Hui; Ling Ling; Victor Nurcombe; Simon M Cool
Journal:  Gene       Date:  2013-02-01       Impact factor: 3.688

7.  Heparan sulfation-dependent fibroblast growth factor signaling maintains embryonic stem cells primed for differentiation in a heterogeneous state.

Authors:  Fredrik Lanner; Kian Leong Lee; Marcus Sohl; Katarina Holmborn; Henry Yang; Johannes Wilbertz; Lorenz Poellinger; Janet Rossant; Filip Farnebo
Journal:  Stem Cells       Date:  2010-02       Impact factor: 6.277

8.  Localisation of specific heparan sulfate proteoglycans during the proliferative phase of brain development.

Authors:  Miriam Ford-Perriss; Kirsty Turner; Scott Guimond; Anwyn Apedaile; Hans-Dieter Haubeck; Jeremy Turnbull; Mark Murphy
Journal:  Dev Dyn       Date:  2003-06       Impact factor: 3.780

9.  Transgenic human ES and iPS reporter cell lines for identification and selection of pluripotent stem cells in vitro.

Authors:  Dmitry A Ovchinnikov; Drew M Titmarsh; Patrick R J Fortuna; Alejandro Hidalgo; Samah Alharbi; Deanne J Whitworth; Justin J Cooper-White; Ernst J Wolvetang
Journal:  Stem Cell Res       Date:  2014-06-08       Impact factor: 2.020

Review 10.  Heparan sulfate proteoglycans: structure, protein interactions and cell signaling.

Authors:  Juliana L Dreyfuss; Caio V Regatieri; Thais R Jarrouge; Renan P Cavalheiro; Lucia O Sampaio; Helena B Nader
Journal:  An Acad Bras Cienc       Date:  2009-09       Impact factor: 1.753

  10 in total
  5 in total

Review 1.  Exploiting Heparan Sulfate Proteoglycans in Human Neurogenesis-Controlling Lineage Specification and Fate.

Authors:  Chieh Yu; Lyn R Griffiths; Larisa M Haupt
Journal:  Front Integr Neurosci       Date:  2017-10-17

2.  The neurofilament derived-peptide NFL-TBS.40-63 enters in-vitro in human neural stem cells and increases their differentiation.

Authors:  Kristell Barreau; Claudia Montero-Menei; Joël Eyer
Journal:  PLoS One       Date:  2018-08-09       Impact factor: 3.240

3.  Heparan Sulfate Proteoglycans as Drivers of Neural Progenitors Derived From Human Mesenchymal Stem Cells.

Authors:  Rachel K Okolicsanyi; Lotta E Oikari; Chieh Yu; Lyn R Griffiths; Larisa M Haupt
Journal:  Front Mol Neurosci       Date:  2018-04-24       Impact factor: 5.639

4.  Differentiation of Human Mesenchymal Stem Cells from Wharton's Jelly Towards Neural Stem Cells Using A Feasible and Repeatable Protocol.

Authors:  Ewa Kruminis-Kaszkiel; Adam Osowski; Ewa Bejer-Oleńska; Mariusz Dziekoński; Joanna Wojtkiewicz
Journal:  Cells       Date:  2020-03-17       Impact factor: 6.600

5.  Controlling properties of human neural progenitor cells using 2D and 3D conductive polymer scaffolds.

Authors:  Shang Song; Danielle Amores; Cheng Chen; Kelly McConnell; Byeongtaek Oh; Ada Poon; Paul M George
Journal:  Sci Rep       Date:  2019-12-20       Impact factor: 4.379

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.