| Literature DB >> 26954230 |
Lei Liu1, Shaohua Xu1, Xiaojuan Wang1, Hongchao Jiao1, Hai Lin1.
Abstract
An experiment was conducted to investigate the effect of peripheral insulin treatment on appetite in chicks. Six-d-age chicks with ad libitum feeding or fasting for 3 h before injection received a subcutaneous injection of 0, 1, 3, 5, 10, or 20 IU of insulin or vehicle (saline). The results showed peripheral insulin treatment (1 to 20 IU) did not alter significantly the feed intake in chicks under either ad libitum feeding or fasting conditions within 4 h (p>0.05). Compared with the control, plasma glucose concentration was significantly decreased after insulin treatment of 3, 5, 10, and 20 IU for 4 h in chicks with ad libitum feeding (p<0.05). In fasted chicks, 10 and 20 IU insulin treatments significantly decreased the plasma glucose level for 4 h (p<0.05). Peripheral insulin treatment of 10 IU for 2 or 4 h did not significantly affect the hypothalamic genes expression of neuropeptide Y, proopiomelanocortin, corticotropin-releasing factor and insulin receptors (p>0.05). All results suggest peripheral administration of insulin has no effect on appetite in chicks.Entities:
Keywords: Appetite; Feed Intake; Hypothalamus; Insulin
Year: 2016 PMID: 26954230 PMCID: PMC5003990 DOI: 10.5713/ajas.15.0674
Source DB: PubMed Journal: Asian-Australas J Anim Sci ISSN: 1011-2367 Impact factor: 2.509
Gene-specific primers used for the analysis of chick gene expression
| Gene | GenBank accession no. | Primer sequences (5′-3′) | Product size (bp) |
|---|---|---|---|
| L08165 | F: TGCGTGACATCAAGGAGAAG | 300 | |
| AF173612 | F: ATAACGAACGAGACTCTGGCA | 136 | |
| M87294 | F: GAGGCACTACATCAACCTCATCAC | 101 | |
| NM_001123031 | F: CTCCCTGGACCTGACTTTCC | 86 | |
| AF111857 | F: CAAACGGTGACCAAGCCTCA | 186 | |
| NM_001031098 | F: CGCTACGGCGGCTTCA | 88 |
NPY, neuropeptide Y; CRH, corticotropin-releasing hormone; INSR, insulin receptor; POMC, proopiomelanocortin.