Literature DB >> 26954183

Complete Mitochondrial Genome Sequences of Chinese Indigenous Sheep with Different Tail Types and an Analysis of Phylogenetic Evolution in Domestic Sheep.

Hongying Fan1,2, Fuping Zhao2, Caiye Zhu2, Fadi Li3, Jidong Liu4, Li Zhang2, Caihong Wei2, Lixin Du1,2.   

Abstract

China has a long history of sheep (Ovis aries [O. aries]) breeding and an abundance of sheep genetic resources. Knowledge of the complete O. aries mitogenome should facilitate the study of the evolutionary history of the species. Therefore, the complete mitogenome of O. aries was sequenced and annotated. In order to characterize the mitogenomes of 3 Chinese sheep breeds (Altay sheep [AL], Shandong large-tailed sheep [SD], and small-tailed Hulun Buir sheep [sHL]), 19 sets of primers were employed to amplify contiguous, overlapping segments of the complete mitochondrial DNA (mtDNA) sequence of each breed. The sizes of the complete mitochondrial genomes of the sHL, AL, and SD breeds were 16,617 bp, 16,613 bp, and 16,613 bp, respectively. The mitochondrial genomes were deposited in the GenBank database with accession numbers KP702285 (AL sheep), KP981378 (SD sheep), and KP981380 (sHL sheep) respectively. The organization of the 3 analyzed sheep mitochondrial genomes was similar, with each consisting of 22 tRNA genes, 2 rRNA genes (12S rRNA and 16S rRNA), 13 protein-coding genes, and 1 control region (D-loop). The NADH dehydrogenase subunit 6 (ND6) and 8 tRNA genes were encoded on the light strand, whereas the rest of the mitochondrial genes were encoded on the heavy strand. The nucleotide skewness of the coding strands of the 3 analyzed mitogenomes was biased toward A and T. We constructed a phylogenetic tree using the complete mitogenomes of each type of sheep to allow us to understand the genetic relationships between Chinese breeds of O. aries and those developed and utilized in other countries. Our findings provide important information regarding the O. aries mitogenome and the evolutionary history of O. aries inside and outside China. In addition, our results provide a foundation for further exploration of the taxonomic status of O. aries.

Entities:  

Keywords:  Mitochondrial Control Region; Mitochondrial DNA; Mitogenome; Phylogenetic; Sheep

Year:  2015        PMID: 26954183      PMCID: PMC4852223          DOI: 10.5713/ajas.15.0473

Source DB:  PubMed          Journal:  Asian-Australas J Anim Sci        ISSN: 1011-2367            Impact factor:   2.509


INTRODUCTION

The origins of domestic sheep (Ovis aries [O. aries]) breeds remain a controversial topic. Domestic sheep can interbreed with mouflon (Ovis orientalis orientalis), urial (Ovis orientalis vignei), and argali (Ovis ammon), complicating study of the origins of sheep breeds (Guo et al., 2005). China has a centuries-old tradition of sheep domestication, production, and breeding (Ma et al., 2006). In China, sheep are an important source of meat, wool, skin, and dairy products that fulfill agricultural, economic, cultural, and religious roles (Chen et al., 2006). At least 42 sheep breeds are indigenous to China (Resources, 2011); however, the origins and phylogenic relationships of these breeds are uncertain. Evaluation of the structure and function of mitochondrial DNA (mtDNA) provides information useful in the study of molecular evolution, classification, population genetic analysis, and relationship identification. Analyses of mtDNA have been used to illuminate the maternal origins of populations (Bruford et al., 2003). Animal mtDNA is a small extrachromosomal genome that is typically 15 to 20 kb in size. With few exceptions, all animal mitochondrial genomes contain the same 37 genes: 2 ribosomal RNAs (rRNAs), 13 protein-coding genes and 22 transfer RNAs (tRNAs) (Boore, 1999). Previous studies constructed phylogenetic trees using the control region sequence (which includes the D-loop) and mitochondrial cytochrome b (CYTB) gene (Pedrosa et al., 2005; Gu et al., 2007). The earliest studies of mtDNA variation in domestic O. aries breeds exposed 3 distinct lineages (Wood and Phua, 1996; Hiendleder et al., 1998a, b; Guo et al., 2005). In this study, we evaluated 3 O. aries breeds indigenous to China, the Altay sheep, Shandong large-tailed sheep, and small-tailed Hulun Buir sheep, which were of the fat-rump tailed, fat-tailed, and small-tailed varieties, respectively. We sequenced the complete mitogenomes of each of the 3 types of sheep and confirmed the mitochondrial genome structure. The primary features of the sheep mitogenome, including gene structure, gene arrangement, initiation codon, termination codon, and anticodon, were described and compared among the 3 types of sheep. The A/T-content of each mitogenome was calculated by DNA frequency analysis. The mtDNA D-loop region and CYTB gene have been widely used to investigate the origins of sheep (Xin et al., 2006; Wang et al., 2007). However, the mtDNA D-loop region is best-suited to studies of the phylogeny of closely related breeds. Therefore, to facilitate the study of the evolutionary relationships of distantly related species, we analyzed the complete mitogenome. In addition, similar to other analyses of complete sheep mitogenomes, we performed a molecular phylogenetic analysis using the complete mitogenome and mtDNA control region via unweighted pair group method with arithmetic means (UPGMA) method (Tamura and Nei, 1993). This study will facilitate further investigations of the phylogenetic relationships of O. aries and provides important annotation information for the sheep mitogenome.

MATERIALS AND METHODS

Sample collection and DNA extraction

Blood samples were collected from Altay sheep (AL) from Fuhai County in the Xinjiang Uygur Autonomous Region, Shandong large-tailed sheep (SD) from Liaocheng City in Shandong Province, and small-tailed Hulun Buir sheep (sHL) from the Autonomous County of Evenki in the Inner Mongolia Autonomous Region. The samples were collected only from purebred, healthy, young female sheep. Blood samples (approximately 10 cc) were drawn from the jugular veins of 40 unrelated domestic sheep into K3 ethylenediaminetetraacetic acid vacuum tubes by licensed veterinarian experts. Total genomic DNA from each individual was extracted using the QIAGEN DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) and stored at −20°C.

Polymerase chain reaction amplification and sequencing

Based on alignments and comparisons of complete mitochondrial sequences of other sheep (Hiendleder et al., 1998a), 19 sets of primers were employed to amplify contiguous, overlapping segments of the mtDNA from each type of sheep (Table 1). Polymerase chain reaction (PCR) amplification was performed using an ABI 9700 Thermocycler. Each PCR reaction was carried out in a 25-μL reaction volume consisting of 12.5 μL premixed enzyme, 2.0 μL DNA template, 1.0 μL of each primer (10 ppm), and 8.5 μL sterile deionized water. The PCR conditions were as follows: an initial denaturation at 94°C for 3 min, followed by 35 cycles of 94°C for 30 s (denaturation), 60°C for 30 s (annealing), and 72°C for 1 min (extension), with a final extension at 72°C for 10 min. Each sample of amplified DNA (5 μL) was inspected by electrophoresis on a 1% agarose gel to confirm the length of the amplified fragment.
Table 1

PCR primers used for the analysis of sheep mitochondrial genomes

No.Forward (5′–3′)Reverse (5′–3′)Product length (bp)Tm (°C)
1AACTTAAAGCAAGGCACTTTTACTTGAGGAGGGTGA91851
2AAATGACAATTCCCAACCGATGTAGGGAGAAAATAGTTAGATC91654
3ATGGTTGAGGCCGGAGCATCAGAGTATCGTCGTGGT99756
4ATGAGCCAAAATCCACTTATTTCTGAGCATTGACCG1,06051
5CAATTCCAGGTCGTTTAACTTATTAGTGCAAGGGTG94551
6TGAAACCATCAGCCTATTTACGAAGTGTCAGTATCAGG98454
7TCCTAATTGTCTGCTTCTATAGTCAGGTTAGGGGTA97151
8TACCCCTAACCTGACTATCAAGTGCTATGTGGCTAA95852
9AGCTCAATTTGCCTTCGCGAGGGTTTGGATGGTTAG98554
10TCATGCGCTTTCATCACTTGTCTTGCTCGTCGTTTA94652
11CCACCTAGCATTCCTTCATTGCTGCTTTATACAGTTATGG94054
12TCCACCACAATCACAAGCGGTAATAACTGTTGCTCCT1,12754
13ATTTGCGACAATAGCCACAGGTTGATAATGATTCAGGGA93255
14GAACAACCAACCTCCCTATGTGACCCAGGTGCCTAT1,25555
15TAATAGCCAAAGGAGGATCTTAAACTTGTGCGAGGA95051
16ACTGGACTATTCTATTACTAAGAACTTTTCGTTCAACTA1,12449
17CCAGTTAAGGTGGCAGAGGTAATTGGGAGCACGAAG1,16355
18CCCACAAACATAAGAAATTTTGAAGGCTCTTGGTCT1,19850
19CTATGGCCGTCTGAGGCCTGTAAGCAAGGCGTTGTGAG48451

PCR, polymerase chain reaction; Tm, temperature.

The second data set used in this study was 16 Chinese sheep and 13 foreign sheep from National Center for Biotechnology Information (NCBI) (Table 2). These data set were used to construct the phylogenetic tree about Chinese and foreign sheep.
Table 2

List of complete sheep mitogenomes available in the NCBI GenBank database

No.SpeciesGenbank No.Length (bp)
1Tashkurgan sheepKF938337.116,618
2Yecheng sheepKF938338.116,618
3Qira Black sheepKF938326.116,617
4Sunite sheepKF938317.116,543
5Bashbay sheepKF938330.116,618
6Bayinbuluke sheepKF938331.116,618
7Tan sheepKF938336.116,618
8Small tailed Han sheepKF977847.116,617
9Duolang sheepKF938332.116,618
10Kirghiz sheepKF938334.116,617
11Qinghai Tibetan sheepKF938325.116,617
12Ujimqin sheepKF938319.116,620
13Hetian sheepKF938322.116,620
14Baerchuke sheepKF938321.116,620
15Turfan Black sheepKF938324.116,620
16Lanzhou large-tailed sheepKF938335.116,617
17Sahelian sheepKF977846.116,617
18FinnsheepKF938355.116,617
19Kulunda sheepKF938358.116,617
20Andi sheepKF938340.116,617
21Oxford down sheepKF938359.116,617
22Swiniarka sheepKF938349.116,617
23Pramenka sheepKF938347.116,617
24Mountain carpathian sheepKF938357.116,617
25Djallonke sheepKF977845.116,617
26Karakul sheepKF938348.116,618
27Minxian Black Fur sheepKF938318.116,620
28Ammon hodgsoni sheep (mouflon)JX101654.116,688
29Ammon isolate sheep (argali)HM236188.116,613

NCBI, National Center for Biotechnology Information.

Genome organization and structure analysis

All of the sequences were inspected and assembled using DNASTAR (DNASTAR, Inc., Madison, WI, USA) and DNAMAN 7.0 (Lynnon LLC., San Ramon, CA, USA) software, after which the target sequences were assessed by basic local alignment search tool (BLAST) searches of the NCBI database. Thirteen typical protein-coding genes and 2 rRNA genes were identified by BLAST searches of the NCBI database (Hu and Gao, 2014). Twenty-two tRNA genes and anticodons were annotated by tRNAscan-SE Search Server v.1.21 online (http://lowelab.ucsc.edu/tRNAscan-SE/) (Lowe and Eddy, 1997). Initiation and termination codons were identified by comparison of the obtained genomes with fully sequenced O. aries mitogenomes. The complete mitochondrial genome was annotated using the program Sequin (National Center for Biotechnology Information, Bethesda, MD, USA). A nucleotide structure chart was generated for the entire mitogenome using OGDRAW (http://ogdraw.mpimp-golm.mpg.de/). The A+T-content of the entire mitogenome was calculated using the EditSeq program included in the Lasergene software package (DNASTAR, Inc., USA), after which C, G, A, and T frequencies were calculated. Skewness was evaluated using the following formulas: GC-skew = (G−C)/(G+C) and AT-skew = (A−T)/(A+T).

Phylogenetic analysis

The complete mitogenomes of 16 Chinese sheep breeds and 13 foreign sheep breeds were obtained from the National Center for Biotechnology Information (Table 2) and used to construct a phylogenetic tree. Clustering analysis was performed using MEGA 6.0 software (Tamura et al., 2013).

RESULTS

Genome organization and structure

To characterize the mitochondrial genomes of sHL, AL, and SD sheep, 19 sets of primers were employed to amplify contiguous, overlapping segments of complete mtDNA from each breed. The complete mitochondrial genomes of AL, SD, and sHL sheep have been submitted to the NCBI GenBank database (accession numbers: KP981380 [sHL], KP702285 [AL], and KP981378 [SD]). The mitochondrial genomes of the sHL, AL, and SD breeds were circular molecules that were 16,617 bp, 16,613 bp, and 16,613 bp in size, respectively. The mitochondrial genomes of the sHL, AL, and SD breeds were similar in size to the mitogenomes of other sheep breeds (Hu and Gao, 2014). In addition, the gene arrangements and transcriptional directions of the mitochondrial genomes of the sHL, AL, and SD breeds were similar to those of typical O. aries mitogenomes (Hiendleder et al., 1998a, b; Hu and Gao, 2014). The mitochondrial genes and D-loop region arrangements of the mitochondrial genomes of the sHL, AL, and SD breeds were identical. The nucleotide structure of the sHL mitogenome is shown Figure 1.
Figure 1

Mitochondrial gene arrangements of Ovis aries. Gene organization of the small-tailed Hulun Buir sheep for instance. Different color areas represent 13 protein-coding, 22 tRNA genes, 12S and 16S rRNA genes and D-loop region. All protein-coding genes are encoded on the H-strand, with the exception of ND6 which is encoded on the L-strand. The two ribosomal RNA genes are encoded on the H-strand. Transfer RNA genes are designated by single-letter amino acid codes. Transfer RNA genes encoded on the H-strand and L-strand are shown outside and inside the circular gene map, respectively.

The nucleotide skewness of the coding strands of the mitogenomes of the sHL, AL, and SD breeds (AT-skew = 0.10, GC-skew = −0.33) was biased toward A and T (Table 3). The A-T rich pattern of the mitogenomes of the sHL, AL, and SD breeds was typical of vertebrate mitogenomes (Mayfield and McKenna, 1978; Hiendleder et al., 1998b). The nucleotide composition of the coding strand was biased toward T and A in C, similar to most O. aries mitogenomes (Jiang et al., 2013). In addition, some variation in the nucleotide skewness of the whole mitogenome and control region was identified among the sHL, AL, and SD breeds (Table 3).
Table 3

Base compositions of sheep mitochondrial genomes

RegionA/T content (%)Base composition (%)AT-skewnessGC-skewness


sHL/AL/SDAGTC
Protein-coding gene
 ND159.37/60.00/60.0031.73/32.25/32.2511.31/10.89/10.8927.64/27.75/27.7529.32/29.11/29.11
 ND264.01/63.63/63.6337.14/36.37/37.048.25/8.35/8.3526.87/26.58/26.5827.74/28.02/28.02
 COI59.48/59.35/59.3529.13/28.93/28.9316.12/16.44/16.4430.36/30.42/30.4224.40/24.21/24.21
 COX262.28/62.28/62.2835.23/35.09/35.0913.16/13.30/13.3027.05/27.19/27.1924.56/24.42/24.42
 ATP869.15/69.15/69.1541.79/41.79/41.795.97/5.97/5.7927.36/27.36/27.3624.88/24.88/24.88
 ATP660.09/59.65/59.6531.52/31.52/31.5211.78/11.63/11.6328.57/28.13/28.1328.13/28.72/28.72
 COX354.72/54.21/54.2126.15/25.64/25.6415.31/15.56/15.5628.57/28.57/28.5729.97/30.23/30.23
 ND357.80/58.38/58.3830.64/30.64/30.6411.85/11.85/11.8527.17/27.75/27.7530.35/29.77/29.77
 ND4L60.27/60.61/60.6130.30/30.30/30.3012.46/12.46/12.4629.97/30.30/30.3027.27/26.94/26.94
 ND460.96/60.81/60.8131.93/32.00/32.0010.74/10.67/10.6729.03/28.81/28.8128.30/28.52/28.52
 ND561.18/61.07/61.0733.77/33.66/33.6610.21/10.16/10.1627.40/27.40/27.4028.61/28.78/28.78
 ND664.96/64.77/64.7742.99/42.99/42.997.01/6.82/6.8221.97/21.78/21.7828.03/28.41/28.41
 Cyt b58.68/58.60/58.6031.49/31.40/31.4012.89/12.98/12.9827.19/27.19/27.1928.42/28.42/28.42
tRNA gene
 tRNA-Phe61.76/61.76/61.7636.76/36.76/36.7619.12/19.12/19.1225.00/25.00/25.0019.12/19.12/19.12
 tRNA-Val70.15/70.15/70.1537.31/37.31/37.3113.43/13.43/12.4332.84/32.84/32.8416.42/16.42/16.42
 tRNA-Leu60.00/60.00/60.0032.00/32.00/32.0017.33/17.33/17.3328.00/28.00/28.0022.67/22.67/22067
 tRNA-Ile73.91/73.91/73.9139.13/39.13/39.1315.94/15.94/15.9434.78/34.78/34.7810.14/10.14/1014
 tRNA-Gln61.11/61.11/61.1136.11/36.11/36.119.72/9.72/9.7225.00/25.00/25.0029.17/29.17/29.17
 tRNA-Met55.07/55.07/55.0727.54/27.54/27.5418.84/18.84/18.8427.54/27.54/27.5426.09/26.09/26.09
 tRNA-Trp64.18/64.18/64.1837.31/37.31/37.3116.42/16.42/16.4226.87/26.87/26.8719.40/19.40/19.40
 tRNA-Ala66.67/66.67/66.6739.13/39.13/39.1310.14/10.14/10.1427.54/27.54/27.5423.19/23.19/23.19
 tRNA-Asn54.79/56.16/56.1631.51/31.51/31.5115.07/15.07/15.0723.29/24.66/24.6630.14/28.77/28.77
 tRNA-Cys58.82/58.82/58.8227.94/27.94/27.9419.12/19.12/19.1230.88/30.88/30.8822.06/22.06/22.06
 tRNA-Tyr66.18/66.18/66.1829.41/29.41/29.4114.71/14.71/14.7136.76/36.76/36.7619.12/19.12/19.12
 tRNA-Ser57.97/57.97/57.9733.33/33.33/33.3315.94/15.94/15.9424.64/24.64/24.6426.09/26.09/26.09
 tRNA-Asp67.65/67.65/66.6739.71/39.71/39.1314.71/14.71/14.4927.94/27.94/27.5417.65/17.65/18.84
 tRNA-Lys66.18/63.24/63.2433.82/30.88/30.8814.71/17.65/17.6532.35/32.35/32.3519.12/19.12/19.12
 tRNA-Gly66.67/66.67/66.6733.33/33.33/33.3314.49/14.49/14.4933.33/33.33/33.3318.84/18.84/18.84
 tRNA-Arg74.63/74.63/75.0040.30/40.30/39.4111.94/11.94/11.7634.33/34.33/35.2913.43/13.43/13.24
 tRNA-His73.91/73.91/73.9139.13/39.13/39.1313.04/13.04/13.0434.78/34.78/34.7813.04/13.04/13.04
 tRNA-Ser62.30/63.93/63.9332.79/34.43/34.4316.39/14.75/14.7529.51/29.51/29.5121.31/21.31/21.31
 tRNA-Leu67.61/67.61/67.6139.44/39.44/39.4416.90/16.90/16.9028.17/28.17/28.1715.49/15.49/15.49
 tRNA-Glu65.22/65.22/65.2239.13/39.13/39.1311.59/11.59/11.5926.09/26.09/26.0923.19/23.19/23.19
 tRNA-Thr60.00/60.00/60.0035.71/35.71/35.7117.14/17.14/17.1424.29/24.29/24.2922.86/22.86/22.86
 tRNA-Pro57.58/57.58/57.5834.85/34.85/34.8513.64/13.64/13.6422.73/22.73/22.7328.79/28.79/28.79
 12SrRNA59.08/59.08/59.0836.85/36.85/36.8517.75/17.75/17.7522.23/22.23/22.2323.17/23.17/23.17
 16SrRNA62.19/62.19/62.1937.43/37.43/37.4317.06/17.06/17.0624.76/24.76/24.7620.75/20.75/20.75
 D-loop62.49/62.63/62.6332.85/33.05/33.0514.56/14.41/14.4129.64/29.58/29.5822.95/22.97/22.97
 Entire mitogenome61.04/60.09/61.0833.65/33.61/33.6613.14/13.14/13.0925.82/25.87/25.8327.39/27.38/27.420.10/0.10/0.10−0.33/−0.33/−0.33

sHL, small-tailed Hulun Buir sheep; AL, Altay sheep; SD, Shandong large-tailed sheep.

Four gene overlaps were found, all of which were on the H-strand. In addition, 17 intergenic spacers were detected, with 11 on the heavy strand (H-strand) and 6 on the light strand (L-strand). The overlaps were 1 to 40 bp in size, whereas the intergenic spacers were 1 to 32 bp in size (Table 4). The longest overlap (40 bp) was located between ATP synthase protein 8 (ATP8) and ATP synthase protein 6 (ATP6). The longest intergenic spacer (32 bp) occurred between tRNA-Asn and tRNA-Cys.
Table 4

Summary of sheep mitochondrial genomes

Length (bp)PositionCodonsAnticodonIntergenic nucleotideStrand



sHL/AL/SDStartEndStartStop
tRNA-Phe68/68/681/1/168/68/68GAA0H
rRNA958/958/95869/69/691,026/1,026/1,0260H
tRNA-Val67/67/671,027/1,027/1,0271,093/1,093/1,093/1,093TAC0H
rRNA1,574/1,571/1,5711,094/1,094/1,0942,667/2,664/2,6640H
tRNA-Leu75/75/752668/26652,742/2,739/2,739TAA2H
ND1955/955/9552745/2742/27423,699/3,696/3,696ATGT--1H
tRNA-Ile69/69/693701/3698/36983,769/3,766/3,766GAT−1H
tRNA-Gln72/72/723767/3764/37643,838/3,835/3,835TTG2L
tRNA-Met69/69/693841/3838/38383,909/3,906/3,906CAT0H
ND21,042/1,042/1,0423910/3907/39074,951/4,948/4,948ATAT--0H
tRNA-Trp67/67/674952/4949/49495,018/5,015/5,015TCA1H
tRNA-Ala69/69/695020/5017/50175,088/5,085/5,085TGC1L
tRNA-Asn73/73/735090/5087/50875,162/5,159/5,159GTT32L
tRNA-Cys68/68/685195/5192/51925,262/5,259/5,259GCA0L
tRNA-Tyr68/68/685263/5260/52605,330/5,327/537GTA1L
COI1,545/1,545/1,5455332/5329/53296,876/6,873/6,873ATGTAA−1H
tRNA-Ser69/69/696874/6871/68716,942/6,939/6,939TGA7L
tRNA-Asp68/68/686950/6947/69477,017/7,014/7,014GTC1H
COX2684/684/6847019/7016/70167,702/7,699/7,699ATGTAA3H
tRNA-Lys68/68/687706/7703/77037,773/7,770/7,770TTT1H
ATP8201/201/2017775/7772/77727,975/7,972/7,972ATGTAA−40H
ATP6679/679/6797936/7933/79338,614/8,611/8,611ATGT--1H
COX3784/784/7848616/8613/86139,399/9,396/9,396ATGT--0H
tRNA-Gly69/69/699400/9397/93979,468/9,465/9,465TCC0H
ND3346/346/3469469/9466/94669,814/9,811/9,811ATAT--2H
tRNA-Arg67/67/679817/9814/98149,883/9,880/9,880TCG1H
ND4L297/297/2979885/9882/988210,181/10,178/10,178ATGTAA7H
ND41,378/1,378/1,37810,175/10,172/10,17211,552/11,549/11,549ATGT--0H
tRNA-His69/69/6911,553/11,550/11,55011,621/11,618/11,618GTG0H
tRNA-Ser61/61/6111,622/11,619/11,61911,682/11,679/11,679GCT0H
tRNA-Leu71/71/7111,683/11,680/11,68011,753/11,750/11,750TAG0H
ND51821/182111,754/11,751/11,75113,574/13,571/13,571ATATAA−17H
ND6528/528/52813,558/13,555/13,55514,085/14,082/14,082ATGTAA0L
tRNA-Glu69/69/6914,086/14,083/14,08314,154/14,151/14,151TTC4L
Cyt b1139/113914,159/14,156/14,15615,298/15,295/15,295ATGTAA3H
tRNA-Thr70/70/7015,302/15,299/15,29915,371/15,368/15,368TGT0H
tRNA-Pro65/65/6515,371/15,368/15,36815,436/15,433/15,433TGG0L
D-loop1,180/1,180/1,18015,437/15,434/13,43416,617/16,613/16,613

sHL, small-tailed Hulun Buir sheep; AL, Altay sheep; SD, Shandong large-tailed sheep.

The sHL, AL, and SD mitogenomes each contained 13 protein-coding genes, mitochondrially encoded NADH dehydrogenase 1–6 (ND1–6), mitochondrially encoded NADH dehydrogenase 4L (ND4L), mitochondrially encoded cytochrome c oxidase I (CO1), mitochondrially encoded cytochrome c oxidase II (CO2), mitochondrially encoded cytochrome c oxidase III (CO3) and ATP6, ATP8, and CYTB. ND1–6 were encoded on the L-strand, whereas the other 12 genes were encoded on the H-strand (Table 4). The start codon of ND2, ND3, and ND5 was ATA, whereas the start of the other 10 genes was ATG. ND1, ND2, ATP6, COX3, ND3, and ND4 were inferred to end with an incomplete stop codon (T--), whereas the stop codon of the other genes was TAA. With the exceptions of COX2 and ATP8, the different A/T content of protein-coding genes is different from the other breeds. ATP8 had the highest A/T content (69.15%, 69.15%, and 69.15% in the sHL, AL, and SD breeds, respectively), whereas COX3 had the lowest A/T content (54.72%, 54.21%, and 54.21% in the sHL, AL, and SD breeds, respectively). The 22 tRNA encoded in the complete mitochondrial genome of the sHL, AL, and SD breeds formed a typical clover-leaf secondary structure, with the exception of tRNAser (AGN), in which the DHU arm formed a simple loop. The 22 tRNA genes ranged in size from 66 to 75 bp. Fourteen of the tRNA genes were encoded on the H-strand, whereas 8 tRNA genes were encoded on the L-strand (Table 4). With the exceptions of tRNA-Asn, tRNA-Asp, tRNA-Lys, and tRNA-Arg, the tRNAs have equal A/T content in the sHL, AL, and SD breeds. tRNA-Arg had the highest A/T content (74.63%, 74.63%, and 75.00% in the sHL, AL, and SD breeds, respectively), whereas tRNA-Asn had the lowest A/T content (54.79%, 56.16%, and 56.16% in the sHL, AL, and SD breeds, respectively). In the sHL, AL, and SD breeds, the A/T content of the 16S rRNA was 59.08%, whereas that of the 12S rRNA was 62.19%. These findings provide an important foundation for further exploration of the taxonomic status of O. aries. We constructed a phylogenetic tree using the complete mtDNA (including the control region) of 32 breeds of sheep via the UPGMA method (Tamura et al., 1993). The complete dataset for the 32 sheep breeds included 2 parts: one part was from our sequencing data, whereas the other part was downloaded from the NCBI. The bootstrap consensus tree inferred from 1,000 replicates was taken to represent the taxonomy of the analyzed sheep breeds (Felsenstein, 1985). Branches corresponding to partitions reproduced in less than 50% of bootstrap replicates were collapsed. The evolutionary distances were computed using the maximum composite likelihood method (Tamura et al., 2004) and provided as the number of base substitutions per site. The analysis involved 32 nucleotide sequences. First, second, third, and noncoding codon positions were included. All positions containing gaps and missing data were eliminated. There were a total of 16,530 positions in the final dataset. Clustering analyses were conducted using MEGA6.0 (Tamura et al., 2013). Phylogenetic analysis of the complete mitogenome showed that the Chinese local sheep breeds were clustered into a single group, whereas the foreign breeds were closely clustered into another group (Figure 2). The mouflon (O. orientalis orientalis) (ammon_isolate sheep) and argali (O. ammon) (ammon_hodgsoni sheep) were placed into a separate branch as outgroups. The phylogenetic tree constructed using the D-loop of the Chinese and foreign sheep breeds showed a disordered distribution (Figure 3). These results indicate that evolutionary analyses utilizing full mitogenomes can provide information regarding the relationships between distantly related species that cannot be generated by analysis of the D-loop region only.
Figure 2

Evolutionary relationships of sheep based on the mitogenomes. Phylogenetic trees of Ovis aries constructed by the complete mitochondrial genome of 30 sheep. Ammon hodgsoni and Ammon isolate h77 were selected out groups. The evolutionary distances were computed using the Maximum Composite Likelihood method. Tree topologies was inferred using the UPGMA method. The asterisk indicates the sequence generated in this research.

Figure 3

Evolutionary relationships of sheep based on the D-loop region. Results of phylogenetic analyses via UPGMA method using analysis indicated evolutionary relationships among 30 individuals based on mtDNA D-loop region. Ammon hodgsoni and Ammon isolate h77 were selected out groups. The evolutionary distances were computed using the Maximum Composite Likelihood method. The asterisk indicates the sequence generated in this research. UPGMA, unweighted pair group method with arithmetic means; mtDNA, mitochondrial DNA.

DISCUSSION

The complete mitochondrial genomic DNA sequences of 3 breeds of indigenous Chinese sheep, AL, SD, and sHL, were 16,613 to 16,617 bp in length and contained 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 putative control region. The organization and structure of the mitogenomes of the AL, SD, and sHL sheep were similar to those of other domestic sheep, including the Texel and Merinolandschaf breeds (Hiendleder et al., 1998a, b; Hu and Gao, 2014). The minor differences in the sizes of the genomes of domestic sheep were due primarily to changes in the control region. The AL, SD, and sHL mitogenomes had similar A/T content (approximately 60% to 61%), which was also similar to that of the Texel, Merino, and Merinolandschaf breeds (Hiendleder et al., 1998a, b; Lancioni et al., 2013; Hu and Gao, 2014). The gene overlaps and intergenic spacers among 1 bp to 7 bp at the large, other than tRNA-Ala and tRNA-Asn, ATP8, and ATP6, also ND5 and ND6 were 32, −40, −17, respectively. The relative organization of the 37 genes and control regions comprising the mitogenomes of the sHL, AL, and SD breeds was identical with that of other domestic sheep breeds (Hiendleder et al., 1998a, b; Hu and Gao, 2014). The 13 protein-coding genes in the mitogenomes of the sHL, AL, and SD breeds began with initiation codons ATG or ATA, but only 3 genes (ND2, ND3, and ND5) used the latter. About half of the 13 protein-coding genes had incomplete termination codons, whereas the others had the typical TAA stop codon. Incomplete termination codon (T) is in the process of transcription by TAA after the formation affixed Poly (A) terminal translated (Clayton, 1991). Incomplete stop codons are commonly found in many vertebrate mitochondrial genes (Wang et al., 2014). The phylogenetic tree based on the mitogenome clusters the sHL and SD sheep into the same clade, suggesting they have closer relationship than AL. This agrees with the fact that both of SD and sHL are fat–tailed sheep while AL are fat-rump tailed sheep. In addition to details regarding the organization of the mitochondrial genome of indigenous Chinese sheep, this study provides information regarding the evolutionary relationship between the mitogenomes of indigenous Chinese sheep and foreign sheep. The NJ, ML, and UPGMA trees constructed according to the maximum composite likelihood method showed the same results; therefore, we showed only the UPGMA tree. Our phylogenetic tree, constructed using the entire mitogenome, clearly shows the evolutionary separation between indigenous Chinese sheep and foreign sheep, whereas the phylogenetic tree constructed using only the control region did not show this relationship.

CONCLUSION

The present study provides the complete mitochondrial genome DNA sequences of the small-tailed Hulun Buir sheep, Altay sheep, and Shandong large-tailed sheep, which are indigenous to China. The mitogenomes of the small-tailed Hulun Buir sheep, Altay sheep, and Shandong large-tailed sheep were 16,617 bp, 16,613 bp, and 16,613 bp in length, respectively, and included a typical set of 37 genes: 13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes, as well as a control region. The gene annotations and genome organizations of the mitogenomes of small-tailed Hulun Buir sheep, Altay sheep, and Shandong large-tailed sheep have been submitted to the GenBank database. Phylogenetic relationships determined via analysis of complete mitochondrial genomes may be more precise than those determined via analysis of only the mitochondrial control region.
  20 in total

1.  Analysis of the genetic diversity and the phylogenetic evolution of Chinese sheep based on Cyt b gene sequences.

Authors:  Xin Wang; Yue-Hui Ma; Hong Chen
Journal:  Yi Chuan Xue Bao       Date:  2006-12

2.  Complete sequence of the yak (Bos grunniens) mitochondrial genome and its evolutionary relationship with other ruminants.

Authors:  Zhiliang Gu; Xingbo Zhao; Ning Li; Changxing Wu
Journal:  Mol Phylogenet Evol       Date:  2006-07-14       Impact factor: 4.286

Review 3.  Replication and transcription of vertebrate mitochondrial DNA.

Authors:  D A Clayton
Journal:  Annu Rev Cell Biol       Date:  1991

4.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

5.  Variation in the control region sequence of the sheep mitochondrial genome.

Authors:  N J Wood; S H Phua
Journal:  Anim Genet       Date:  1996-02       Impact factor: 3.169

6.  tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence.

Authors:  T M Lowe; S R Eddy
Journal:  Nucleic Acids Res       Date:  1997-03-01       Impact factor: 16.971

7.  The complete mitochondrial genome sequence analysis of Tibetan argali (Ovis ammon hodgsoni): implications of Tibetan argali and Gansu argali as the same subspecies.

Authors:  Lichun Jiang; Gaochao Wang; Shuai Tan; Shu Gong; Min Yang; Quekun Peng; Rui Peng; Fangdong Zou
Journal:  Gene       Date:  2013-03-28       Impact factor: 3.688

8.  Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees.

Authors:  K Tamura; M Nei
Journal:  Mol Biol Evol       Date:  1993-05       Impact factor: 16.240

9.  The complete mitochondrial genome of domestic sheep, Ovis aries.

Authors:  Xiao-di Hu; Li-zhi Gao
Journal:  Mitochondrial DNA A DNA Mapp Seq Anal       Date:  2014-08-27       Impact factor: 1.514

10.  Phylogenetic relationships of three Italian merino-derived sheep breeds evaluated through a complete mitogenome analysis.

Authors:  Hovirag Lancioni; Piera Di Lorenzo; Simone Ceccobelli; Ugo A Perego; Arianna Miglio; Vincenzo Landi; Maria T Antognoni; Francesca M Sarti; Emiliano Lasagna; Alessandro Achilli
Journal:  PLoS One       Date:  2013-09-09       Impact factor: 3.240

View more
  1 in total

1.  The genetic profiles and maternal origin of local sheep breeds on Java Island (Indonesia) based on complete mitochondrial DNA D-loop sequences.

Authors:  Alek Ibrahim; I Gede Suparta Budisatria; Rini Widayanti; Wayan Tunas Artama
Journal:  Vet World       Date:  2020-12-11
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.