| Literature DB >> 26955370 |
Wenting Ju1, Anne-Laure Moyne2, Maria L Marco1.
Abstract
The capacity to distinguish between living and dead cells is an important, but often unrealized, attribute of rapid detection methods for foodborne pathogens. In this study, the numbers of enterohemorrhagic Escherichia coli O157:H7 after inoculation onto Romaine lettuce plants and on plastic (abiotic) surfaces were measured over time by culturing, and quantitative PCR (qPCR), propidium monoazide (PMA)-qPCR, and reverse transcriptase (RT)-qPCR targeting E. coli O157:H7 gapA, rfbE, eae, and lpfA genes and gene transcripts. On Romaine lettuce plants incubated at low relative humidity, E. coli O157:H7 cell numbers declined 10(7)-fold within 96 h according to culture-based assessments. In contrast, there were no reductions in E. coli levels according to qPCR and only 100- and 1000-fold lower numbers per leaf by RT-qPCR and PMA-qPCR, respectively. Similar results were obtained upon exposure of E. coli O157:H7 to desiccation conditions on a sterile plastic surface. Subsequent investigation of mixtures of living and dead E. coli O157:H7 cells strongly indicated that PMA-qPCR detection was subject to false-positive enumerations of viable targets when in the presence of 100-fold higher numbers of dead cells. RT-qPCR measurements of killed E. coli O157:H7 as well as for RNaseA-treated E. coli RNA confirmed that transcripts from dead cells and highly degraded RNA were also amplified by RT-qPCR. These findings show that neither PMA-qPCR nor RT-qPCR provide accurate estimates of bacterial viability in environments where growth and survival is limited.Entities:
Keywords: EHEC; PMA-qPCR; RT-qPCR; detection; foodborne pathogen; fresh produce; phyllosphere; viability
Year: 2016 PMID: 26955370 PMCID: PMC4767924 DOI: 10.3389/fmicb.2016.00223
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Primer sets used for qPCR, PMA-qPCR, and RT-qPCR.
| Target | Primer sequence | Size (bp) | Reference |
|---|---|---|---|
| lpfA | 5′- CACCGTTAAGAGCGACCAGGG -3′ | 165 | |
| 5′- GAAGATTGCGATACCACCACG -3′ | |||
| eae | 5′- TCTGTGTGGATGGTAATAAATTTTTG -3′ | 105 | |
| 5′- GTAAGTTACACTATAAAAGCACCGTCG -3′ | |||
| rfbE | 5′- TCAAAAGGAAACTATATTCAGAAGTTTGA -3′ | 129 | |
| 5′- CGATATACCTAACGCTAACAAAGCTAA-3′ | |||
| gapA | 5′-TAGGGGGCAGATTTTATATTCCGT-3′ | 143 | This study |
| 5′-AACCAATGCTCCTATCACACCAAT-3 | |||